ID: 1166493082

View in Genome Browser
Species Human (GRCh38)
Location 19:43275894-43275916
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 682
Summary {0: 9, 1: 0, 2: 5, 3: 68, 4: 600}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166493082_1166493086 22 Left 1166493082 19:43275894-43275916 CCATCTTCTCTGCAAACACACAG 0: 9
1: 0
2: 5
3: 68
4: 600
Right 1166493086 19:43275939-43275961 TATTGGGAGCCCTGTATGCAAGG 0: 5
1: 1
2: 1
3: 19
4: 168
1166493082_1166493085 6 Left 1166493082 19:43275894-43275916 CCATCTTCTCTGCAAACACACAG 0: 9
1: 0
2: 5
3: 68
4: 600
Right 1166493085 19:43275923-43275945 TCTCTGTGTTCATTTCTATTGGG 0: 7
1: 3
2: 10
3: 94
4: 855
1166493082_1166493087 25 Left 1166493082 19:43275894-43275916 CCATCTTCTCTGCAAACACACAG 0: 9
1: 0
2: 5
3: 68
4: 600
Right 1166493087 19:43275942-43275964 TGGGAGCCCTGTATGCAAGGTGG 0: 5
1: 3
2: 1
3: 12
4: 131
1166493082_1166493084 5 Left 1166493082 19:43275894-43275916 CCATCTTCTCTGCAAACACACAG 0: 9
1: 0
2: 5
3: 68
4: 600
Right 1166493084 19:43275922-43275944 ATCTCTGTGTTCATTTCTATTGG 0: 7
1: 3
2: 7
3: 72
4: 690

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166493082 Original CRISPR CTGTGTGTTTGCAGAGAAGA TGG (reversed) Intergenic
900326641 1:2111455-2111477 CTGGGTGTCTCCAGAGAAGCTGG + Intronic
900881160 1:5382334-5382356 CCTTGTGTCTGCAGAGTAGAGGG + Intergenic
900958591 1:5904866-5904888 ATGTGTGTTTGCATAGGGGATGG + Intronic
902744504 1:18464456-18464478 GTGTGTGTGTGCAGAGCAGAGGG - Intergenic
903223563 1:21882388-21882410 GTGTGTGTGTACATAGAAGAGGG - Intronic
904295340 1:29516643-29516665 CTGTGTGTTGGGAGTGAAGTGGG + Intergenic
905950123 1:41943561-41943583 TTGTCTGTGTGTAGAGAAGATGG - Intronic
905989607 1:42323610-42323632 CTATGGGTTTACTGAGAAGAGGG - Intronic
906014199 1:42559397-42559419 GTGTGTCTTTGCACATAAGATGG - Intronic
906043281 1:42806069-42806091 TTTTGTGTTTTCAGAGAAGTAGG - Intergenic
906130387 1:43452145-43452167 CTGTGGGTGTGCGGAGAAGGGGG - Exonic
906834816 1:49072131-49072153 GTGTGTCTTTGCACATAAGATGG + Intronic
907217825 1:52880867-52880889 CTGTGAGATCTCAGAGAAGAGGG + Intronic
908536949 1:65087125-65087147 TGGTGTGTGTGCACAGAAGAAGG + Intergenic
908693061 1:66804379-66804401 CTGTGTCCTTTCACAGAAGATGG + Intergenic
908896731 1:68909663-68909685 CTGTGTGTTTCCAGGGTTGAGGG - Intergenic
909449667 1:75784518-75784540 CTGTGTGTGTGGCGAGGAGAGGG + Intronic
909809248 1:79910459-79910481 CTATGTGTTTGGAGAGGATATGG - Intergenic
910728585 1:90364660-90364682 TTGTGTGTTAGCAGAGCAAAAGG + Intergenic
911685194 1:100767713-100767735 CTGTGAGTATGCAGAGAAAAAGG + Intergenic
911840890 1:102680493-102680515 CTGCCTTTATGCAGAGAAGAAGG - Intergenic
912029149 1:105217298-105217320 CTGTGAGTTTGCAGAGTATCTGG + Intergenic
912036590 1:105324486-105324508 CTCTGTCTTTGCAAAGGAGAGGG - Intergenic
912456066 1:109798223-109798245 GTGTGTGTTCCCAGAGAACAAGG + Intergenic
913547902 1:119887600-119887622 ATGTGTTTGTGAAGAGAAGAAGG - Intergenic
914229154 1:145749028-145749050 CTGTTTCTTCTCAGAGAAGAGGG - Intronic
914295053 1:146313339-146313361 CGGCGTGGTTGCAGAGAAAATGG - Intergenic
914556094 1:148764122-148764144 CGGCGTGGTTGCAGAGAAAATGG - Intergenic
914860772 1:151384067-151384089 CTATGTGTTTGCTGTGAAGATGG - Intergenic
916292058 1:163177684-163177706 CTGCGTGTTTGCCGTGGAGAGGG - Intronic
916735781 1:167605736-167605758 CTGTCTGGTTGGAGAGGAGAAGG - Intergenic
916962391 1:169902439-169902461 GTGTTTGTTTGCAGGGAGGAGGG - Intergenic
917056391 1:170986547-170986569 CTTTGTGGTTGCAGAGAGTAGGG + Exonic
917348003 1:174048899-174048921 CTGTGAGTTAGGGGAGAAGATGG - Intergenic
917400948 1:174649088-174649110 CTGTGTCTTTGCACATGAGATGG + Intronic
917900562 1:179539077-179539099 GTGTGTCTTTGCACAGGAGATGG + Intronic
918158948 1:181879170-181879192 CTGTGAGGTTGCAGAGAAAAAGG - Intergenic
918652286 1:186980118-186980140 TTTTGTGTTTGTAGTGAAGACGG + Intronic
918801978 1:188984457-188984479 GTGTGTCTTTGCACATAAGACGG + Intergenic
918829835 1:189380489-189380511 ATGAGTGTTACCAGAGAAGAAGG - Intergenic
919051178 1:192513349-192513371 CTGTGTGGATGTAGAGAAGTAGG + Intergenic
919076289 1:192817170-192817192 CTGTCTATTTGGAGTGAAGAGGG + Intergenic
919493467 1:198234846-198234868 CAGTGTGAATGCAGAGAGGAGGG - Intronic
919786973 1:201264358-201264380 CTGTGTGTTTGAAAACAACAAGG - Intergenic
920608228 1:207411013-207411035 CTGTGTTGTTGCAAAGAACATGG - Intergenic
921089120 1:211826098-211826120 CTGTCTGTAGGCACAGAAGATGG - Intronic
921363687 1:214353912-214353934 CTGTCTATTTGCAGAAAATATGG + Exonic
921829001 1:219706233-219706255 CCGTGAGGTTGCAGAGAAGAAGG + Intronic
922386863 1:225095026-225095048 CAGTGAGGTTGCAGAGAAAAGGG + Intronic
922488711 1:225998284-225998306 ATGTGTGTTTGCAAATAATACGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924055177 1:240118090-240118112 CAGTGTGTTTGAGGAGGAGAAGG + Intronic
924465932 1:244299263-244299285 TTGTGTCTCTGCAGAGAAGCAGG - Intergenic
1062859863 10:802997-803019 CTCTGGGTTTACTGAGAAGAGGG + Intergenic
1062933935 10:1371818-1371840 TTGTGTGGATGCAGAGAAAAGGG + Intronic
1062958422 10:1555349-1555371 TTGTGAGGTTGCAGAGAAAAGGG - Intronic
1063374400 10:5545385-5545407 CTGTGTGTGTCCAGTGGAGAAGG + Intergenic
1063379690 10:5576648-5576670 CTGTGTGTGTGCAGGGAGTAGGG - Intergenic
1064103739 10:12484338-12484360 CTCTGTGTTTGGAGGGAGGAGGG + Intronic
1065413687 10:25460640-25460662 TTGTTTGTTTCCAGAGAAAAGGG - Intronic
1066046612 10:31600874-31600896 CTGTGTGTCTTCTGAGAAGCAGG - Intergenic
1067120909 10:43471409-43471431 CTGTGTGTTTGCAGCTCAGTTGG + Intronic
1067189369 10:44056775-44056797 TTCTTTGTTTGCAGAGTAGAGGG + Intergenic
1067268349 10:44767133-44767155 CTGTGGCTTTGGAGATAAGAGGG + Intergenic
1067507677 10:46870504-46870526 TGGTGGGTTTGCTGAGAAGATGG + Intergenic
1067654578 10:48181341-48181363 TGGTGGGTTTGCTGAGAAGATGG - Intronic
1068087761 10:52395877-52395899 CTGTAGGTGTGCACAGAAGAGGG - Intergenic
1068435499 10:56985683-56985705 GTGTGTCTTTGCATATAAGATGG + Intergenic
1068491495 10:57730228-57730250 CAGTGAGGTTGCAGAGAAAAGGG - Intergenic
1069407472 10:68117324-68117346 CTATGTGGGTGCAGAGACGATGG + Intronic
1071059279 10:81550369-81550391 GTGTGTCTTTGCACATAAGATGG - Intergenic
