ID: 1166499811

View in Genome Browser
Species Human (GRCh38)
Location 19:43332361-43332383
Sequence GTCAGAGGAGGCCATGGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 539
Summary {0: 2, 1: 1, 2: 7, 3: 48, 4: 481}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166499811_1166499817 4 Left 1166499811 19:43332361-43332383 CCACTGCCATGGCCTCCTCTGAC 0: 2
1: 1
2: 7
3: 48
4: 481
Right 1166499817 19:43332388-43332410 GTTTAGCAAAGCTCTCAGGTGGG No data
1166499811_1166499822 25 Left 1166499811 19:43332361-43332383 CCACTGCCATGGCCTCCTCTGAC 0: 2
1: 1
2: 7
3: 48
4: 481
Right 1166499822 19:43332409-43332431 GGGCTGATGGCGCTGTCCTGGGG 0: 2
1: 0
2: 2
3: 9
4: 222
1166499811_1166499818 5 Left 1166499811 19:43332361-43332383 CCACTGCCATGGCCTCCTCTGAC 0: 2
1: 1
2: 7
3: 48
4: 481
Right 1166499818 19:43332389-43332411 TTTAGCAAAGCTCTCAGGTGGGG No data
1166499811_1166499815 0 Left 1166499811 19:43332361-43332383 CCACTGCCATGGCCTCCTCTGAC 0: 2
1: 1
2: 7
3: 48
4: 481
Right 1166499815 19:43332384-43332406 TGCTGTTTAGCAAAGCTCTCAGG 0: 2
1: 0
2: 0
3: 9
4: 142
1166499811_1166499819 12 Left 1166499811 19:43332361-43332383 CCACTGCCATGGCCTCCTCTGAC 0: 2
1: 1
2: 7
3: 48
4: 481
Right 1166499819 19:43332396-43332418 AAGCTCTCAGGTGGGGCTGATGG No data
1166499811_1166499821 24 Left 1166499811 19:43332361-43332383 CCACTGCCATGGCCTCCTCTGAC 0: 2
1: 1
2: 7
3: 48
4: 481
Right 1166499821 19:43332408-43332430 GGGGCTGATGGCGCTGTCCTGGG No data
1166499811_1166499820 23 Left 1166499811 19:43332361-43332383 CCACTGCCATGGCCTCCTCTGAC 0: 2
1: 1
2: 7
3: 48
4: 481
Right 1166499820 19:43332407-43332429 TGGGGCTGATGGCGCTGTCCTGG No data
1166499811_1166499816 3 Left 1166499811 19:43332361-43332383 CCACTGCCATGGCCTCCTCTGAC 0: 2
1: 1
2: 7
3: 48
4: 481
Right 1166499816 19:43332387-43332409 TGTTTAGCAAAGCTCTCAGGTGG No data
1166499811_1166499823 28 Left 1166499811 19:43332361-43332383 CCACTGCCATGGCCTCCTCTGAC 0: 2
1: 1
2: 7
3: 48
4: 481
Right 1166499823 19:43332412-43332434 CTGATGGCGCTGTCCTGGGGAGG 0: 2
1: 0
2: 1
3: 16
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166499811 Original CRISPR GTCAGAGGAGGCCATGGCAG TGG (reversed) Intergenic
901012054 1:6207596-6207618 TTCAGAGGACGACCTGGCAGTGG + Intronic
901167783 1:7232104-7232126 GTTAGAGGACTCCAGGGCAGAGG + Intronic
901421496 1:9154234-9154256 TTCAGGGGTGGGCATGGCAGGGG + Intergenic
901436955 1:9252820-9252842 GTCAGAGGATGACAAAGCAGGGG - Intronic
901738777 1:11328878-11328900 CTCAGAGGAGGAGATGGCTGGGG + Intergenic
901857464 1:12053513-12053535 GTCAGTGCAAGCCAAGGCAGTGG + Intergenic
902079564 1:13811893-13811915 GGCAGAGGAGGGCAGGGCAGGGG + Intronic
902189294 1:14750267-14750289 GGCAGAGGAGTCCATGTCTGTGG - Intronic
902646021 1:17798410-17798432 GTAAGAGTAGGTGATGGCAGAGG + Intronic
902786236 1:18734401-18734423 TTCAGAGGAGGGCAGGGGAGAGG - Intronic
903323620 1:22556762-22556784 GTCAGAGGAGGGGAGGGCAGGGG + Intergenic
903935286 1:26890947-26890969 GGTAGATGAGGCCAGGGCAGAGG + Exonic
905118982 1:35667145-35667167 GGCAGTGGAGCCCATGGCACTGG + Intergenic
905284926 1:36873100-36873122 GCCAGAGGAGGCCATTGCTGAGG - Intronic
905414829 1:37796623-37796645 TTCAGAAGAGGGCCTGGCAGTGG - Intronic
905873819 1:41419546-41419568 GGCAGAGGACGCCCTGGCAGAGG - Intergenic
906129981 1:43450286-43450308 GTGAGAGGAGGGCATGGGTGGGG - Intronic
906163392 1:43667963-43667985 CCCAGAGGAGGACATGGAAGGGG + Exonic
906697039 1:47830003-47830025 GGCAGAGGGGGTCATGGAAGAGG - Intronic
906817078 1:48890150-48890172 GTGAAAGGAGGCCAAGGCACTGG - Intronic
907525933 1:55054007-55054029 TACAGAGGAGGAAATGGCAGTGG - Intronic
907704938 1:56824844-56824866 GTCACATGGGGCCATGGTAGTGG - Intergenic
909740898 1:79028766-79028788 CTCTAAGGAGCCCATGGCAGAGG + Intergenic
910149035 1:84119116-84119138 GACAGAGAAAGACATGGCAGAGG - Intronic
911129017 1:94370190-94370212 GTCAAGGGAAGCCATGACAGTGG - Intergenic
911475461 1:98367443-98367465 CTCAGAGCAGGCCCTGGGAGTGG + Intergenic
911671898 1:100617116-100617138 GTGAGAGGAGGCTATTGCATTGG - Intergenic
912095371 1:106134573-106134595 GTCAGAGGAGGAAATGGCAGGGG + Intergenic
915068248 1:153244255-153244277 GGCAGTGGAGGTGATGGCAGTGG + Intergenic
916074536 1:161192882-161192904 GACAGAGGAGCCCATGGAAGAGG + Intronic
916174459 1:162025896-162025918 GGGAGGGGGGGCCATGGCAGGGG + Intergenic
917517207 1:175718262-175718284 GTCAGAGAAGGCCAGGACAGGGG - Intronic
919377199 1:196809091-196809113 TGCACAGGAGCCCATGGCAGCGG - Intergenic
919803020 1:201364852-201364874 GGAAGAGGAGGCAAGGGCAGGGG + Intronic
920086285 1:203419960-203419982 GTCACTGGAGGCCATGGGAATGG + Intergenic
920232493 1:204479965-204479987 GACAGGAGAGGCCACGGCAGAGG + Intronic
923762953 1:236863636-236863658 GGAAGAGTAGGGCATGGCAGTGG + Intronic
924519516 1:244794181-244794203 GTGAGAGGAGGCTACGGAAGAGG - Intergenic
924858396 1:247896927-247896949 CTTTTAGGAGGCCATGGCAGGGG - Intergenic
1063522014 10:6749759-6749781 GTCAGAAGATGCCAGGGGAGAGG + Intergenic
1065684501 10:28270396-28270418 GTAGGAGGAAGCCAGGGCAGTGG + Intronic
