ID: 1166499813

View in Genome Browser
Species Human (GRCh38)
Location 19:43332373-43332395
Sequence TGCTAAACAGCAGTCAGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 2, 1: 0, 2: 0, 3: 16, 4: 220}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166499813_1166499819 0 Left 1166499813 19:43332373-43332395 CCTCCTCTGACTGCTGTTTAGCA 0: 2
1: 0
2: 0
3: 16
4: 220
Right 1166499819 19:43332396-43332418 AAGCTCTCAGGTGGGGCTGATGG No data
1166499813_1166499822 13 Left 1166499813 19:43332373-43332395 CCTCCTCTGACTGCTGTTTAGCA 0: 2
1: 0
2: 0
3: 16
4: 220
Right 1166499822 19:43332409-43332431 GGGCTGATGGCGCTGTCCTGGGG 0: 2
1: 0
2: 2
3: 9
4: 222
1166499813_1166499823 16 Left 1166499813 19:43332373-43332395 CCTCCTCTGACTGCTGTTTAGCA 0: 2
1: 0
2: 0
3: 16
4: 220
Right 1166499823 19:43332412-43332434 CTGATGGCGCTGTCCTGGGGAGG 0: 2
1: 0
2: 1
3: 16
4: 171
1166499813_1166499820 11 Left 1166499813 19:43332373-43332395 CCTCCTCTGACTGCTGTTTAGCA 0: 2
1: 0
2: 0
3: 16
4: 220
Right 1166499820 19:43332407-43332429 TGGGGCTGATGGCGCTGTCCTGG No data
1166499813_1166499818 -7 Left 1166499813 19:43332373-43332395 CCTCCTCTGACTGCTGTTTAGCA 0: 2
1: 0
2: 0
3: 16
4: 220
Right 1166499818 19:43332389-43332411 TTTAGCAAAGCTCTCAGGTGGGG No data
1166499813_1166499821 12 Left 1166499813 19:43332373-43332395 CCTCCTCTGACTGCTGTTTAGCA 0: 2
1: 0
2: 0
3: 16
4: 220
Right 1166499821 19:43332408-43332430 GGGGCTGATGGCGCTGTCCTGGG No data
1166499813_1166499817 -8 Left 1166499813 19:43332373-43332395 CCTCCTCTGACTGCTGTTTAGCA 0: 2
1: 0
2: 0
3: 16
4: 220
Right 1166499817 19:43332388-43332410 GTTTAGCAAAGCTCTCAGGTGGG No data
1166499813_1166499816 -9 Left 1166499813 19:43332373-43332395 CCTCCTCTGACTGCTGTTTAGCA 0: 2
1: 0
2: 0
3: 16
4: 220
Right 1166499816 19:43332387-43332409 TGTTTAGCAAAGCTCTCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166499813 Original CRISPR TGCTAAACAGCAGTCAGAGG AGG (reversed) Intergenic
900300294 1:1973652-1973674 TGCAAAGGAGCAGCCAGAGGTGG + Intronic
901076810 1:6560365-6560387 TGCTCCACAGCAATCAGAGGAGG + Intronic
901078458 1:6570180-6570202 TGCTCCACAGCAATCAGAGGAGG + Intronic
904224738 1:29006785-29006807 AGCTACTCAGGAGTCAGAGGTGG + Intronic
904617635 1:31758502-31758524 GTCTAAACAGCAGGCAGAGGGGG + Intronic
905142458 1:35858886-35858908 TGCTACTCAGCAGGCTGAGGTGG - Intergenic
906735039 1:48117242-48117264 TGACAATAAGCAGTCAGAGGAGG + Intergenic
907124551 1:52038038-52038060 TGCTACTCAGGAGTCTGAGGTGG - Intronic
907802520 1:57784279-57784301 AGCTACACAGGAGTCTGAGGTGG + Intronic
908256218 1:62305627-62305649 TGTTAAACAGCACTGAAAGGAGG + Intronic
908536606 1:65084246-65084268 TGCTAAACCACAGCCAGGGGAGG + Intergenic
908855442 1:68421591-68421613 GGCTAAAGAGGAGTTAGAGGAGG - Intergenic
909170329 1:72285226-72285248 TGGGAAACAGCAGTCAGAAAAGG - Intergenic