1071567229 10:86677625-86677647 CTGTGTGGTTACACTGAAGATGG + Intronic
1072097847 10:92199875-92199897 CTGTGTGTTTGGAGAAAAATAGG - Intronic
1073305399 10:102499985-102500007 GTGTGTGTGTGGAGAGAAGTGGG + Intronic
1073600780 10:104844013-104844035 CTGTTTGTTTGCAGAGAACTAGG + Intronic
1073669122 10:105567677-105567699 CTGTATGTTTAAAGAGAAAAGGG + Intergenic
1073779154 10:106818073-106818095 CTTTATGCTTGCAGAGAACAAGG + Intronic
1073965768 10:108987784-108987806 ATGTGTGTTTGCTGAGAAAAGGG + Intergenic
1073985036 10:109198352-109198374 GTGTGTCTTTGCACATAAGATGG - Intergenic
1074016520 10:109540469-109540491 GTGTGTCTTTGCACATAAGATGG + Intergenic
1074226272 10:111487622-111487644 GTGGGGGTTTGCAGGGAAGATGG - Intergenic
1074724875 10:116297633-116297655 CTGTGTGTTTGTGGAGAGGACGG + Intergenic
1075068851 10:119307777-119307799 CAGTGTGTATGCAGAAAGGAGGG - Intronic
1075428549 10:122362161-122362183 CTGTGAGCCTGTAGAGAAGATGG + Intergenic
1075913843 10:126149051-126149073 CTGTCTCTTTACAGGGAAGAGGG - Intronic
1076102464 10:127794114-127794136 CTGTGGGTTTGCAGACTTGAGGG - Intergenic
1076306535 10:129469124-129469146 CTGTCCTTTTGCAGGGAAGAAGG + Intronic
1076538184 10:131196355-131196377 CTGTGCATTTGCAGGGAAGGTGG + Intronic
1076797357 10:132804832-132804854 CCCTGTGTTTCCAGAGAGGACGG + Intergenic
1076835957 10:133021017-133021039 GTGTGTGTTTGGGGAGAAGCTGG + Intergenic
1077710693 11:4533679-4533701 GTGTGTCTTTGCACATAAGATGG - Intergenic
1079809718 11:24982118-24982140 TTGTGAGGTTGCAGAGAAAAGGG + Intronic
1079810384 11:24991702-24991724 TTGTGTGGTTGCAGTGAACAGGG - Intronic
1080389689 11:31833636-31833658 CTGTGGGTTTGAGGTGAAGAGGG + Intronic
1080395294 11:31884553-31884575 CTGTGTGTCTGTGGAGAGGAGGG + Intronic
1082131459 11:48494869-48494891 CTGTGTATTTGAAGAGCAGATGG + Intergenic
1082902686 11:58272792-58272814 CTGTGTGTCTGTGGAGAGGACGG + Intergenic
1085066595 11:73500942-73500964 GTGTGTCTTTGCACATAAGATGG - Intronic
1085812461 11:79696700-79696722 CTAGCTGTTTGCAGAAAAGAGGG + Intergenic
1085904947 11:80749149-80749171 ATGTGGGTTTACAGGGAAGATGG + Intergenic
1086969724 11:93067262-93067284 CTCTGTGTCTTCAGAGATGAGGG + Intergenic
1087652389 11:100883170-100883192 CTGTGTGTTGAAAGAGATGAGGG - Intronic
1087770047 11:102199022-102199044 CTATGTGTTTGTGGAGGAGAAGG + Intronic
1087843688 11:102946901-102946923 CTGTGTGTATGTAGAGATGGAGG + Intronic
1088603480 11:111505982-111506004 TGGTGTGTATGCAGAGAAAAGGG + Intronic
1089167657 11:116489478-116489500 CAGTGTGGTGGCAGAGAACAAGG + Intergenic
1089566975 11:119376810-119376832 ATGTGAGACTGCAGAGAAGATGG - Intronic
1090590576 11:128262660-128262682 CTCTGTGTATGCAGAGTAGTGGG + Intergenic
1090685213 11:129109557-129109579 CAGTGAGTATGCAGAGAAAAGGG - Intronic
1091304060 11:134525594-134525616 CAGGGTGTGTGCACAGAAGAGGG - Intergenic
1091358435 11:134956094-134956116 CTATCTGTTTAGAGAGAAGAGGG + Intergenic
1091903790 12:4166074-4166096 GTGTGTGTGTGCAGGGAAGAGGG - Intergenic
1092259235 12:6943789-6943811 GTATGTGTTTGGAGAGAAGATGG - Intronic
1092552270 12:9515661-9515683 CTCTGTGTCTGCAATGAAGAAGG - Intergenic
1092874555 12:12836773-12836795 CTGTGTGTCTTCAGATAAGAAGG - Intergenic
1093092877 12:14941035-14941057 CTGTGAGACTGCAGAGAAAAGGG + Intergenic
1093230635 12:16538193-16538215 CTGTGTTTTAGCAGAGAGAATGG - Intronic
1093837858 12:23858553-23858575 TGGTGAGGTTGCAGAGAAGAGGG + Intronic
1093930065 12:24947156-24947178 GTGTGTGTGTGGAGGGAAGACGG - Intronic
1095088986 12:38086733-38086755 CTGTTTGGTTGCAGAGAAAGTGG - Intergenic
1095211851 12:39503633-39503655 CTATGTGTTTTCAAAGAAGATGG + Intergenic
1095674467 12:44899865-44899887 GTGTGTCTTTGCACATAAGATGG - Intronic
1096049105 12:48591266-48591288 TGGTGAGTTTGCAGAGAAAAAGG + Intergenic
1096197195 12:49656354-49656376 GTGTGTGTTTGCGGGGGAGAAGG - Intronic
1098047448 12:66415428-66415450 CGGTGAGGTTGCAGAGAAAAAGG + Intronic
1098568896 12:71967227-71967249 CCTTGTGCCTGCAGAGAAGAAGG - Intronic
1099054268 12:77818552-77818574 CAGTGTCTTTGCAGGGATGAGGG + Intergenic
1099232362 12:80041604-80041626 CAGAGTGTTTACAGCGAAGAAGG - Intergenic
1099254613 12:80300393-80300415 CTGGGTGGCTGCAGAGAAGCAGG + Intronic
1099265868 12:80447040-80447062 CAGTGTGGATGCAGAGAAAAGGG - Intronic
1099367087 12:81780581-81780603 CTGTGAGGTTGCAGAGGAAAGGG + Intergenic
1099550811 12:84041644-84041666 GTGTGTGTTTGCACATGAGATGG + Intergenic
1099951978 12:89313812-89313834 CTGTATTTTGGCAGAGAAAACGG + Intergenic
1100100243 12:91094739-91094761 CAGTGTGTTTGGAGAGGAGTGGG + Intergenic
1101994298 12:109513841-109513863 CTTGGTGTTTTCAGAGCAGATGG + Intronic
1102974082 12:117193610-117193632 CTGAGTGGCTGCAAAGAAGATGG - Intergenic
1103214502 12:119191194-119191216 CTGTTTCTTTGCAGAAAAAAAGG - Intronic
1103331366 12:120156526-120156548 CTGTGCCTTTGCAGAGCAGGAGG - Exonic
1103830452 12:123775051-123775073 CTGTGTGTGTGCAGAGGGCATGG + Intronic
1104729518 12:131097331-131097353 CTGTGTGTTTGAACAGATGCTGG - Intronic
1105607315 13:21936898-21936920 GTGTGTGTGTGTAGAGAAGGTGG + Intergenic
1106377207 13:29201398-29201420 GTGTGTCTTTGCACACAAGATGG + Intronic
1107325590 13:39238923-39238945 GTGTGTGTTTGCACATGAGATGG + Intergenic
1107480186 13:40779704-40779726 GTGTTTGTTTGTAGAGAAGGGGG - Intergenic
1107525027 13:41221894-41221916 CTGTGTGTTTCCGGAGGAAAGGG + Intronic
1108031315 13:46232418-46232440 TTTTGTGTTTGCACAAAAGATGG + Intronic
1108623135 13:52203293-52203315 GTGTTTGTTTGTAGAGAAGGAGG - Intergenic
1108637305 13:52348357-52348379 CTGTGTTTCTGCAGGGATGAAGG - Intergenic
1108663594 13:52607747-52607769 GTGTTTGTTTGTAGAGAAGGAGG + Intergenic
1108860011 13:54844943-54844965 GTGTGTGTTTGCACAGTAAAAGG - Intergenic
1109048492 13:57444797-57444819 CTGTGTGTGTACAGACAACAAGG + Intergenic
1109133217 13:58613976-58613998 TTGTGAGGTTGCAGAGAAAAGGG + Intergenic
1110590530 13:77251875-77251897 CAGGGTGTTTGGAGAGCAGAGGG - Intronic
1111444793 13:88333460-88333482 ATGTGTATTGCCAGAGAAGAAGG + Intergenic
1111447442 13:88366253-88366275 GTGTTTGTTTTAAGAGAAGATGG - Intergenic
1111456666 13:88493308-88493330 ATGAGTATTTCCAGAGAAGAAGG - Intergenic
1112233609 13:97614049-97614071 CAGTTTATTTGCAGAGAACAAGG + Intergenic