1067101706 10:43338992-43339014 GGAAGAGGAGGCCATGGGGGAGG + Intergenic
1069559075 10:69416927-69416949 GCCAGTGGGGGCCTTGGCAGAGG + Intergenic
1069751421 10:70747640-70747662 TTCTGTGGAGGTCATGGCAGAGG + Intronic
1070135276 10:73688926-73688948 GGCAGAGGAGGCAGAGGCAGAGG - Intronic
1070722048 10:78763776-78763798 GTCAGAGGAGGCCAGGGCCGTGG + Intergenic
1070779725 10:79130474-79130496 GTCTGAGAAGGGCACGGCAGGGG - Intronic
1070855579 10:79605910-79605932 GTCAGAGGGGACCAGGGCATTGG - Intergenic
1071470251 10:85979192-85979214 GGCACTGGAGGCCATGGGAGGGG - Intronic
1072281964 10:93873850-93873872 GTCAGAGAGGCACATGGCAGAGG + Intergenic
1073055500 10:100698081-100698103 GTAAGAGAAGGCCCTGGCAGAGG - Intergenic
1073196274 10:101694631-101694653 GACAGGGGTGGCCATGGCGGCGG - Exonic
1073729541 10:106272168-106272190 GTCAGAGGAGACCAGGGCATTGG + Intergenic
1074934077 10:118160181-118160203 TCCAGAGGTTGCCATGGCAGTGG + Intergenic
1075374320 10:121965769-121965791 ATCTGGGGAGGCCAAGGCAGAGG + Intronic
1075863560 10:125698088-125698110 ATGAGAGGAGGCTATGGCAGAGG + Intergenic
1076109691 10:127851172-127851194 GCCAGAGGAGGCCAAGGCAGAGG + Intergenic
1076133212 10:128028005-128028027 GGCAGGACAGGCCATGGCAGAGG + Intronic
1076378561 10:130009507-130009529 GACAGAGGAACCCAAGGCAGCGG + Intergenic
1076548245 10:131260359-131260381 GTCCACGGAGACCATGGCAGCGG + Exonic
1076883051 10:133248731-133248753 CCCAGAGGAGGCCAGGGCACAGG + Intergenic
1077018099 11:405845-405867 GACAGCGGGGGCCAGGGCAGCGG - Exonic
1077232097 11:1462332-1462354 GACAGACGACTCCATGGCAGAGG - Intronic
1077334410 11:1997098-1997120 GTCAGACAGGGACATGGCAGGGG - Intergenic
1077352148 11:2097945-2097967 GACAGAGGAGGCCCTGGAAGAGG + Intergenic
1077472585 11:2770934-2770956 GGCAGAGGAGACCATGGGAAGGG + Intronic
1077907229 11:6544072-6544094 GTCAGATGAGGCAAGGGCCGGGG - Intronic
1078350291 11:10587360-10587382 GTCAGAGGGAACCATGGCAGTGG - Intronic
1078902079 11:15650888-15650910 CTCAGAGGCTGCCAGGGCAGGGG - Intergenic
1080078794 11:28187226-28187248 GTCAGAGAAGGCCATAGCACTGG - Intronic
1080799648 11:35598401-35598423 GTCAGAGAAGGCGGTAGCAGGGG - Intergenic
1081591061 11:44423527-44423549 GACAGAGGATGCCATGCCTGTGG - Intergenic
1081672256 11:44949040-44949062 GAAAGAAGCGGCCATGGCAGGGG + Intronic
1083779482 11:64910535-64910557 AGCAGAGGAGGCCCTGGCAGAGG + Intronic
1083958924 11:66003139-66003161 GTAAGAGGAAGCCAAGCCAGGGG - Intronic
1084150990 11:67287935-67287957 GAGAGAGGAGGCCGTGGAAGAGG + Intergenic
1084339063 11:68481313-68481335 CTCAATGAAGGCCATGGCAGAGG - Intronic
1084404047 11:68960818-68960840 GTCAGAGGAGGCAGAGGCTGCGG - Intergenic
1084707252 11:70822684-70822706 GACAGAGGTGGCGCTGGCAGAGG + Intronic
1084707260 11:70822715-70822737 GACAGAGGTGGCGCTGGCAGAGG + Intronic
1084707268 11:70822746-70822768 GACAGAGGTGGCGCTGGCAGAGG + Intronic
1084707289 11:70822839-70822861 GTCAGAGGTGGCGTTGGCAGAGG + Intronic
1084707298 11:70822870-70822892 GGCAGAGGTGGCACTGGCAGAGG + Intronic
1084707306 11:70822901-70822923 GACAGAGGTGGCACTGGCAGAGG + Intronic
1084707314 11:70822932-70822954 GACAGAGGTGGCACTGGCAGAGG + Intronic
1084933227 11:72573475-72573497 GTCAGAGAAGGATATGGGAGGGG - Intergenic
1086429183 11:86718842-86718864 GTCAGGGAAGGCATTGGCAGTGG - Intergenic
1086946101 11:92845359-92845381 ATTAGAGGAGGCCAGGCCAGAGG + Intronic
1086981856 11:93206985-93207007 GTCAGAGGCTGCCCTGGCAAGGG - Intergenic
1088123813 11:106399425-106399447 GTGAGAGGCTGCCATGGGAGGGG + Intergenic
1089080392 11:115771813-115771835 ATCAGAGGAGGCCCTGGATGTGG + Intergenic
1089327000 11:117664108-117664130 GGGAGAGGAGGCCAGGGGAGGGG + Intronic
1089343862 11:117777842-117777864 AACAGAGGAGGACAAGGCAGAGG - Intronic
1089514974 11:119026602-119026624 GTCAGACCGGGCCATGGCAAAGG - Exonic
1090271072 11:125386927-125386949 AGCAGAGGAGGCCCTGCCAGAGG + Intronic
1090726507 11:129531752-129531774 GTCATAGGAGCCCATTGAAGAGG - Intergenic
1202817393 11_KI270721v1_random:52280-52302 GTCAGACAGGGACATGGCAGGGG - Intergenic
1091518067 12:1206488-1206510 GACAGAGGAGAGCAGGGCAGGGG - Intronic
1091691833 12:2602306-2602328 GTCAGGGGAGGTCACGGCAGTGG - Intronic
1092114978 12:5994027-5994049 GTAAGAGGAGGACCTGGCAGTGG + Exonic
1092945236 12:13448179-13448201 GTGAGATGAGGCCAGGACAGTGG - Intergenic
1092993478 12:13926007-13926029 ATCAGAGGAGGCAATGGAACGGG + Intronic
1094117672 12:26935121-26935143 GTCAGAGCAGGCAGTGGGAGAGG + Intronic
1095939717 12:47718045-47718067 AGCAGGGGCGGCCATGGCAGTGG - Intronic
1096993937 12:55827492-55827514 GAGATAGCAGGCCATGGCAGCGG - Exonic
1097683342 12:62669685-62669707 CTAATAGGAGGCCAAGGCAGGGG + Intronic
1098736812 12:74115289-74115311 GTCAGAAGATGACATGGCAGAGG - Intergenic
1101522536 12:105497147-105497169 GGCAGTGGTGGCAATGGCAGTGG + Intergenic
1102089144 12:110172297-110172319 GGCAGAGGAGGCAGAGGCAGAGG - Intronic
1102722482 12:115029298-115029320 ATCCGAGGAGGTCATGGCAAGGG + Intergenic
1102778648 12:115543563-115543585 TTAAGAGGAGGCCATGGCACTGG - Intergenic
