ID: 1166495748

View in Genome Browser
Species Human (GRCh38)
Location 19:43301914-43301936
Sequence ACTGACTCTTTGGAAAACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166495746_1166495748 1 Left 1166495746 19:43301890-43301912 CCTTTATTCTTTCATGGGAATGA No data
Right 1166495748 19:43301914-43301936 ACTGACTCTTTGGAAAACACAGG No data
1166495744_1166495748 6 Left 1166495744 19:43301885-43301907 CCTCTCCTTTATTCTTTCATGGG No data
Right 1166495748 19:43301914-43301936 ACTGACTCTTTGGAAAACACAGG No data
1166495742_1166495748 12 Left 1166495742 19:43301879-43301901 CCAAGTCCTCTCCTTTATTCTTT No data
Right 1166495748 19:43301914-43301936 ACTGACTCTTTGGAAAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166495748 Original CRISPR ACTGACTCTTTGGAAAACAC AGG Intergenic
No off target data available for this crispr