1113667924 13:112153844-112153866 CTGTGTGTTTGTAGATAAACAGG + Intergenic
1114206614 14:20577930-20577952 CTGTGTTTTGGCAGAAAATATGG - Intergenic
1114776246 14:25485293-25485315 CTGTGTATTTCCAGATCAGATGG + Intergenic
1114893279 14:26952739-26952761 CACTGTGTTTGCAGGAAAGATGG + Intergenic
1114966341 14:27965846-27965868 CTGTGGGTTTTTAGAGAATATGG + Intergenic
1115043217 14:28956457-28956479 ATGTGTGTTTGCACATAAGATGG - Intergenic
1115491269 14:33960439-33960461 GTGTGTGTTTTCAGTGGAGACGG - Intronic
1116024789 14:39502082-39502104 CGGTGAGGTTGCAGAGAAAAGGG - Intergenic
1116138244 14:40955101-40955123 TTGTGAGTTTACAGAGAAAAGGG - Intergenic
1116648445 14:47560032-47560054 CAGTGAGGTTGCAGAGAAAAGGG - Intronic
1117166993 14:53045394-53045416 GTCAGTTTTTGCAGAGAAGAGGG + Exonic
1117630178 14:57683111-57683133 CTATGTGTTTGCAGACAACCAGG - Intronic
1118167863 14:63355859-63355881 GTGTGTGTGTGCAGGGAACAGGG - Intergenic
1119601490 14:75979915-75979937 CTGTGTGTGTGGAAGGAAGAGGG - Intronic
1119725851 14:76921412-76921434 GTGTCTTTTTGCAGGGAAGAAGG - Intergenic
1119746649 14:77049403-77049425 ATGTGTGTCTGCAGTGATGATGG + Intergenic
1119876868 14:78067566-78067588 TGGTGAGGTTGCAGAGAAGAGGG - Intergenic
1120058691 14:79955814-79955836 ATGTGTCTTTGCACATAAGATGG - Intergenic
1120064357 14:80022693-80022715 CTGTGAGGTTGCAGAGAAAAGGG - Intergenic
1120513800 14:85446355-85446377 CTGCGTGTTAGCAGAGGGGAAGG + Intergenic
1120997817 14:90429780-90429802 CTGTGAGTTTCCTGAGAACAGGG - Intergenic
1121044199 14:90776032-90776054 CTCTGTGTATGCAGAAAAGAAGG + Intronic
1121143129 14:91558836-91558858 GTGTGTCTTTGCACATAAGATGG - Intergenic
1121611925 14:95287119-95287141 CTGTGAATTTGCACAGAGGAGGG + Intronic
1121706225 14:95996458-95996480 TGGTGAGTTTGCAGAGAAAAAGG - Intergenic
1121759712 14:96434828-96434850 CTCTGTCTTTGGAAAGAAGAGGG - Intronic
1121917857 14:97852535-97852557 CTGTGTGTGTGCACAGAAAGGGG - Intergenic
1122265417 14:100544534-100544556 CAGTGTGTTCACAGAGAAAATGG + Intronic
1122293642 14:100693076-100693098 CGGCGTGTTTGCAGAGTACATGG - Intergenic
1122507245 14:102239481-102239503 GTGCCTGTTTGCAGAGGAGATGG - Intronic
1124707014 15:31974609-31974631 CTGGGTGCTTGGAGAGGAGACGG + Intergenic
1125408650 15:39381753-39381775 CGGTGAGGTTGCAGAGAAAAGGG + Intergenic
1125644256 15:41258259-41258281 GTGTGTGTTTGCTAAGAATAGGG + Intronic
1125766805 15:42141774-42141796 TTGTGTGTTTTTGGAGAAGATGG - Exonic
1125825457 15:42672636-42672658 TTGTGTGTTTGCAGAGAGGAGGG + Intronic
1125984957 15:44040919-44040941 GTGTGTCTTTGCAGATGAGATGG - Intronic
1126993383 15:54410008-54410030 CGGTGAGGTTGCAGAGAAAAGGG - Intronic
1127369792 15:58328880-58328902 CAGTGAGATTGCAGAGAAAAGGG + Intronic
1128133940 15:65249097-65249119 CCATGTTTTTGCAGAGAAGCAGG - Intronic
1128506373 15:68275915-68275937 AAGTGTGTTGGCAGAGGAGAGGG + Intergenic
1129055494 15:72817077-72817099 GTGTGTGTTTGCAAAGTGGAGGG + Intergenic
1129107552 15:73320040-73320062 GTGTGTGTAAGTAGAGAAGAGGG + Exonic
1129633162 15:77284875-77284897 GTGTGTTTTAGTAGAGAAGATGG - Intronic
1129906915 15:79194949-79194971 ATGTGAGTTTGGAGAGATGATGG - Intergenic
1130039374 15:80392233-80392255 CTGTGTATTTCCTGAGAAAAAGG - Intronic
1131698451 15:94905910-94905932 CTGTCTTTTTGCAGTGTAGAAGG - Intergenic
1131904949 15:97133107-97133129 GTGTGTGTTTGGAGAGATGGTGG + Intergenic
1132078484 15:98843964-98843986 TTGTTTGTTTTCAGAGCAGATGG + Intronic
1133636827 16:7674614-7674636 ATGTGTGTTTCCAGACAAGACGG - Intronic
1134239451 16:12494600-12494622 CTGTGAGCTGGTAGAGAAGATGG - Intronic
1135676370 16:24418215-24418237 CTGTGTTTTGGAAGAGACGATGG - Intergenic
1136040313 16:27573524-27573546 ATGTGTGTGTGCACAGAGGAAGG + Intronic
1136105278 16:28025774-28025796 CAGTGTGTTGGGACAGAAGAGGG + Intronic
1136667468 16:31824810-31824832 CCGAGAGTTTGGAGAGAAGAAGG + Intergenic
1137069307 16:35886795-35886817 AGGTGAGTTTGCAGAGAAAAAGG + Intergenic
1140132973 16:72180283-72180305 CTGTGGCTTTGCAGAAAAGCAGG - Intergenic
1140692909 16:77501469-77501491 CTGTGTGTTTTCAAATGAGAGGG - Intergenic
1141035204 16:80620281-80620303 CTGTGTGTTTGCAGACCCAACGG - Intronic
1141083684 16:81076600-81076622 CTGTGTGAGAGTAGAGAAGACGG - Intronic
1141137006 16:81473022-81473044 CTGAGGGTATGCAGAGGAGATGG - Intronic
1141234040 16:82198998-82199020 CTGTGTGTGTGGGGAGAGGAGGG - Intergenic
1141820317 16:86441315-86441337 CTCTGTGATTGCAGAAAATAGGG - Intergenic
1141845711 16:86607529-86607551 CTGTGTGTTGGGAGAGAAGGGGG - Intergenic
1142066217 16:88064549-88064571 CTGAGGGTTTGCCGAGGAGAGGG + Intronic
1142184251 16:88686876-88686898 CTGTGAGTTTGCAGAAGGGATGG - Intergenic
1143488084 17:7266231-7266253 CAGTGAGTTTGGAGAGAAGCTGG - Intergenic
1143790676 17:9292887-9292909 CCTTGTGTTTGGAGAGAAGATGG - Intronic
1143952969 17:10648159-10648181 CTGTGTGGTTGTAGGGAGGAGGG - Intronic
1143989490 17:10944588-10944610 GTGTGTGTGTGCACAGAAGAGGG + Intergenic
1145201162 17:20946071-20946093 TTGTGAGTTTGCAGAGAAAAGGG - Intergenic
1146312242 17:31778461-31778483 CTGTGTGGATGCAGAGCTGAGGG - Intergenic
1146533991 17:33633896-33633918 CTGGGGCTTTGCACAGAAGATGG - Intronic
1147181883 17:38691578-38691600 CTCTGTTTTTGCTGAGAAGCTGG - Intergenic
1147484628 17:40800777-40800799 CAGTGGGGATGCAGAGAAGATGG + Intergenic
1147562204 17:41516166-41516188 CCGTGTGCTGGCAGAGATGAGGG - Exonic
1147845579 17:43402023-43402045 TTGTGTGTTTGCACAAAAGGTGG - Intergenic
1148044599 17:44735338-44735360 CTGTGTATCTGCATAGAAGGGGG - Intronic
1148919622 17:51019103-51019125 CTGTGTCTTCACATAGAAGAAGG - Intronic
1149351976 17:55799461-55799483 GTGTGTGTTTGCACATGAGATGG + Intronic
1150038125 17:61826765-61826787 CGGTGAGGTTGCAGAGAAAAAGG + Intronic
1150334863 17:64323323-64323345 CTGTGTATTTCCAAAGAACAAGG + Exonic
1150532604 17:66000201-66000223 CAGTGAGGTTGCAGAGAAAAAGG - Intronic
1151191540 17:72401790-72401812 CTGTCTTTCAGCAGAGAAGATGG + Intergenic
1151906171 17:77050770-77050792 CAGTGCGTTGGCAGAGAGGATGG + Intergenic
1151931071 17:77231749-77231771 CAGAGTGTTTGCACAGAAGCCGG + Intergenic
1152794453 17:82300254-82300276 CTCTCTGTGTGCTGAGAAGATGG + Intergenic
1153026640 18:678905-678927 CTGTGTATCTGCAGAGGAGAAGG + Intronic