1103444357 12:120984506-120984528 GACACAGGAGGACATGGCACAGG + Intronic
1104079144 12:125415081-125415103 GGAAGAGGAGGCCATTGCACTGG - Intronic
1104709326 12:130974265-130974287 GGCAGAGGAGGCCTTCTCAGGGG + Intronic
1105026530 12:132852922-132852944 GTCAGAGGAGAGCTGGGCAGGGG - Intronic
1105504665 13:20999233-20999255 GTCGGAGGCGGCCACGGCTGGGG - Intronic
1106131788 13:26946881-26946903 CTCAGAGGAAGCTGTGGCAGGGG - Intergenic
1106200600 13:27533511-27533533 GGCAGAGGAGGCCAGGGGAGTGG + Intergenic
1106550008 13:30762888-30762910 GTCAGAGGAGGGCTCTGCAGAGG + Intronic
1107853373 13:44591819-44591841 ATCAGAGTAGGCCCTGGGAGTGG - Intergenic
1110569380 13:76988385-76988407 GGCAGTGAAGGCTATGGCAGTGG + Intergenic
1110619558 13:77579754-77579776 CTCAAAGGAGGCAATGCCAGAGG + Intronic
1113531998 13:111033968-111033990 GCCAGAGGAGCCCATGAGAGAGG + Intergenic
1113904213 13:113811764-113811786 CTCAGACGAAGCCAGGGCAGAGG - Exonic
1115607294 14:35016498-35016520 GCCAGAGGAGATGATGGCAGAGG - Intronic
1115761595 14:36582375-36582397 TCCAGAGGTGGCCATGGCCGAGG + Exonic
1117253493 14:53956353-53956375 GACAGAGAAGGCCTGGGCAGGGG + Intronic
1117737868 14:58786004-58786026 GTCAGCAGAGGCTCTGGCAGTGG - Intergenic
1117828516 14:59727414-59727436 GTCCGAGGACCCCATGGCCGCGG - Exonic
1118627702 14:67674475-67674497 GGCGGAGGAGGCCATGGCGCAGG + Exonic
1118640673 14:67789426-67789448 GTCAAATGCAGCCATGGCAGGGG + Exonic
1119181450 14:72608002-72608024 GACACAGGTGGGCATGGCAGTGG - Intergenic
1119432632 14:74578483-74578505 GTCAGGGGAGCCCGGGGCAGGGG - Intronic
1119600660 14:75974186-75974208 GTCAGAGTGGGTCAAGGCAGTGG + Intronic
1119649506 14:76373703-76373725 GTGAGAGGAGGCTCAGGCAGAGG + Intronic
1119777219 14:77256764-77256786 GTCAGGGGAGGGCCTGGCAAGGG + Exonic
1119956909 14:78808574-78808596 GACAGAGGAGGCCATGCCCCTGG - Intronic
1120112607 14:80575488-80575510 TTCAGAGTTGACCATGGCAGGGG + Intronic
1120678765 14:87453777-87453799 GACAGAAGAGGCCTGGGCAGTGG - Intergenic
1121309686 14:92929105-92929127 GTCAGAGGAGGCAGCGGCGGCGG + Intronic
1121326277 14:93021635-93021657 CTCAGAGGACTCCATGCCAGTGG + Intronic
1121363564 14:93286085-93286107 AGGAGAGAAGGCCATGGCAGTGG - Intronic
1122706695 14:103626392-103626414 GTCAGAGGAGGCCTTGACCCAGG + Intronic
1123506237 15:20942752-20942774 GCCAGCTGTGGCCATGGCAGGGG + Intergenic
1123563463 15:21516456-21516478 GCCAGCTGCGGCCATGGCAGGGG + Intergenic
1123599715 15:21953742-21953764 GCCAGCTGCGGCCATGGCAGGGG + Intergenic
1123880677 15:24675790-24675812 GCCAGAGGAGGCGGTGGCTGAGG + Intergenic
1124595533 15:31088813-31088835 GTCAGAGGAGGCCTTTGTACCGG + Intronic
1124633529 15:31350766-31350788 CTTAGAGGTGGCCATGCCAGTGG + Intronic
1124805662 15:32879592-32879614 GTCAGATGAGGCGATGCCTGAGG - Intronic
1125727731 15:41876665-41876687 GTTGGAGGAGGGCATGGGAGAGG + Intronic
1126150773 15:45522340-45522362 GCCAGAGCCGGCCATGGCAGAGG + Exonic
1126376481 15:48001938-48001960 GACACAGGAAGCCATAGCAGTGG + Intergenic
1129252187 15:74315136-74315158 CTCAGTGGAGGCCGTTGCAGGGG + Intronic
1129659482 15:77544983-77545005 GACAGATCTGGCCATGGCAGAGG - Intergenic
1129811015 15:78509997-78510019 ATCAGGGAAGGCCATGGCAGGGG + Intronic
1129992696 15:79978493-79978515 GTCAGGGCAGGCACTGGCAGGGG - Intergenic
1130045798 15:80443656-80443678 GGCAGAGGAGGCCTAGGAAGAGG + Intronic
1130681765 15:86003092-86003114 GTGTGTGGAGGACATGGCAGAGG + Intergenic
1132023710 15:98386517-98386539 GCCAGAGGAGGAGAGGGCAGAGG - Intergenic
1202971821 15_KI270727v1_random:243593-243615 GCCAGCTGTGGCCATGGCAGGGG + Intergenic
1132518110 16:375280-375302 ATCAGAGGAGGCCGGGGCGGGGG + Intronic
1132840823 16:1977796-1977818 GTCAGGTAAGGCCAGGGCAGTGG + Exonic
1132858113 16:2056513-2056535 GAGAGAGGGTGCCATGGCAGCGG + Intronic
1133139635 16:3734690-3734712 GACAGAGGAGGCGCGGGCAGGGG - Intronic
1133177406 16:4025651-4025673 GTCAGTGCAGGACATGGCACAGG - Intronic
1133264730 16:4576180-4576202 GGCAGCGGCGGCGATGGCAGCGG - Exonic
1134059315 16:11189378-11189400 TCAAGAGGAGCCCATGGCAGTGG + Intergenic
1135137393 16:19895187-19895209 GAAAGAGGAGGACAGGGCAGAGG + Intergenic
1135684773 16:24490035-24490057 GTCTGGGGAGGCCAAGGCAAGGG - Intergenic
1136272381 16:29156039-29156061 GTCAGAGGCAGCTATGGCAAAGG + Intergenic
1137617016 16:49854697-49854719 GGGAGAGGAGGCCAGGGGAGGGG + Intronic
1137722924 16:50638410-50638432 GTCTGGGGAGGCCGAGGCAGGGG - Exonic
1138442359 16:57042639-57042661 GCCAGAGGAGCCCAGGGGAGAGG + Intronic
1138584503 16:57961132-57961154 GCCCCAGGAGGCCATGGCTGTGG - Intronic
1139375336 16:66493324-66493346 GTCCGAGACGGCCCTGGCAGAGG + Intronic
1139470156 16:67174096-67174118 GTCAGAGGCGGCGAGGGCAGCGG + Intronic
1140735387 16:77893483-77893505 GTCATAGTAGGCCATGAAAGTGG + Intronic
1141033731 16:80610962-80610984 GAGGGATGAGGCCATGGCAGTGG - Intronic
1141376470 16:83535457-83535479 GTGAGAGGTGGCCAAGGCAAAGG + Intronic
1141522909 16:84593345-84593367 GACAGAGGAGTCCAGGGCACAGG + Intronic
1141904457 16:87014835-87014857 GGCAGAACTGGCCATGGCAGAGG + Intergenic
