ID: 1166496098

View in Genome Browser
Species Human (GRCh38)
Location 19:43304395-43304417
Sequence TGGGTCTCCTGGGGAAAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166496098_1166496109 13 Left 1166496098 19:43304395-43304417 CCCCATTTTCCCCAGGAGACCCA No data
Right 1166496109 19:43304431-43304453 GCCTTCTCATTTCCTCTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166496098 Original CRISPR TGGGTCTCCTGGGGAAAATG GGG (reversed) Intergenic
No off target data available for this crispr