1153427524 18:4982453-4982475 ATGTGTCTTTGCACATAAGATGG - Intergenic
1153791185 18:8581324-8581346 CTGTGTGTTAGCAGAAAATTTGG - Intergenic
1154496510 18:14965124-14965146 CTATCTGTTTAGAGAGAAGATGG - Intergenic
1155788088 18:29927281-29927303 TTGTGGGTTTGGAGAGAAAAAGG + Intergenic
1156056172 18:33006716-33006738 CTCTGTCTTTGCAGATAAGAAGG + Intronic
1156812176 18:41266044-41266066 ATGTGTGTTTGGAGAGAGAAAGG + Intergenic
1156918106 18:42485365-42485387 GTGTGTGTTTGGAGAGAGAATGG + Intergenic
1157011129 18:43650232-43650254 CTGTGTTTTGGGAGAGAGGAAGG + Intergenic
1157190322 18:45576237-45576259 CTGGGTGTTTGGAGAGAAGGTGG + Intronic
1157395091 18:47334821-47334843 CTGTGTATTGGCAGAGAACATGG - Intergenic
1157881472 18:51325039-51325061 CTGTGTGTGGGCAGAGAGGTGGG + Intergenic
1158409234 18:57189850-57189872 TTGTGTGTGTGCAGAGGTGAAGG + Intergenic
1158564377 18:58542331-58542353 CTGTTTTTTCACAGAGAAGAAGG - Intronic
1158642795 18:59218128-59218150 CTGTGTGTCTGCAGAGCACCTGG - Intergenic
1158676760 18:59527383-59527405 ATGTGTCTTTGCACAGGAGATGG + Intronic
1159548112 18:69866371-69866393 TTCTGGGTTTGCAGATAAGAGGG - Intronic
1160179715 18:76623756-76623778 CTGTGTGCTTGGAGCGAAGAGGG + Intergenic
1160482924 18:79259640-79259662 CTGTGCGCTTCCAGAGCAGACGG + Intronic
1160659152 19:290495-290517 CTGTGAGATGGCAGAGAAGCAGG + Intronic
1161187813 19:2934015-2934037 ATGTGTGCTCGCAGAGAGGAGGG + Exonic
1163087633 19:14993792-14993814 CTGAGTGCTTGCAGACAGGATGG + Intronic
1163118997 19:15204866-15204888 CTGTGTGTTTCCTGAGAACAAGG + Intergenic
1163288864 19:16365627-16365649 CTGTGGGTTTGCAGGGGATAGGG + Intronic
1164001230 19:21101311-21101333 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164007994 19:21169514-21169536 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164195310 19:22951772-22951794 CTGTGTCTTTGCATGTAAGATGG - Intergenic
1164214963 19:23136336-23136358 CTGTGTGTTTCCAGAAACAATGG - Intronic
1164253284 19:23503658-23503680 CTCTGGGTTTGTAGTGAAGAGGG - Intergenic
1164297140 19:23922048-23922070 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164317628 19:24107842-24107864 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164503772 19:28841376-28841398 CTGTGTGTGTGGGGAGAAGGTGG + Intergenic
1165374598 19:35432821-35432843 CACTGTGTGTTCAGAGAAGAGGG + Intergenic
1166066366 19:40361566-40361588 CAGTGTGTCTGCAGTGAAGTGGG - Intronic
1166427495 19:42692547-42692569 CTGTGTGTTCCCAAAGAAAATGG - Intronic
1166434132 19:42752842-42752864 CCGTGTGTTTGCAGATAAGATGG - Intronic
1166437278 19:42778170-42778192 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166446988 19:42866615-42866637 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166453917 19:42924284-42924306 CTGTGTGTTTGCAGAGAAGATGG - Exonic
1166456389 19:42943566-42943588 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166466181 19:43032837-43032859 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166472325 19:43088905-43088927 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166483456 19:43192854-43192876 CTGTGTGTTTGCAGAGAAGATGG - Exonic
1166485926 19:43211941-43211963 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166493082 19:43275894-43275916 CTGTGTGTTTGCAGAGAAGATGG - Intergenic
925160158 2:1677928-1677950 GTGTGTGTGTGCAGCGGAGATGG + Intronic
925363255 2:3294440-3294462 GTGTGTGTTTGGAGAGAGGATGG - Intronic
925363298 2:3294638-3294660 GTGTGTGTTTGGAGAGAGGATGG - Intronic
925363362 2:3294935-3294957 GTGTGTGTGTGTAGAGAGGATGG - Intronic
925363369 2:3294974-3294996 GTGTGTGTGTGTAGAGAGGATGG - Intronic
925363437 2:3295321-3295343 GTGTGTGTGTGTAGAGAGGATGG - Intronic
925363456 2:3295420-3295442 GTGTGTGTGTGCAGAGAGGATGG - Intronic
925363470 2:3295486-3295508 GTGTATGTGTGCAGAGAGGATGG - Intronic
925363484 2:3295554-3295576 GTGTGTGTGTGGAGAGAGGATGG - Intronic
925363498 2:3295619-3295641 GTGTGTGTATGTAGAGAGGATGG - Intronic
925363517 2:3295719-3295741 GTGTGTGTATGTAGAGAGGATGG - Intronic
925363602 2:3296128-3296150 GTGTGTGTGTGCAGAGAGGATGG - Intronic
925363642 2:3296303-3296325 GTGTGTGTGTGTAGAGAGGATGG - Intronic
925363670 2:3296447-3296469 GTGTGTGTGTGGAGAGAGGATGG - Intronic
925447271 2:3938758-3938780 GTGTGTCTTTGCACATAAGATGG + Intergenic
926057431 2:9782423-9782445 CTGTGAGTTTCCTGAGAAGAAGG - Intergenic
926059707 2:9797620-9797642 CTGGGTGTTTTCAGAGAAATGGG - Intergenic
926438726 2:12864148-12864170 CTGAGTATTGCCAGAGAAGAAGG - Intergenic
927417552 2:22894385-22894407 CTGTGAGTTTCCTGAGAGGAGGG + Intergenic
927991418 2:27450097-27450119 CTGAGTGGTTGAACAGAAGATGG + Intronic
929387858 2:41432460-41432482 CTCTGTATTGGCAGAGAAGTGGG + Intergenic
930409469 2:51005894-51005916 GTGTGTATTTGCAGATAAGATGG - Intronic
930483956 2:51988546-51988568 TTGTGTGTTTGCTGAGGAGTAGG - Intergenic
931516578 2:63053736-63053758 GTGTGTGTGTGCAGGGGAGAGGG + Intronic
932826972 2:74949955-74949977 GTGTGTCTTTGCACATAAGATGG - Intergenic
932998913 2:76896191-76896213 TTGTGTGTGTGCATAGGAGATGG - Intronic
933141937 2:78801934-78801956 CTGAGTCTTTGAAGATAAGATGG - Intergenic
933862011 2:86479123-86479145 CTGTGTTTATGCAGAGTTGAAGG + Intronic
934014868 2:87869350-87869372 ATGTGTGTGTACAGAAAAGATGG - Intergenic
934028905 2:88023969-88023991 CTTGGGGTTTTCAGAGAAGAAGG + Intergenic
934695817 2:96399451-96399473 GTGTGTGTTACCAGAGAAGTGGG - Intergenic
934869571 2:97850487-97850509 GTGTGTTTTTCCAGAGAGGATGG - Intronic
935065588 2:99644644-99644666 CTGCGCGTCTGCAGAGAAGCTGG - Intronic
935362504 2:102259034-102259056 ATGTGTGTTTGGTGAGAGGAAGG - Intergenic
935491153 2:103722085-103722107 TTGTGAGGTTGCAGAGAAAAGGG + Intergenic
936779386 2:116013920-116013942 CTGTGTGCTTCCAGGGATGATGG + Intergenic
937610253 2:123852702-123852724 TTGTGGGTTTGCAGAAATGAGGG + Intergenic
937712559 2:124995145-124995167 CTGTGCTTTTGGAGAGATGATGG - Intergenic
938602198 2:132853893-132853915 CTGTGTATTTAAAGTGAAGAAGG - Intronic
939344965 2:140952033-140952055 CTGTGCCTTTGTAGAGAACAGGG - Intronic
939536115 2:143431207-143431229 CTGTGTGTTTGAACAGGAAAAGG - Intronic
939935351 2:148285169-148285191 CTATTTGTTTGAAGAGCAGATGG - Intronic