1141992166 16:87616776-87616798 CTCAGAGGCTGCCAGGGCAGCGG - Intronic
1142075942 16:88117850-88117872 GTCAGAGGCAGCTATGGCAAAGG + Intronic
1142616358 17:1138264-1138286 GTGATAGAAGTCCATGGCAGTGG + Intronic
1142967631 17:3591136-3591158 GTCAGGGCAGGCCAGGGCTGGGG + Intronic
1143108200 17:4539825-4539847 GTCAGAGGATGGCACGCCAGCGG - Exonic
1143165550 17:4895620-4895642 GACAGAGGAGGCCAGGGCGGTGG + Intronic
1143630952 17:8140162-8140184 GTCACGGGTGGCCAAGGCAGAGG - Intergenic
1144020942 17:11240225-11240247 GCTAGAGAAGGCAATGGCAGGGG + Intergenic
1144476958 17:15596677-15596699 GACAGAGGAAGACATGGGAGTGG + Intronic
1144714548 17:17424827-17424849 CTCAGAGGAGGCCCTGGAATGGG - Intergenic
1144847964 17:18229875-18229897 CTCAGGGTGGGCCATGGCAGAGG + Intronic
1145251801 17:21300832-21300854 TTCAGAGGTTGCCGTGGCAGAGG - Intronic
1146261990 17:31427891-31427913 GTCAGAGGCTGGCATGGCTGGGG + Intronic
1146374249 17:32283876-32283898 GTGAGAACAGGCCATGGCTGAGG + Intronic
1147166061 17:38594078-38594100 GGCAGAGGGGGCCAGGGCAAGGG - Intronic
1147783702 17:42962742-42962764 CTGAGTGGAGGCCAGGGCAGTGG + Intronic
1148791135 17:50173626-50173648 GGCAGGTGAGGCCCTGGCAGAGG - Intronic
1148845199 17:50525952-50525974 GGCTGAGGAGGCCAGGCCAGGGG + Exonic
1149546356 17:57506632-57506654 GTCGGGGGAGGCCATGGGAGTGG + Intronic
1149934563 17:60792190-60792212 GGCAGTGGTGGCCATGGCAGTGG + Intronic
1150143061 17:62746190-62746212 GCCCCAGGAGGGCATGGCAGTGG + Intronic
1150316583 17:64174341-64174363 GACTGAGGAGGACTTGGCAGGGG + Intronic
1151113208 17:71703694-71703716 GTCAGAGGAGGCTCTGGAAGGGG - Intergenic
1151194920 17:72424625-72424647 GTGGGAGGAGGGGATGGCAGGGG - Intergenic
1151582034 17:74985461-74985483 ATCAGAGGAGGCTTTTGCAGAGG + Intergenic
1151657608 17:75503027-75503049 GCTACAGGCGGCCATGGCAGGGG - Exonic
1151823283 17:76508868-76508890 GGAAGAGGAGGCTTTGGCAGGGG + Intergenic
1151825105 17:76519633-76519655 GGGAGAGGAGGCTTTGGCAGAGG - Intergenic
1151870666 17:76834320-76834342 AGCAGAGGAGGGAATGGCAGGGG + Intergenic
1152272492 17:79333125-79333147 GACAGAGGAGGACAGGCCAGGGG + Intronic
1152507107 17:80757065-80757087 CTCACAGGAGGCCATGGGAAAGG + Intronic
1152561917 17:81082894-81082916 GACAGAGTAGGCCACGTCAGCGG - Intronic
1153310164 18:3669634-3669656 GTCAGAGGAGAGCCGGGCAGCGG + Intronic
1155201084 18:23518243-23518265 GACTGGGGAGGCCAAGGCAGGGG + Intronic
1155296060 18:24385509-24385531 GGCAAAGGAGGCCAGGGAAGAGG + Intronic
1155374456 18:25140434-25140456 GTCAGGGTAAGACATGGCAGAGG + Intronic
1155956920 18:31962170-31962192 GTCAGCTTGGGCCATGGCAGTGG - Intergenic
1157367165 18:47075686-47075708 TCCAGAGGAGGCCATCACAGCGG - Intronic
1157485502 18:48084224-48084246 GTCAGAGGAAGGCGGGGCAGTGG + Intronic
1157756498 18:50222546-50222568 ATCATACGAGGCCTTGGCAGGGG + Intergenic
1158010374 18:52721114-52721136 GGCAGAGAAGGCCTTAGCAGAGG + Intronic
1160324982 18:77937733-77937755 GTCAGAGGAGGACTTGTCAGAGG + Intergenic
1160329766 18:77980501-77980523 GTCAGACGCGGCCGTGGCTGGGG + Intergenic
1160521497 18:79510815-79510837 GGCAGAGGATGCCCCGGCAGAGG - Intronic
1160521502 18:79510830-79510852 GGCAGAGGATGCCCCGGCAGAGG - Intronic
1160521507 18:79510845-79510867 GGCAGAGGATGCCCCGGCAGAGG - Intronic
1160679518 19:406411-406433 AGCAGAGGAGGTCTTGGCAGAGG - Exonic
1161104020 19:2434464-2434486 GCTGGAGGAGGCCATGGCCGGGG - Exonic
1161568532 19:5017010-5017032 GGCAGAGGTGGCAGTGGCAGCGG + Intronic
1162098485 19:8324998-8325020 GGAAGAGGAGGACATGGCTGTGG - Exonic
1162303701 19:9858638-9858660 GTCAGGAGAGGCCAGGGCAAGGG - Intronic
1162319222 19:9960894-9960916 GTGAGAGGAGGGCAAGGCAGAGG + Intronic
1162380233 19:10327571-10327593 GTGAGCGGAGGCCAGTGCAGAGG - Intronic
1163236119 19:16031612-16031634 GTCAGTGGGGGCCTTGTCAGTGG + Intergenic
1163236170 19:16031828-16031850 GTCAGCGGGGGCCTTGTCAGTGG + Intergenic
1163267237 19:16228511-16228533 GTCCTAGGAGGGCAGGGCAGAGG + Intronic
1163500677 19:17674415-17674437 GGCACAGGAGGCCAGGGCGGAGG + Intronic
1163862241 19:19748499-19748521 TGCACAGGAGGCCATGGCCGGGG - Intergenic
1163863399 19:19754143-19754165 GTCAGTGGAAGCCTCGGCAGTGG - Intergenic
1165755230 19:38288994-38289016 GGCAGAGCCGGCCATGGAAGGGG + Intronic
1165934821 19:39383018-39383040 GGCAGAGGAGACAATGGCAATGG - Intronic
1166072781 19:40396653-40396675 GTCAGAGGTGGCTGTGCCAGAGG - Exonic
1166198881 19:41223484-41223506 GACAGAGGAGCAGATGGCAGAGG + Intronic
1166267866 19:41696144-41696166 GTCAGAGGAGGCCATGGCAGTGG + Intronic
1166355524 19:42225150-42225172 GGATGAGGAGGCCATGGCAGAGG + Exonic
1166391112 19:42409454-42409476 GCCATAGGAGGCCAAGGCAAGGG + Intronic
1166499811 19:43332361-43332383 GTCAGAGGAGGCCATGGCAGTGG - Intergenic
1168332617 19:55579033-55579055 GTCGGAGGAGGCCGAGGCCGGGG - Exonic
924962209 2:45738-45760 GTCAGACTCGGCCAAGGCAGCGG + Exonic
925286312 2:2717793-2717815 GTCAGAGGAGGGCATGGCAGGGG - Intergenic
926023468 2:9517642-9517664 GTCAGAGGGGTCCAGGACAGAGG + Intronic
926937791 2:18103659-18103681 GTCAAAGGAGGCATTGGCTGGGG - Intronic
928437777 2:31266734-31266756 GTTAGAGGAGGAGATGGGAGCGG + Exonic
928679084 2:33680672-33680694 GTCAGGGAGGGACATGGCAGTGG - Intergenic
929400001 2:41568346-41568368 GTCTGGGGAAGCCATGGCTGGGG + Intergenic
929493956 2:42423225-42423247 GTAAGAGGAAGCAATGGGAGTGG - Intronic
929560245 2:42952035-42952057 GCCAGAGGCAGCCATGGCTGAGG - Intergenic
931274893 2:60735806-60735828 GACGGAGGAGGCGAGGGCAGCGG + Intergenic
932119744 2:69087744-69087766 GGCAGTGGTAGCCATGGCAGAGG - Intronic
932779885 2:74553500-74553522 GGCAGAGAAGGCCTTGGCTGAGG - Intronic
933608096 2:84405308-84405330 GTCTGGGGAGACCCTGGCAGAGG + Intergenic
934663366 2:96154649-96154671 GCCAGAGGAGGCCAAGGGAGGGG + Intergenic
936042562 2:109160947-109160969 CTGAGAGGAGGGCGTGGCAGGGG + Intronic
936104552 2:109613813-109613835 CTCGGAGGAGGCCATGGTCGCGG + Exonic
936643106 2:114337824-114337846 GTCAGAGGAGGCAATTGAATTGG + Intergenic
937125594 2:119473367-119473389 GGGAGAGGAGGCCCTGGGAGAGG - Intronic
937222700 2:120350924-120350946 CTCAGCGGAGGCCAAGGGAGGGG + Exonic
937349441 2:121151063-121151085 GTCAGAGGGGGTAATGCCAGGGG + Intergenic
937984587 2:127632815-127632837 GCCACAGGAGGCCAAGCCAGAGG - Intronic
938061075 2:128254676-128254698 GTCAGAGAAGGCCAGGTAAGGGG + Intronic
938583737 2:132669969-132669991 ATCAGAGGAGGCGACAGCAGCGG + Exonic
941230404 2:162904734-162904756 CACAGAGCAGGCCATGGCAGGGG + Intergenic
942443519 2:176060999-176061021 TTCACAGGAGGCCAGGACAGAGG - Intergenic
944836329 2:203583928-203583950 GTCAGAGGAGGCTGGGGCACAGG - Intergenic
945023316 2:205595853-205595875 GTGAGAGTAGGTCATGGGAGGGG + Intronic
945374833 2:209067827-209067849 GTCAGAGGAGGCCTCGTCGGGGG - Intergenic
945809035 2:214525579-214525601 GTCAGAAGAGGCAATTCCAGGGG - Intronic
945969396 2:216221262-216221284 GTCAGAGGGGGACGTGGCTGAGG - Intergenic
946047129 2:216830520-216830542 GTCAGAGGTTGCCATGGGAATGG + Intergenic
947017638 2:225638871-225638893 GGGAGAGGAGGCCAAGACAGAGG + Intronic
947758840 2:232588578-232588600 GTCCAAGGAGGCCAGGGCATAGG - Intergenic
947901572 2:233725213-233725235 GGCAGAGGAGGCAGAGGCAGAGG + Intronic
947901575 2:233725228-233725250 GGCAGAGGAGGCAGAGGCAGAGG + Intronic
947901578 2:233725243-233725265 GGCAGAGGAGGCAGAGGCAGAGG + Intronic
947901581 2:233725258-233725280 GGCAGAGGAGGCAGAGGCAGAGG + Intronic
948351841 2:237347375-237347397 GTCTGAGGAGCCCATGGCCTTGG + Intronic
948551353 2:238774995-238775017 GCCAGAGGGGACCATGGCAGAGG - Intergenic
948693330 2:239720495-239720517 GGCCGTGGAGGCCGTGGCAGAGG - Intergenic
1169357750 20:4922274-4922296 GTCAGAAGAGACCAAGGCTGTGG + Intronic
1169638874 20:7725739-7725761 GTCAGAACAAGCCAAGGCAGTGG + Intergenic
1170596115 20:17807005-17807027 GCCCGAGGAGGCCCTGGCTGGGG + Intergenic
1171968528 20:31548939-31548961 GACGGAGGAGGGCATGGCTGTGG - Intronic
1173171325 20:40726407-40726429 GTCAGCTTAAGCCATGGCAGAGG + Intergenic
1173340936 20:42152212-42152234 GTTAGTGGTGGCCTTGGCAGAGG + Intronic
1173828773 20:46064594-46064616 TTCAGTGGAGTACATGGCAGAGG + Intronic
1174918338 20:54676517-54676539 GACAAAGGGGGCCATGGCAAGGG - Intergenic
1175245504 20:57579658-57579680 TTCAGGGGAGACCATGGGAGGGG - Intergenic
1175805443 20:61825988-61826010 GTCAGAGCACGCTGTGGCAGTGG - Intronic
1175853050 20:62104076-62104098 GGCAGAGGAGGGCCAGGCAGAGG + Intergenic
1175913488 20:62415342-62415364 GGCAGCAGAGGCTATGGCAGAGG - Intronic
1175988629 20:62776747-62776769 GACAGAGGAGGGCAGGGCGGAGG + Intergenic
1176221333 20:63970470-63970492 GGCAGAGAAGGCCCTGGCACTGG - Intronic
1176273971 20:64253191-64253213 CTGTGAGGAGGCCAGGGCAGAGG + Intergenic
1177163567 21:17575424-17575446 GACTTAGGAGGCCGTGGCAGGGG - Intronic
1179047651 21:37860764-37860786 GTCAGGGAAGGCCTTGGAAGAGG - Intronic
1179480500 21:41673799-41673821 ATCAGGCGAGACCATGGCAGAGG - Intergenic
1179664827 21:42903948-42903970 GGCAGAAGAGGCCAGAGCAGAGG + Exonic
1179714783 21:43280993-43281015 GTCATAGAAGGCTGTGGCAGGGG + Intergenic
1180047827 21:45318003-45318025 GGCAGAGGAGGCCACGGTGGAGG + Intergenic
1180814818 22:18782708-18782730 GTCTGAGGAGGGCACAGCAGGGG + Intergenic
1180980934 22:19877667-19877689 GTCAAAGGAAGCCATGGCAAAGG - Intronic
1181026590 22:20131061-20131083 GGCAGAGGAGGCGGTGCCAGCGG - Intronic
1181201004 22:21217044-21217066 GTCTGAGGAGGGCACAGCAGGGG + Intronic
1181256238 22:21564613-21564635 GTAAGAAGATGCCATGGCAAAGG + Intronic
1181310954 22:21944492-21944514 GTCAGAGGGAGCTATGGCTGAGG + Intronic
1181491496 22:23263123-23263145 GACAGGGGCGGCCATGGCGGCGG + Intronic
1181500602 22:23313639-23313661 CCCAGAGGAGCCCAAGGCAGGGG - Intronic
1181645994 22:24232143-24232165 GCCAGTGCAGGCCATGGGAGTGG + Exonic
1181700736 22:24619926-24619948 GTCTGAGGAGGGCACAGCAGGGG - Intronic
1183175823 22:36224001-36224023 GTCAGAGGAGGAGATTACAGGGG + Intergenic
1183437784 22:37805252-37805274 GGCAGAGGAGGCGGAGGCAGAGG + Exonic
1183714716 22:39526957-39526979 GACACAGGAAGCCATGGCTGGGG + Intergenic
1184608188 22:45586303-45586325 TGCAGAGGCGGCCACGGCAGGGG - Intronic
1184763391 22:46558244-46558266 GACAGGGGTGGCCATGGCACTGG - Intergenic