939976484 2:148722532-148722554 TGGTGAGGTTGCAGAGAAGAGGG + Intronic
940276883 2:151948863-151948885 CTGTGTGCTTGCAGAGTAGAAGG - Intronic
942722461 2:178967842-178967864 GTGTGTCTTTGCACATAAGATGG - Intronic
942726851 2:179019023-179019045 CTGTGGGTGTCCAAAGAAGAGGG - Intronic
942850244 2:180475732-180475754 CTGAGTGGTGGAAGAGAAGAGGG - Intergenic
943296319 2:186144614-186144636 GTGTGTCTTTGCACATAAGATGG - Intergenic
944972907 2:205014470-205014492 CAGTGTGTGTGCCGAGGAGAAGG + Intronic
945072329 2:206004339-206004361 CTGTGTGTTTGCAGGCAGGTGGG - Exonic
945425659 2:209697333-209697355 CTGTGTGTTTGGTTAGACGATGG + Intronic
945639477 2:212405343-212405365 CGGTGAGGTTGCAGAGAAAAGGG + Intronic
945959406 2:216116655-216116677 CTAGGTGTTTGCTGAGAACAAGG + Exonic
946154986 2:217801377-217801399 CTGGGTGTCTGGAGGGAAGAGGG - Exonic
946352284 2:219163000-219163022 CTGTGTCTTTGCATAAATGATGG + Intronic
946748047 2:222864814-222864836 CTGTGTCTTTGCTGGGAGGAGGG + Intronic
947767839 2:232648860-232648882 CTTTCTGTGTGAAGAGAAGAAGG + Intronic
947893023 2:233643288-233643310 CTCTGTCTTTGCAAATAAGAGGG - Intronic
1168792708 20:590622-590644 CAGTGTGATTGGAGAGAGGATGG + Intergenic
1169083736 20:2814691-2814713 CTGTGAGTTTGCAGAGCTGCAGG - Intergenic
1170130261 20:13011442-13011464 CTGTGTGGTTGCAAATAAGTGGG - Intronic
1170499091 20:16956289-16956311 CTGTGACTTTGCAGAGAAACAGG + Intergenic
1171288190 20:23960779-23960801 CTGAGTATTGCCAGAGAAGAAGG + Intergenic
1173197540 20:40928255-40928277 CTGTGGGAGTGCAGAGGAGAGGG - Intergenic
1173644777 20:44626547-44626569 CTATGAGTTTGTAGAGATGAAGG - Exonic
1173759929 20:45550417-45550439 GTGTGTGTGTGCAGAGAAAGGGG + Intergenic
1174436965 20:50515380-50515402 CTGTGTGTTTTCATACAAGCTGG + Intronic
1174599174 20:51710477-51710499 CTGGGAGATTGCAGGGAAGAGGG - Intronic
1174904137 20:54532362-54532384 TTCTGTGTTTATAGAGAAGAAGG + Intronic
1174934044 20:54848098-54848120 CAGTTTGTTTGCAGAAAAGAAGG + Intergenic
1174953112 20:55065329-55065351 GTGTGTCTTTGCACATAAGATGG + Intergenic
1175541443 20:59750596-59750618 CGGTGTGTGGGCAGGGAAGACGG - Intronic
1175617999 20:60419898-60419920 CTGGGTGTTTTCAGTGATGAAGG + Intergenic
1175742571 20:61430283-61430305 GTGTGCGCTTGCAGAGAAGGGGG + Intronic
1176660981 21:9634738-9634760 CTGTGTGTGTGCAGCAGAGAAGG + Intergenic
1177388391 21:20435523-20435545 TTGTGTCTTTGCACATAAGATGG - Intergenic
1177713283 21:24807543-24807565 CTGTGGGTCAGCAGAGAAGTAGG + Intergenic
1177933121 21:27310351-27310373 TGGTGTGTATGCAGAGAAAAGGG - Intergenic
1178644336 21:34373028-34373050 CTGTCTGGATGCAGAGCAGAGGG - Intergenic
1178676697 21:34637242-34637264 GTGTGTGTGTGCAGAGAAAGAGG + Intergenic
1178685476 21:34707426-34707448 GTGTGTGTGTGCAGAGAACTAGG - Intronic
1179327351 21:40360948-40360970 CTGTGAGGGTGCAGAGAAAAGGG - Intronic
1179505674 21:41838670-41838692 CTGTGAATAGGCAGAGAAGATGG - Intronic
1180588362 22:16914120-16914142 CTTTGAGTCTGCAGAGGAGAAGG - Intergenic
1181730554 22:24843313-24843335 ATGTGTTTCTGCAGAGAAGGTGG + Intronic
1182608577 22:31527352-31527374 CTGTGTGTGTGTAAAGAAAAAGG + Intronic
1182795666 22:32989880-32989902 CTGTGTCTTTAGAGAGGAGAGGG - Intronic
1183026361 22:35068407-35068429 CTGTGTGTCTGCAGGCAGGAAGG + Intronic
1183390027 22:37540424-37540446 CTGTGTGTTTGGAGAGCAGTGGG - Intergenic
1184173317 22:42772226-42772248 CTCTGTGTGTGCAGAGGGGAAGG - Intergenic
1184341768 22:43890074-43890096 CTGTGGGTGTGCAGGGAAGGAGG + Intronic
949172023 3:1011504-1011526 TGATGTGTTTGCTGAGAAGATGG - Intergenic
949676677 3:6462668-6462690 CTGTGTGTGTGTAGGGAACATGG - Intergenic
949958866 3:9294754-9294776 CTGTTTCTTTGGAGAGGAGAAGG - Intronic
950327204 3:12121953-12121975 CTGAGGTTTTGCAGAGAAGAAGG - Intronic
950561445 3:13730666-13730688 GTGTTAGTTTGCTGAGAAGATGG + Intergenic
951319559 3:21227901-21227923 CTTGGTGTTGGTAGAGAAGATGG - Intergenic
951324231 3:21283628-21283650 GTGTGTGTTTGCACATGAGATGG + Intergenic
951640565 3:24830188-24830210 GTGTGTGATTGTAGAGACGATGG + Intergenic
952023839 3:29055502-29055524 GTGTGTGTTTGCACATGAGATGG + Intergenic
952210597 3:31225796-31225818 CTGTGTGGCAGCAGGGAAGAGGG - Intergenic
952574210 3:34755291-34755313 CTAGGTGTTAGCAGACAAGAAGG + Intergenic
952743871 3:36760201-36760223 CACTGTGTTTGGAGAGATGATGG - Intergenic
953589745 3:44240425-44240447 CTGTGTGTTCGCAGACAGGAAGG + Intergenic
953808470 3:46091956-46091978 CTGTGTCATTGCAAAGTAGAAGG + Intergenic
954045355 3:47925165-47925187 CTGTGTGATTGTAGAATAGATGG - Intronic
954527720 3:51287644-51287666 TGGTGAGGTTGCAGAGAAGAGGG + Intronic
954865319 3:53724059-53724081 CTGAGTGTGAGCAGACAAGAAGG - Intronic
955597907 3:60611869-60611891 CTGTGTGTGTACAGAGCAGCTGG + Intronic
955635181 3:61020787-61020809 GTGTGTCTTTGCACATAAGATGG - Intronic
956192063 3:66617384-66617406 CTGGGTGGTTGAAGATAAGATGG - Intergenic
956651986 3:71512771-71512793 CTGTGTGTGGGAAGAGATGACGG - Intronic
956865367 3:73363840-73363862 CAGTGTTGTTGCAGAGTAGATGG - Intergenic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
958013623 3:87913444-87913466 TAGTGAGTTTGCAGAGAAAAAGG + Intergenic
958255276 3:91318519-91318541 GTGTGTCTTTGCACAGGAGATGG + Intergenic
958495042 3:94834316-94834338 CAGTGAGGTTGCAGAGAAAAGGG + Intergenic
958656255 3:97007493-97007515 GTGTGTCTTTGCACACAAGATGG + Intronic
959205616 3:103303076-103303098 GTGTGTCTTTGCAGGTAAGATGG + Intergenic
959479640 3:106855447-106855469 GTGTGTCTTTGCACATAAGATGG - Intergenic
960069769 3:113416249-113416271 GTGTGTCTTTGCAGGTAAGATGG + Intronic
960772936 3:121215090-121215112 GTGTGTCTTTGCACATAAGATGG + Intronic
961037570 3:123653224-123653246 GTGTGTGTTGGCAGAGAGGTGGG - Intronic
961183659 3:124896065-124896087 CAATGTGCTTGCATAGAAGACGG + Intronic
961587315 3:127943193-127943215 TTGTGTGTATACACAGAAGAGGG + Intronic
961945647 3:130684241-130684263 CTGGGTGATTGCAGGTAAGATGG - Exonic
961988391 3:131161191-131161213 TTGTGAGGTTGCAGAGAAAAAGG + Intronic
964465745 3:156989810-156989832 CTGTGTGTGTGCAGAGAGAGAGG - Intronic
964648859 3:158989472-158989494 GTGTGTCTTTGCACACAAGATGG + Intronic
965172830 3:165290163-165290185 CTGTGAGATTGTAGAGAAAAAGG - Intergenic
965220519 3:165921092-165921114 CTGAGTGTTGGGAGAGAAGCTGG + Intergenic