1185198036 22:49484606-49484628 GTCAGAGGAGGTCAGGAAAGTGG + Intronic
1185272038 22:49934274-49934296 GTCAGCTGAGGACATGGCTGAGG - Intergenic
949895749 3:8766675-8766697 GGCAGAGGAGTCCAAGGGAGAGG - Intronic
950191589 3:10980379-10980401 TCCAAAGGAGGCCATGGCTGGGG - Intergenic
951900248 3:27650533-27650555 GTCAGAGAAGGTCATGAGAGTGG + Intergenic
952416675 3:33096553-33096575 GTCAGGAGAGGCCCTTGCAGTGG - Intronic
953537979 3:43790282-43790304 GCCAGAGGAGGCATTGGGAGAGG + Intergenic
954228599 3:49199347-49199369 GTCAGAGGAGACCCTGGGGGCGG + Intronic
954361874 3:50126461-50126483 GTCCGAAGAGGCCAAGGCTGTGG - Intergenic
954465686 3:50653375-50653397 GTGAGAGGCAGCCATGGCACAGG + Intergenic
954704415 3:52471596-52471618 GACAGAGGAGGGCAGGGCTGTGG - Intronic
954763566 3:52895304-52895326 GACAGAGCAGGCCAGGGCAATGG - Intronic
955631451 3:60979741-60979763 GACAGAGGGGGTGATGGCAGGGG - Intronic
955735894 3:62037873-62037895 GTTAGATGAGGTCATGACAGTGG - Intronic
956004224 3:64761797-64761819 GTCAGGGGAGGCCAAGACAGAGG + Intergenic
956623554 3:71245207-71245229 GTCAGAGGAGGCCAAGCCAGGGG - Intronic
956989944 3:74751568-74751590 CTCAGAGTAGGCCCTGGAAGGGG + Intergenic
957845131 3:85721969-85721991 GTCAGAGGAGGCCCTGGAGTGGG + Intronic
958026924 3:88059425-88059447 GGCAGAGGCGGCGCTGGCAGCGG + Exonic
960174246 3:114498374-114498396 TTTAGAGGAGGCCATTGAAGAGG + Intronic
960725995 3:120670707-120670729 GTGAGAAGAGGCCAGGGCTGTGG - Intronic
961593478 3:127998222-127998244 GGAAGAGGAGGCCCAGGCAGAGG + Intergenic
962346002 3:134619447-134619469 GGAAGAGCAGGCCTTGGCAGAGG + Intronic
962793942 3:138834846-138834868 GGCGGAGCGGGCCATGGCAGTGG - Intronic
962846976 3:139281649-139281671 GTCAGTGCCGGCCATGGCAGGGG - Intronic
962934103 3:140063668-140063690 GTCAGAGGAGGCAACGGAAGGGG - Intronic
963761760 3:149292101-149292123 GTCAGAGAGGGCCAGGGCATTGG + Intergenic
966096219 3:176206433-176206455 CTCAGAGGATGCCATTGCAGAGG + Intergenic
966913226 3:184570645-184570667 GTCAGGGGAGGCCAGGGCCAGGG + Intronic
967829762 3:193909108-193909130 GTCAGCGTAGGCCCTGCCAGGGG - Intergenic
968189083 3:196654476-196654498 GTCAGAGAAGGACATCCCAGAGG - Intronic
968283995 3:197497569-197497591 GACAGAGGAGGCCTGGACAGAGG + Intergenic
968480077 4:829375-829397 GGCAGTGGAGGCCTTGGCAGGGG - Intergenic
968582338 4:1400914-1400936 GACAGAGGAGGCCAGGGTGGGGG + Intergenic
968919303 4:3514482-3514504 GTCACAGGAGGACGAGGCAGTGG + Intronic
968923668 4:3535812-3535834 GGCAGAGGGGTCCAGGGCAGAGG + Intergenic
973164811 4:47063880-47063902 GTCAGGGGAGGGCAGGGCTGGGG + Intronic
973173556 4:47175299-47175321 ATCTGGGGAGGCCAAGGCAGAGG - Intronic
973826422 4:54711447-54711469 GCCAGAGGGGGCCATGGGATAGG + Intronic
974480648 4:62438372-62438394 TTCTCAGGAGGCCAAGGCAGGGG + Intergenic
974514959 4:62897177-62897199 TTCAGAGGAGGCCAAGGTGGTGG - Intergenic
974807529 4:66899538-66899560 CGCACAGGAGCCCATGGCAGAGG + Intergenic
975379723 4:73685134-73685156 GTCAGAGGAGGACATGGGAGAGG - Intergenic
975476800 4:74832889-74832911 GTCAGATGAGGCCGTGACGGTGG + Intergenic
978491625 4:109316755-109316777 GTCAGAGGGGACCAGGGCACTGG + Intergenic
980750126 4:137077196-137077218 ATCAGAGCAGGCCCTGGGAGGGG + Intergenic
981023247 4:140050570-140050592 TTCAGTGGAGCCCACGGCAGTGG - Intronic
981279064 4:142936215-142936237 GTCAGATGAGGTCCTGGAAGAGG - Intergenic
982331689 4:154187862-154187884 GTCAGAGGAGGCCATGATCAAGG - Intergenic
985083606 4:186291617-186291639 GGCAGTGCAGGCCAAGGCAGTGG + Intergenic
985327017 4:188782463-188782485 GCCAGAGGAGGACATGGACGTGG - Intergenic
985391915 4:189498806-189498828 GAGAGAGAAGGCCAGGGCAGGGG - Intergenic
985491441 5:182022-182044 GTCAGAGGAGGACACCGCTGTGG - Exonic
986163343 5:5250946-5250968 GGAAGAAGAGGCCATAGCAGTGG + Intronic
986249679 5:6044732-6044754 TTCAGAGGAGGTCATGAGAGTGG + Intergenic
986658844 5:10041160-10041182 GTCAGAAGATGCCAGGTCAGGGG + Intergenic
988604060 5:32665315-32665337 GTCAAAGGAGACCAGGGCATTGG - Intergenic
990982571 5:61615289-61615311 GTCACAGGATGCCATGGGAGAGG - Intergenic
991996113 5:72388817-72388839 GGCAGAGGAGAGCAAGGCAGAGG + Intergenic
993006833 5:82437575-82437597 GTCAGGGGAGGCCCAGGTAGGGG - Intergenic
993157089 5:84239651-84239673 GTCAGAGGAGGTCATGCTTGGGG + Intronic
993681034 5:90878376-90878398 GTCAGTGGTGGCCATGAGAGAGG + Intronic
994774834 5:104028079-104028101 GTCAGAGGAGACCAGGGCATTGG + Intergenic
995354222 5:111219674-111219696 CTGAGGGGAGGCCAGGGCAGGGG - Intergenic
995616484 5:113970123-113970145 GGCAGAACAGGCCCTGGCAGTGG - Intergenic
996478661 5:123949266-123949288 TGCACAGGAGCCCATGGCAGCGG + Intergenic
998462885 5:142322603-142322625 GTGAGATGAGGCCATTTCAGAGG + Intronic
998769278 5:145523655-145523677 GTTAAAGGAGACCATAGCAGCGG - Intronic
999169088 5:149578070-149578092 CACAGAGGAGACCATGCCAGAGG - Intronic
999257169 5:150216170-150216192 GTCAGGGGAGGACAGGGAAGTGG + Intronic
999278237 5:150346724-150346746 GTCTCTTGAGGCCATGGCAGGGG - Intergenic