965368964 3:167836996-167837018 ATGTGTGTTTGCAGAGTGGGAGG + Intergenic
965632695 3:170749536-170749558 TTGTGTGTTTAAAGAGATGATGG - Intronic
966159605 3:176953972-176953994 CTGTGTGTTCTCAGAGAAGAAGG - Intergenic
966422584 3:179747901-179747923 ATGTGTGTATGCAGACAAAAAGG - Intronic
966715589 3:183010431-183010453 CTGTGTGGTAGAAGAGGAGATGG - Intergenic
966772634 3:183517671-183517693 CCCTGAGTTTCCAGAGAAGACGG + Intronic
967149649 3:186636985-186637007 CTATGTGGCTTCAGAGAAGAAGG - Intronic
967470502 3:189855728-189855750 GTGTGTGTATGCACAGAAAACGG + Intronic
967494982 3:190133079-190133101 CTGTGTGGTTGCAGGGAAAAAGG - Intergenic
968047599 3:195632661-195632683 CTGTGTGTTTGCTGAGCTGGAGG + Intergenic
968307012 3:197657263-197657285 CTGTGTGTTTGCTGAGGTGGAGG - Intergenic
968394654 4:223737-223759 CTCTGGGGTTGCAGAGAAGAAGG + Intergenic
968407002 4:349660-349682 CTCTGGGGTTGCAGAGAAGAAGG + Intronic
968413621 4:409338-409360 CTCTGCGGTTGCAGAGAAGAAGG + Intergenic
968419234 4:468689-468711 CTCTGGGGTTGCAGAGAAGAAGG - Intronic
969269737 4:6091332-6091354 CTGTGTATTTGCACAAGAGACGG - Intronic
969337356 4:6519489-6519511 CTGTGTGGCTGCAGAGGAGAGGG - Intronic
969499995 4:7546824-7546846 ATGTGTTTTTGCAGGGAAGAGGG - Intronic
970057088 4:11987153-11987175 CTTTGTATTTGGAGTGAAGAGGG - Intergenic
970269846 4:14334373-14334395 CAGTGAGGTTGCAGAGAAAAAGG + Intergenic
970454317 4:16207076-16207098 CTGTGTGGCTGCTGAGAAGCAGG - Intronic
971965169 4:33544807-33544829 CTGGGTTTTTGTAGAGAAAAGGG - Intergenic
972010618 4:34176488-34176510 TTGTGTGGTTGCAGAGAAAAGGG + Intergenic
972761166 4:42105876-42105898 CTGTGTGATTGAATAGAAGCAGG - Intergenic
974570131 4:63635161-63635183 CGGTGAGGTTGCAGAGAAAAGGG + Intergenic
974913021 4:68146781-68146803 CTATGTGTTTGCACATGAGATGG + Intergenic
975096878 4:70466513-70466535 GTGTGTCTTTGCACATAAGATGG - Intronic
975233987 4:71969726-71969748 TAGTGTGTTTGCACAGAAGTAGG - Intergenic
976378804 4:84376125-84376147 TTGTGTATTTGCACAGCAGATGG - Intergenic
976506979 4:85859154-85859176 GTGTGTGTGTGCACAGAAGTGGG - Intronic
976853665 4:89577820-89577842 CTCAGTCTTTGCAGAGAGGAAGG - Intergenic
977040018 4:92003905-92003927 GTGTGTCTTTGCACATAAGATGG - Intergenic
977563637 4:98559396-98559418 CTGTCTTTTTGCAGAAAGGAAGG + Intronic
977845809 4:101765234-101765256 CAGTGAGGTTGCAGAGAAAAGGG - Intronic
978035645 4:103990114-103990136 CTGTGAATGTGCAGAGAAAAGGG - Intergenic
978058020 4:104297281-104297303 TGGTGAGTTTGCAGAGAAAAAGG - Intergenic
978060875 4:104336689-104336711 TTGTGAGATTGCAGAGAAGAGGG - Intergenic
978370950 4:108029185-108029207 CTCTGTGTTGGCTGAGAGGAGGG - Intronic
978626767 4:110693762-110693784 TTGTTTGTTTTCAGAGAAAAAGG + Intergenic
978827183 4:113039576-113039598 CTATGTGTTTGCTGAGGAGTGGG + Intronic
979381430 4:120011249-120011271 CTGTGTGTCTGGTGAGAATATGG - Intergenic
979583661 4:122389742-122389764 GTGTGTCTTTGCACATAAGATGG + Intronic
979882000 4:125971293-125971315 ATGTGTGTTTGGAAAAAAGATGG - Intergenic
980225109 4:129973336-129973358 CTATAAGTTTGCAGAAAAGATGG - Intergenic
981201958 4:141990901-141990923 ATGTGTCTTTGCACATAAGATGG + Intergenic
981605938 4:146540375-146540397 TGGTGTGGTTGCAGAGAAAAGGG - Intergenic
981734120 4:147931635-147931657 CTCTGTATTTGGAGAGAAGGTGG + Intronic
983439182 4:167759374-167759396 TGGTGTGGTTGCAGAGAAAAAGG + Intergenic
983710114 4:170704492-170704514 TGGTGAGTTTGCAGAGAAAAGGG - Intergenic
984592846 4:181635935-181635957 CTATATGTTAGCAGGGAAGAGGG - Intergenic
985744012 5:1636503-1636525 CTGTGTGTTTGCTGAGCTGGAGG - Intergenic
985936552 5:3101952-3101974 CTGTGTGTTCTCTGTGAAGATGG - Intergenic
986482000 5:8198854-8198876 CTGTATTTCTACAGAGAAGATGG + Intergenic
986621287 5:9678289-9678311 TGGTGAGTTTGCAGAGAAAAGGG + Intronic
986751763 5:10793995-10794017 CTGCATGTTTGCAGAGCAGATGG - Intergenic
986923352 5:12716274-12716296 ATGAGTGTTGCCAGAGAAGAAGG + Intergenic
987426211 5:17776451-17776473 CTGTGTGTCATCAGAGATGATGG + Intergenic
987809235 5:22812365-22812387 ATATGTGTTTGCAGAGGAGACGG - Intronic
988618453 5:32797261-32797283 GTGTGTCTTTGCACATAAGATGG - Intergenic
988618953 5:32802869-32802891 CTGTAAATGTGCAGAGAAGATGG + Intergenic
989092289 5:37745531-37745553 GTGTGTCTTTGCACATAAGATGG - Intronic
989124876 5:38042758-38042780 CAGTGTGTTTGTAGGGAAAACGG - Intergenic
989357149 5:40556348-40556370 CTGTCAGTTTGGAGAAAAGAAGG - Intergenic
989526443 5:42458991-42459013 CTGTGAGGTTGTAGAGAAAAGGG + Intronic
990497533 5:56363487-56363509 TTGTGTGTGTGCAGGGAGGAGGG - Intergenic
991524716 5:67543684-67543706 CTGGGTGTATGCAAAGAACAAGG + Intergenic
991726711 5:69542743-69542765 CTGTGTGTAATCAGAAAAGAAGG - Intronic
991868246 5:71085131-71085153 CTGTGTGTAATCAGAAAAGAAGG + Intergenic
992134933 5:73734814-73734836 TTGTGTTTTTGCAGTGGAGAGGG + Intronic
992397063 5:76378120-76378142 CTGCGTGGTGGCAGGGAAGAGGG + Intergenic
992496679 5:77300666-77300688 ATGTGTGTTAGCAAAGAGGAGGG + Intronic
992866568 5:80961834-80961856 CTTTGTGTTTGCAGGAATGAGGG - Intronic
993433924 5:87867424-87867446 CTTTGTGTAAGCCGAGAAGAGGG - Intergenic
993462763 5:88204639-88204661 AAGTGTGTGTGCAGAGAGGAGGG + Intronic
993541570 5:89159163-89159185 CTGTGGGTTTGCAAAGACCATGG - Intergenic
993907222 5:93636490-93636512 CTGTGTCTTCACAGGGAAGAAGG - Intronic
994150889 5:96446405-96446427 TTCTGTGTTTGCAGAAAGGAGGG + Intergenic
994252063 5:97547549-97547571 CTGTGTGGTTTCACAGAAAAGGG - Intergenic
994571507 5:101520625-101520647 ATGTGTATTTCCAGGGAAGAAGG - Intergenic
994636577 5:102351677-102351699 CTGTGTGCTAGCAGAGAGCAAGG - Intergenic
995842647 5:116458374-116458396 GTGTGTTTTTGTAGAAAAGATGG + Intronic
996163320 5:120194548-120194570 GTGTGTCTTTGCACATAAGATGG - Intergenic
996526706 5:124488131-124488153 CTGTGTGTTTGCACATGAGATGG + Intergenic
996826225 5:127684104-127684126 CTGTGTGTGTGCAGAGAAAGAGG + Intergenic
996940225 5:128995704-128995726 CTGAATGTTTGAAGAGAAGGAGG + Intronic
997603772 5:135157920-135157942 GTGTGAGTTTCCAGAGAAAAAGG + Intronic
998150560 5:139754952-139754974 GTGTGTGTGTGCAGTGGAGAGGG + Intergenic
998320108 5:141221939-141221961 CAGTGTGGATGGAGAGAAGAGGG - Intergenic
998538341 5:142955126-142955148 GTGTGTGTGTGCAGAGATGGGGG - Intronic
998869745 5:146540473-146540495 CTGTGTGTATGCTGAGAATAGGG + Intergenic
999587325 5:153104575-153104597 CTGTCTGTCTGTAGAGAACAAGG + Intergenic
1000079968 5:157835711-157835733 TTGTGTGTTTGTTGAGTAGAGGG - Intronic
1000299454 5:159942636-159942658 TTGTGTGTTTGTAGAGATGAGGG - Intronic
1000577196 5:162988922-162988944 CTGTGTCCTCGCAGAGTAGAAGG + Intergenic
1002306634 5:178287407-178287429 CTCTGTGAATGCAGAGATGAAGG - Intronic
1003021200 6:2511046-2511068 CTGTGTGTTTGCGGGGACGGGGG - Intergenic
1004331802 6:14728693-14728715 CTGTATGTGGGCAGAGAAGGAGG + Intergenic
1004386643 6:15178799-15178821 CTGTGTTTTAGTAGAGAGGAGGG - Intergenic
1005024222 6:21447472-21447494 CCGTGTGTTTGCAGTGAGGATGG - Intergenic
1007686857 6:43672179-43672201 GTGTGTGTTTGCTGAGGAAAAGG + Exonic
1008134476 6:47757930-47757952 GTGTGTGTTTGTTGAGATGAAGG + Intergenic
1008367749 6:50702562-50702584 CTGTGTTTTCCCAGAGAACATGG - Intergenic
1008468020 6:51852796-51852818 GTGTGTCTTTGCACATAAGATGG + Intronic
1009422351 6:63477848-63477870 CTTTTTGTTTGCAGAGGAGGAGG + Intergenic
1010535707 6:77026989-77027011 CTGTGAGTTTCCAGATGAGAAGG - Intergenic
1010654674 6:78498028-78498050 TGGTGTGGTTGCAGAGAAAAAGG - Intergenic
1010731595 6:79396987-79397009 CTGTGTGTGTAAGGAGAAGAGGG + Intergenic
1011044081 6:83062899-83062921 TTTTGTGTTTGCAGTGAAGTAGG - Intronic
1011335474 6:86254865-86254887 CTGTGTGGCTGGAGAGGAGATGG + Intergenic
1012922178 6:105231890-105231912 ATGTGTCTTTGCACAGGAGATGG + Intergenic
1013629296 6:111970087-111970109 TAGTGTGTTTGAAGAGAAGGAGG + Intergenic
1014176803 6:118340423-118340445 GTGTGTCTTTGCATATAAGATGG + Intergenic
1014623953 6:123703313-123703335 CTGTGTCTTTACATAGCAGAAGG + Intergenic
1015066468 6:129035117-129035139 CGGTGAGGTTGCAGAGAAAAGGG - Intronic
1015234632 6:130956446-130956468 CTCTGTGTCTGAAGTGAAGAAGG - Exonic
1015282429 6:131448168-131448190 GTGTATGTCTACAGAGAAGAAGG - Intergenic
1017661916 6:156683351-156683373 CTTTGAGTGTGGAGAGAAGAGGG - Intergenic
1017721269 6:157244927-157244949 AAGGGTGTTTGCAGAGAAGCAGG + Intergenic
1018004093 6:159604203-159604225 CTTTAAGTGTGCAGAGAAGAAGG - Intergenic
1018373825 6:163192753-163192775 GTGTGTATTTGCAGGGAAGATGG + Intronic
1019106489 6:169671749-169671771 TTGTGAGTGTGCAGAGGAGAAGG - Intronic
1020331538 7:7022339-7022361 TTGTGAGGTTGCAGAGAAAAAGG - Intergenic
1020967302 7:14887454-14887476 CTGAGTGTACACAGAGAAGAAGG - Intronic
1021129868 7:16898846-16898868 GTGTGTCTTTGCAGATGAGATGG + Intergenic
1021163490 7:17304913-17304935 ATGTGTGTTTGCGTAGAAGAAGG + Intronic
1022119672 7:27295787-27295809 GTGTGTGTTTAAAGAGAGGAAGG + Intergenic
1022520854 7:31006091-31006113 CTGTGTGTTCCCATAGGAGAGGG + Intergenic
1023159017 7:37279542-37279564 GGGTGTGTTTTCGGAGAAGAGGG - Intronic
1023476543 7:40585372-40585394 AATTGTGTTTTCAGAGAAGAAGG - Intronic
1024350193 7:48355644-48355666 CAGTGTGGTAGCAGAGAAGCTGG + Intronic
1025791814 7:64695044-64695066 GTGTGTGTGTGCACAGAATATGG - Intronic
1025799666 7:64774044-64774066 CTCTGGGGTTGCAGAGAATATGG + Intergenic
1025875516 7:65477142-65477164 CTGGGTGGTTGGAGAGAGGAGGG - Intergenic
1026219237 7:68378090-68378112 CTGAGTGGCTGCAGAGAAGGTGG - Intergenic
1026306923 7:69150491-69150513 CTGTGTGTTTGCATTAATGATGG + Intergenic
1027178335 7:75919401-75919423 GTGTGTGTATGCATATAAGAGGG + Intronic
1027637322 7:80691250-80691272 GTGTGTCTTTGCACATAAGATGG - Intergenic
1027943586 7:84717081-84717103 ATGTGTGTGTGCTGCGAAGAAGG + Intergenic
1028678008 7:93490466-93490488 GTCTGTGTTTGCAGACAACATGG + Intronic
1029347502 7:99989171-99989193 TTTTGTGTTTTCAGTGAAGACGG - Intergenic
1029801701 7:102954646-102954668 CTGTGTCTTTGCACATGAGATGG - Intronic
1030612401 7:111704107-111704129 CTGTGTCTTTGCACATGAGATGG + Intergenic
1030701339 7:112644981-112645003 ATGTGTCTTTGCACATAAGATGG + Intergenic
1030702840 7:112660445-112660467 CTGTGTCTTTGCACATGAGATGG + Intergenic
1031618326 7:123906316-123906338 CTATGTGTTAGCAAAGAACATGG - Intergenic
1031683892 7:124709058-124709080 CTCTGTCTTTGGAGAGAGGAAGG + Intergenic
1033817992 7:145098553-145098575 CTGTGTGTTTATAGGGAAGCTGG + Intergenic
1034358657 7:150474617-150474639 CATTGTGTTTTCAGAGAAAAAGG + Exonic
1035828155 8:2666640-2666662 CTGTACGTTTACAGTGAAGATGG - Intergenic
1035854877 8:2964099-2964121 TTGTGTATCTTCAGAGAAGAAGG - Intronic
1036441863 8:8788895-8788917 CTGTGTGTTGGCAGAGTGGCTGG + Intronic
1037576477 8:20209311-20209333 CTGTGTCTGTGAAGAGTAGAGGG + Intronic
1037904265 8:22706188-22706210 CAGTGTGGTGGGAGAGAAGATGG - Intergenic
1038112022 8:24510573-24510595 CTGTGTCTGTTCAGAGCAGAGGG - Intronic
1040499121 8:47991950-47991972 CTGCCTGTTTGCGGAGGAGATGG + Intergenic
1041100591 8:54392740-54392762 CTTTGTCTATGCAGAGAAGGAGG + Intergenic
1041168327 8:55114209-55114231 CTGTGAGGTTGCAGAGAAAAGGG - Intronic
1041300510 8:56406803-56406825 CTGTGTGTTTCCACAAAACAAGG + Intergenic
1041422153 8:57679600-57679622 GTATGTGTTTGTAGAGAAGATGG - Intergenic
1041725887 8:61017066-61017088 CTGTCTTTTTGGAGAGAAGCAGG - Intergenic
1041747375 8:61223065-61223087 GTGTGTCTTTGCACATAAGATGG + Intronic
1041837522 8:62233154-62233176 CTGTGTGTTTGCATAGCAGAAGG + Intergenic
1042367550 8:67953766-67953788 CTGTATATTTGCAGAGAATGTGG - Intronic
1042492208 8:69412433-69412455 TTGTAAGTTTGCAGAGGAGAGGG - Intergenic
1042907596 8:73787855-73787877 CTGAGTGTTTTCAGTGAAGATGG - Intronic
1043014109 8:74916803-74916825 CAGTGTGATTGCAGAGGAGCAGG + Intergenic
1043380980 8:79701896-79701918 CTGTGTCCTTACAGGGAAGAAGG + Intergenic
1043538244 8:81229851-81229873 CCGTGTGTTCGCAGAGAAGCAGG - Intergenic
1043714711 8:83467350-83467372 CTCTGGGATAGCAGAGAAGAAGG + Intergenic
1044400214 8:91761723-91761745 TTGAGTGTTTCCAGATAAGAAGG - Intergenic
1044594992 8:93950851-93950873 GTGTGTCTTTGCAGATGAGATGG + Intergenic
1044961232 8:97532426-97532448 GTGTGTCTTTGCATATAAGATGG - Intergenic
1045302689 8:100927580-100927602 CTCTATGTATGCAGAGATGAAGG + Intronic
1045415919 8:101967509-101967531 CTGTCTCTTTGCAGAGGAGAAGG + Intronic
1045464339 8:102455718-102455740 CTGTGTGATTGGAGAGATGTTGG + Intergenic
1045535927 8:103027839-103027861 CTGTGTGTGTGCAGGGAGGGTGG - Intronic