1000009219 5:157216082-157216104 CTCAGAGGAGGATATGGCAATGG - Intronic
1000326661 5:160177515-160177537 ATCAGAGGAGGCCAGAGAAGAGG - Intergenic
1000635755 5:163641843-163641865 GTTAGATGAGGTCATGACAGTGG - Intergenic
1000650764 5:163815597-163815619 GTCAGAGGAGGAGATAGGAGAGG + Intergenic
1001244180 5:170093489-170093511 GTCAGAGGATGCCATGTGAGAGG + Intergenic
1001281269 5:170388032-170388054 AGCAGAGGAGGCCATGGCCCTGG - Intronic
1001475159 5:172045097-172045119 TCCAGAGAAGGCCATGTCAGTGG - Intronic
1001548242 5:172583983-172584005 GTGAGGGGAAGCCCTGGCAGAGG - Intergenic
1001586008 5:172834326-172834348 GCCGGAGGAGGCGTTGGCAGCGG + Exonic
1001667762 5:173447404-173447426 GTCAGATGAGGTCATGAGAGTGG - Intergenic
1001971633 5:175959934-175959956 GGGAGAGGAGGCCCCGGCAGAGG - Exonic
1001975920 5:175998199-175998221 AACTGAGGAGGCCAAGGCAGTGG + Intronic
1002171430 5:177376952-177376974 CTCAGAGGAAATCATGGCAGAGG - Intergenic
1002241506 5:177845573-177845595 AACTGAGGAGGCCAAGGCAGTGG - Intergenic
1002245809 5:177883843-177883865 GGGAGAGGAGGCCCCGGCAGAGG + Intergenic
1002461149 5:179374490-179374512 CTCAGAGGACGTCAGGGCAGAGG + Intergenic
1002461226 5:179374848-179374870 CACAGAGGATGCCAGGGCAGAGG + Intergenic
1002958556 6:1892813-1892835 GTCACAGTAGGCCAAGGCATTGG - Intronic
1003199049 6:3941979-3942001 CTCAGGGGAGGGCAGGGCAGAGG - Intergenic
1003614113 6:7639877-7639899 GTTAGATGAGGCCATGAGAGTGG - Intergenic
1004708071 6:18142953-18142975 GAGACAGGAGGCTATGGCAGTGG - Intronic
1005089736 6:22043752-22043774 GTCAGATGAGGCCAAGGGATTGG + Intergenic
1005980004 6:30829453-30829475 GGAAGAGAAGGCCATGGAAGTGG - Intergenic
1006300660 6:33192204-33192226 GGAGGAGGAGGCGATGGCAGCGG + Exonic
1006565904 6:34956955-34956977 GGCAGAGGAGGCCAGGGACGGGG - Intronic
1006797379 6:36740410-36740432 CTCAGAGGAGGTCATGGTTGAGG - Intergenic
1006807079 6:36795510-36795532 GTAAAATGAGGTCATGGCAGTGG + Intronic
1007099641 6:39237100-39237122 GCTGGAGGAGGCCATGGGAGAGG - Intergenic
1007255767 6:40527238-40527260 GTTAGAGAAGGCCCTGGAAGAGG - Intronic
1007461884 6:42025221-42025243 CTCCGAGCAGGCCAGGGCAGGGG + Intronic
1007518105 6:42429443-42429465 GTGAGAGGAGGCGGTAGCAGGGG - Intronic
1008863530 6:56181226-56181248 GGCAGTGGCCGCCATGGCAGAGG - Intronic
1012379611 6:98604529-98604551 GTTAGAGAAGGCCATGATAGAGG + Intergenic
1012842297 6:104344531-104344553 GTCAGTGGAGGCCATGTCGGGGG - Intergenic
1012953380 6:105542450-105542472 GTCAGAGGAGCCCCTGGCCCTGG + Intergenic
1012979219 6:105812289-105812311 GTGAGAGGAGGTCTTGGGAGTGG - Intergenic
1013003417 6:106047592-106047614 GACAGAAGAGGGCATTGCAGTGG - Intergenic
1014276755 6:119397428-119397450 GTCAGAGGGGACCAGGGCACTGG - Intergenic
1015522505 6:134145926-134145948 GCCAGATGAGGCCATTGCTGTGG - Intergenic
1016059531 6:139615206-139615228 GTCAGCGAAGGCCCAGGCAGTGG + Intergenic
1016412239 6:143795566-143795588 GTCAGAGAAGGCCATTGAATTGG + Intronic
1016986683 6:149900710-149900732 GTCACAGCAGGACAGGGCAGGGG - Intergenic
1017043024 6:150322974-150322996 GTCAGAGGAGACCCTGGCAGAGG + Intergenic
1017115819 6:150975633-150975655 GCCAGAGGAGGCCCAGACAGGGG - Intronic
1017810254 6:157979367-157979389 GTCAGATGACGTCATGCCAGTGG - Intergenic
1018027599 6:159818146-159818168 GACAGAGGGGGCACTGGCAGTGG + Intronic
1019493075 7:1324057-1324079 CTCAGAGGAACCCCTGGCAGTGG + Intergenic
1019815573 7:3197418-3197440 GTCAGAGGAGGCTCAGGCAGAGG + Intergenic
1019875354 7:3806128-3806150 GTCAGAAGAGTCACTGGCAGAGG - Intronic
1020733743 7:11918451-11918473 CTCCGAGGAGGCCAAGGCTGTGG - Intergenic
1021978518 7:26031790-26031812 GTCAGAGGTGACCATGGCCATGG + Intergenic
1022531628 7:31070366-31070388 GCCTGTGGTGGCCATGGCAGGGG + Intronic
1023611080 7:41971815-41971837 GGCAGAGGAAGCCATGGGACAGG - Intronic
1023883253 7:44333608-44333630 TGCAGAGCAGGCCCTGGCAGTGG - Intronic
1024310782 7:47966958-47966980 ATCAGAAGAGACCATGGGAGGGG - Intronic
1026262776 7:68770127-68770149 GTTTAAGGAGGCCAAGGCAGGGG + Intergenic
1027480198 7:78686291-78686313 GTCAGAGAAAATCATGGCAGTGG - Intronic
1029493802 7:100886480-100886502 GTCAGAGGTGCCCACAGCAGAGG - Intronic
1029667807 7:102007238-102007260 GTCAGAGAGGGCCATGGCTTAGG - Intronic
1030066800 7:105665843-105665865 CCCTGAGGAGGCCATAGCAGGGG - Intronic
1032516497 7:132509929-132509951 CTCAGAGGAGGCCCTGCTAGGGG - Intronic
1033366830 7:140678421-140678443 GTCAGAGGAGGCGCCGGCTGAGG + Intronic
1034174838 7:149091540-149091562 GACGGAGGAGGCCATGACACAGG + Intergenic
1034179677 7:149127069-149127091 GACGGAGGAGGCCATGACACAGG + Intronic
1034263687 7:149771912-149771934 GTCAGGGGAGGCGGTGGCAGCGG - Intronic
1034550942 7:151820348-151820370 GTCAAAGGAGCCCACGGCAGTGG - Intronic
1034854400 7:154528431-154528453 GAATGAGGAGGCCATGACAGAGG - Intronic
1035011860 7:155725618-155725640 TTCAGGAGGGGCCATGGCAGGGG + Intronic
1035633394 8:1126039-1126061 GTGGGAGAAGACCATGGCAGGGG - Intergenic
1036595122 8:10205100-10205122 GTCATGGGATGCCATGGAAGGGG + Intronic
1036672334 8:10799743-10799765 GTAAGAGGAGCCGCTGGCAGGGG + Intronic
1036713600 8:11099818-11099840 GTTAAGGGAGACCATGGCAGAGG + Intronic
1037287124 8:17313202-17313224 GACAGGGAAGCCCATGGCAGAGG + Intronic
1037761104 8:21742248-21742270 GTTAGATGAGGTCATGGCGGTGG + Intronic
1037830040 8:22182250-22182272 ATCAAAGGAGCTCATGGCAGAGG - Intronic
1037884399 8:22588807-22588829 GTCAGGGCCGGCCAGGGCAGAGG - Intronic
1038416638 8:27401288-27401310 ATCTGAGGAGCCCAAGGCAGAGG + Intronic
1038497829 8:28016980-28017002 GTCAGAGCTGGCACTGGCAGTGG - Intergenic
1039080256 8:33727007-33727029 TCCAGAGGAAGCCATGGCACTGG + Intergenic
1039610055 8:38912608-38912630 GGCAGAGGAGGCGAGGACAGTGG + Intronic
1040355855 8:46617576-46617598 GGCAGTGGAGGCCAGGGCTGTGG + Intergenic
1041473184 8:58233901-58233923 CTGTGAGGAGGCCATTGCAGGGG + Intergenic
1041523631 8:58781573-58781595 GTGAGGTGAGGCCAAGGCAGTGG + Intergenic
1041582488 8:59477540-59477562 GTTGGAGAGGGCCATGGCAGGGG + Intergenic
1041916415 8:63144014-63144036 GCCAGATGAGGCCAGGGCAGGGG + Intergenic
1042348692 8:67753808-67753830 GTCAGAGTAGGGCATCTCAGTGG - Intergenic
1042941666 8:74114571-74114593 GTAAAAGGGGGCCATGGTAGCGG - Intergenic
1043391752 8:79798698-79798720 GTCAGGGGTGGCCAGGGCAAGGG - Intergenic
1045866062 8:106866909-106866931 ATCAGAGGAGGCCCAGACAGAGG + Intergenic
1049641317 8:143717298-143717320 GGCAGAAGAGACCGTGGCAGGGG + Intronic
1049968520 9:800638-800660 CTGAGAGGAGGCCATGTAAGGGG - Intergenic
1050002210 9:1089508-1089530 TTCAGAGGAAGCAATGGAAGGGG + Intergenic
1052730468 9:32279200-32279222 GGCAGAGCAGGTCATGGAAGTGG - Intergenic
1053799380 9:41754834-41754856 GGCAGAGGGGTCCAGGGCAGAGG + Intergenic
1054145837 9:61560163-61560185 GGCAGAGGGGTCCAGGGCAGAGG - Intergenic
1054187790 9:61966895-61966917 GGCAGAGGGGTCCAGGGCAGAGG + Intergenic
1054465580 9:65491267-65491289 GGCAGAGGGGTCCAGGGCAGAGG - Intergenic
1054650726 9:67621686-67621708 GGCAGAGGGGTCCAGGGCAGAGG - Intergenic
1056259405 9:84833003-84833025 GTCAGAGGAGCCCACAGCTGAGG + Intronic
1056298148 9:85214142-85214164 GTGAGAGGAAGCCAGAGCAGGGG + Intergenic
1057123451 9:92598248-92598270 CTCAGAGGGACCCATGGCAGTGG - Intronic
1057301411 9:93887213-93887235 GACACAGGAAGCCAGGGCAGAGG + Intergenic
1058391864 9:104504573-104504595 CTCAGTGGAGCCCATGGCAAGGG - Exonic
1058743431 9:107966696-107966718 GACAGAGGAGGGCTGGGCAGAGG + Intergenic
1058765774 9:108181462-108181484 GTCAGAGGAGGCGATTAAAGAGG + Intergenic
1060197394 9:121632535-121632557 GGCAGAGGAGGTGAGGGCAGGGG - Intronic
1061048477 9:128180333-128180355 GGCAGGGGTGGCAATGGCAGAGG - Intronic
1061060113 9:128246033-128246055 GTCAGAGGCGGCCAGGCCGGGGG + Intronic
1061481301 9:130898859-130898881 GGCAGAGGAGGGAAGGGCAGAGG - Intergenic
1061632616 9:131882732-131882754 GTCAGAGGAAGCCTTTGTAGGGG - Intronic
1061659043 9:132116068-132116090 GGCTGAGGAGGCCATGGGATAGG - Intergenic
1061780422 9:132992846-132992868 TTCAGAGGTGTCCATGGCTGTGG - Intergenic
1061992929 9:134170027-134170049 GTGAGAGGTGGGCAGGGCAGGGG - Intergenic
1062004667 9:134233203-134233225 GTGAGAGGCGGCCGTGGCCGTGG - Intergenic
1062066723 9:134532162-134532184 GCCAGCCGAGGCCGTGGCAGAGG + Intergenic
1062319554 9:135984119-135984141 CTCAGAGGAGGACAGGGGAGGGG + Intergenic
1062462292 9:136666978-136667000 GAGAGAGGAGGGCAGGGCAGAGG - Intronic
1185869152 X:3649623-3649645 GTTAGAGGAGGCGAGGGGAGGGG + Intronic
1186387323 X:9122950-9122972 GTCAGAGAAGACCATGGGGGAGG - Intronic
1188247800 X:27855684-27855706 ATCAGAGGAGGGTATGGGAGTGG + Intergenic
1188765753 X:34088939-34088961 GTCAGAGGGGACCAGGGCATTGG + Intergenic
1190073175 X:47295464-47295486 CTCTGAGGAGGCCATAGCAGTGG - Intergenic
1192190257 X:68986926-68986948 CACAGAGGAGGCCACTGCAGTGG - Intergenic
1192348413 X:70332800-70332822 GTCATAGGAGGGAATGGGAGAGG + Intronic
1192363245 X:70452307-70452329 GGCTGAGGAGGCGAGGGCAGCGG + Intronic
1192370423 X:70508347-70508369 GTGGGAGGAGCCCATGGAAGGGG - Intergenic
1192914238 X:75636373-75636395 GTCAGATGAGTCCATAGCAAAGG + Intergenic
1194629529 X:96266321-96266343 TTCAGATGAGGTCATGACAGTGG - Intergenic
1195023796 X:100855504-100855526 GGCAGAGGCGGCTTTGGCAGTGG - Intronic
1195853385 X:109306842-109306864 GTCATAGGGGGCCAGGGCATTGG - Intergenic
1195934594 X:110112835-110112857 TTCAAAGGAGGCCATTACAGTGG - Intronic
1196818783 X:119686377-119686399 GTCAGAGAGGGCCATGGCAGGGG + Intronic
1198312094 X:135433896-135433918 GACAGAGCTGGCCCTGGCAGTGG + Intergenic
1198806348 X:140499263-140499285 GTAGAAGAAGGCCATGGCAGAGG + Intergenic
1200033081 X:153312050-153312072 GTCAGAGGAGCCCTCGGGAGGGG - Intergenic
1200088779 X:153624769-153624791 GGAAGGGAAGGCCATGGCAGAGG + Intergenic
1200100154 X:153686144-153686166 ATCAGAGGAGGCCGAGGCAGAGG - Intronic
1200111166 X:153741624-153741646 GACACAGGTGGCAATGGCAGTGG + Intronic
1200116014 X:153770023-153770045 GGCAGCAGAGGCCATGGGAGAGG - Intronic
1200135650 X:153873367-153873389 AGGAGAGGAGGCCCTGGCAGTGG + Intronic
1200141140 X:153903700-153903722 GGAAGAGGAGGCCTTGGCCGCGG + Intronic
1200918319 Y:8590891-8590913 GGCAGAGGAGACCTTGGTAGAGG + Intergenic