1046054389 8:109061567-109061589 CTGTGTGTTTACAGAGACAGTGG - Intergenic
1046338671 8:112824190-112824212 TTGTGTCTTTGCACATAAGATGG + Intronic
1048361410 8:133700285-133700307 TTTTGTTTTTGCAGAGAGGAGGG + Intergenic
1048888548 8:138928447-138928469 ATGGATGTTTGCAGAGCAGATGG - Intergenic
1049139058 8:140934932-140934954 CTGTGTTTATGCAGAAAAGGAGG + Intronic
1049299635 8:141862740-141862762 CTGTGTGGGTGCAGCGAAGCAGG + Intergenic
1049529487 8:143147252-143147274 ATGGGTGTTTGGAGAGAAGGGGG + Intergenic
1049632685 8:143667078-143667100 ATGTGTGTTTGCACAGAGGGAGG - Intergenic
1051042073 9:12824119-12824141 TTGTGTCTTCCCAGAGAAGATGG + Intergenic
1052751972 9:32501135-32501157 CTGTAGGTTTCCAGAGAGGATGG - Intronic
1055019845 9:71658057-71658079 ATGTATGTTTGTAGAGATGAGGG + Intergenic
1055131383 9:72778923-72778945 CTGCGTGTTGGCAAAGCAGAGGG - Intronic
1055782799 9:79837683-79837705 TTGTGAGGTTGCAGAGAAAAGGG - Intergenic
1057896098 9:98909849-98909871 TTGTTTGTTTGTAGAGAAGGAGG - Intergenic
1058304410 9:103419363-103419385 CTATGTCTTTGCAGTGAACATGG + Intergenic
1058945587 9:109852666-109852688 CGGTGAGGTTGCAGAGAAAAGGG - Intronic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059415271 9:114158309-114158331 CTGTGTGTTTCCAGGTAATAAGG + Intronic
1060025605 9:120168228-120168250 GGGTGGGTATGCAGAGAAGAGGG - Intergenic
1060110038 9:120900308-120900330 CTGTGTCTTTGCCTGGAAGAAGG + Intergenic
1060447166 9:123700586-123700608 CTGAGGTTTTCCAGAGAAGAAGG - Intronic
1060617061 9:125026847-125026869 CTGTCTGATTGCAGAATAGAAGG + Exonic
1060872229 9:127051784-127051806 CTGTGTGTTTCCCGAGAGCAGGG - Intronic
1061015139 9:127977046-127977068 CTGTGTTTTTGCCCAGTAGACGG - Intronic
1061299924 9:129698368-129698390 CAGTCTGGCTGCAGAGAAGAGGG + Intronic
1061387947 9:130301485-130301507 CTCTGGGTTTGGAGAGATGAGGG + Intronic
1061539331 9:131269208-131269230 GTGTGTGTATGCAGAGAGCAAGG - Intronic
1061543880 9:131292574-131292596 CTTTGCGTTTTCAGAGGAGAGGG + Intronic
1061872897 9:133530098-133530120 CTGTGTGTGTGCTGGGAGGACGG + Intergenic
1061883930 9:133582139-133582161 CTGTGTGTGTGCCGAGAGGACGG + Intronic
1062057183 9:134474781-134474803 GTGTGTGTTTGCTGAGTGGATGG + Intergenic
1203638550 Un_KI270750v1:136582-136604 CTGTGTGTGTGCAGCAGAGAAGG + Intergenic
1185545164 X:937745-937767 GTGTGTGTGTGCAGAGATGGGGG - Intergenic
1185569729 X:1124339-1124361 CCCTGCGTTTGCAGCGAAGATGG - Intergenic
1186102781 X:6174284-6174306 CAGTGAGTTTGCAGAGAAAAAGG + Intronic
1186417287 X:9394741-9394763 CTGTGTGTTTCCAGAGAGAAGGG + Intergenic
1186672280 X:11780040-11780062 GTGTGTGTGTGTAGAGATGAGGG - Intergenic
1186845736 X:13529210-13529232 GTGTGTCTTTACATAGAAGAAGG + Intergenic
1187184955 X:16975349-16975371 CAGTGAGGTTGCAGAGAAAAAGG - Intronic
1187391359 X:18888436-18888458 CTGTGTGTCAGGAGTGAAGAGGG - Intergenic
1187659481 X:21524670-21524692 CTTTTTGTTTGGGGAGAAGAAGG + Intronic
1187677829 X:21735532-21735554 CTGTGTGATTACAGGGAACAAGG - Intronic
1187764037 X:22619897-22619919 TGGTGAGGTTGCAGAGAAGAGGG + Intergenic
1188048402 X:25454491-25454513 CTGTGTGTTTGGTGAGGAGATGG - Intergenic
1188493670 X:30761298-30761320 TTGTGAGGTTGCAGAGAAAAAGG + Intergenic
1188525529 X:31083854-31083876 CTGTGTGGTTGCAGAGAAAGGGG + Intergenic
1188819117 X:34751877-34751899 TTGTGAGGTTGCAGAGAAAAGGG - Intergenic
1189065295 X:37801644-37801666 CTGTGTGTTTGTGGAGGGGAAGG + Intronic
1189683342 X:43538950-43538972 CTGTATGTGTGCAGCAAAGAGGG - Intergenic
1189881562 X:45498786-45498808 CGGTGAGGTTGCAGAGAAAAAGG - Intergenic
1190570487 X:51776868-51776890 TTGTGTGTTTGAACAGAAAAAGG - Intergenic
1190897658 X:54637007-54637029 CAGTGAGGTTGCAGAGAAAAGGG - Intergenic
1191154933 X:57264540-57264562 TGGTGAGTTTGCAGAGAAAAAGG + Intergenic
1191794009 X:65001696-65001718 GTGTGTCTTTGCACATAAGATGG - Intronic
1191795891 X:65020786-65020808 CTATGTCTTTGCACATAAGATGG - Intronic
1192625935 X:72728782-72728804 CTGAGTGTTGGATGAGAAGAAGG - Intergenic
1192716654 X:73649451-73649473 CTGTGTCTTTGCACATGAGATGG - Intronic
1192889894 X:75378906-75378928 GTGTGAGTTTGCAGGGAATAAGG + Intronic
1193340583 X:80344433-80344455 TGGTGAGTTTGCAGAGAAAAGGG - Intronic
1193499314 X:82254610-82254632 CAGTGAGGTTGCAGAGAAAAGGG - Intergenic
1193550379 X:82885084-82885106 TAGTGAGGTTGCAGAGAAGAAGG + Intergenic
1193571888 X:83153918-83153940 GTGTGTCTTTGCACATAAGATGG - Intergenic
1193580112 X:83253381-83253403 CTGTGTGCTTTCAGAGATGAAGG - Intergenic
1193719286 X:84969545-84969567 GTGTGTCTTTGCAGGTAAGATGG + Intergenic
1193780590 X:85697082-85697104 GTGTGTCTTTGCACATAAGATGG + Intergenic
1194021782 X:88700452-88700474 GTGTGTCTTTGCACATAAGATGG + Intergenic
1194355884 X:92883441-92883463 TTGTGAGGTTGCAGAGAAAAGGG + Intergenic
1194485778 X:94484462-94484484 GTGTGTCTTTGCACATAAGATGG + Intergenic
1194673394 X:96764383-96764405 GTGTGTGGAGGCAGAGAAGAAGG + Intronic
1194838986 X:98715360-98715382 GTGGGAGTTTGCAGAGAAGAGGG + Intergenic
1194934436 X:99931198-99931220 TTGTTTGTTTTCTGAGAAGACGG + Intergenic
1196476189 X:116089920-116089942 GTGTGTGTTTGCACATGAGATGG + Intergenic
1196573831 X:117295438-117295460 CTCTGTGTTTGCACAGAAAAAGG + Intergenic
1196970042 X:121098687-121098709 CTGAGAGTTTGCAGAGGATATGG + Intergenic
1197184169 X:123568269-123568291 GTGTGTGTTTGCTGAGAATGAGG - Intergenic
1197255310 X:124256839-124256861 CAGTGTGTTTGCAGAAAACCTGG + Intronic
1198792673 X:140362601-140362623 CTGTTGGTGTGCAGAGAATAGGG - Intergenic
1199044942 X:143158877-143158899 CTGTGTCTTAGCATGGAAGAAGG + Intergenic
1199129611 X:144169161-144169183 ATGTGTGTGTACAGAAAAGATGG + Intergenic
1199511672 X:148629876-148629898 CTGGGGGTTCACAGAGAAGAAGG - Intronic
1200664230 Y:6000418-6000440 TTGTGAGGTTGCAGAGAAAAGGG + Intergenic
1200741807 Y:6862328-6862350 GTGTGTCTTTGCATAGGAGATGG + Intergenic
1201289793 Y:12412177-12412199 CTGTGTAATTGCAAAGTAGATGG + Intergenic
1201753737 Y:17464227-17464249 GTGTGTGAGTGCAGAGATGATGG + Intergenic
1201847816 Y:18441758-18441780 GTGTGTGAGTGCAGAGATGATGG - Intergenic
1201986215 Y:19970310-19970332 TTGTGTCTTTGCACATAAGAAGG - Intergenic
1202041826 Y:20693772-20693794 CTGTGTGTTTGCACATGAGGTGG + Intergenic