910925815 1:92397275-92397297 AGCTACTCAGGAGTCAGAGGTGG + Exonic
916747040 1:167692606-167692628 TGCTACACAGGAGGCTGAGGTGG - Intronic
920268993 1:204749069-204749091 TCCTAAGCAGCACCCAGAGGTGG - Intergenic
922208717 1:223470761-223470783 AGCTAAGCAGCAGTGGGAGGTGG + Intergenic
923905133 1:238376214-238376236 GGCTGAAAAGCAGGCAGAGGAGG + Intergenic
924000981 1:239551560-239551582 AGCTATACATCACTCAGAGGAGG + Intronic
1063127201 10:3145830-3145852 TGTTAAACAGCAGCCAAATGTGG + Intronic
1064083738 10:12329232-12329254 AGCTAATCAGGAGGCAGAGGCGG - Intergenic
1065030297 10:21579292-21579314 TGCTAAACAGCAAACACAGAGGG - Intronic
1065320860 10:24508444-24508466 TGTTAAACAGATGTCAGAGTAGG - Intronic
1065891690 10:30126718-30126740 TGCTTCTCAGGAGTCAGAGGTGG - Intergenic
1066240243 10:33526696-33526718 AGCTACTCAGGAGTCAGAGGTGG + Intergenic
1066353672 10:34661762-34661784 GGCAAAACAGCTGTCAAAGGAGG + Intronic
1067483626 10:46624170-46624192 TGCTCAACAAAAGCCAGAGGGGG - Intergenic
1067611130 10:47717473-47717495 TGCTCAACAAAAGCCAGAGGGGG + Intergenic
1067905468 10:50286641-50286663 TGCTAAAAAGAGGTCAGAGCAGG - Intergenic
1069940055 10:71949129-71949151 TGCTCCACCACAGTCAGAGGAGG + Intergenic
1069941990 10:71962872-71962894 TGCTCCACCACAGTCAGAGGAGG + Intergenic
1071483428 10:86081438-86081460 TGCTCAACATCAGACAGAAGAGG + Intronic
1071626548 10:87177710-87177732 TGCTCAACAAAAGCCAGAGGGGG + Intronic
1076014455 10:127016139-127016161 AGCTAAACACCTGTCAGGGGAGG + Intronic
1076246527 10:128951188-128951210 GGCTCACCACCAGTCAGAGGAGG + Intergenic
1077887576 11:6397011-6397033 TGTTTAACAGCAGTTTGAGGTGG - Intronic
1080409089 11:32006331-32006353 CTCTAACCAGCAGTCAGAGAGGG + Intronic
1080694792 11:34593948-34593970 TTCCAAACAGCAGGCAGAGCAGG - Intergenic
1083635950 11:64121089-64121111 TGCTAGAGAGCAGGCAGAGCTGG + Intronic
1083877063 11:65529826-65529848 AGCTAAGAAGCGGTCAGAGGAGG - Intronic
1088908399 11:114171912-114171934 TGCTCTTCAGCAGGCAGAGGCGG - Intronic
1091755049 12:3045842-3045864 TGAGAAACAGCAGGGAGAGGTGG + Intergenic
1093709277 12:22311337-22311359 TGCAAGACAGCAGGTAGAGGGGG + Intronic
1093886298 12:24465532-24465554 TGAGAAACTGAAGTCAGAGGGGG + Intergenic
1095288575 12:40447546-40447568 TGCTGAACAACTGTCAGATGGGG + Intronic
1095344477 12:41133414-41133436 AGCTACACAGGAGTCTGAGGTGG + Intergenic
1098270168 12:68762339-68762361 TGAGAAGGAGCAGTCAGAGGTGG + Intronic
1099017709 12:77364597-77364619 TGCTAAGCAGCTGTCAGATAGGG + Intergenic
1099633455 12:85180148-85180170 TGCTAAATAGATCTCAGAGGTGG - Intronic
1100064403 12:90624034-90624056 TGCAAAACAGCAGTCTCAAGGGG + Intergenic
1102881889 12:116491809-116491831 TTCTAAACATCAGTGAGATGAGG - Intergenic
1103438575 12:120946050-120946072 TGCTAAACAACAGACATTGGTGG - Intergenic
1104752490 12:131248506-131248528 TGCTAAACATCAGTCAGGCAGGG + Intergenic
1106372016 13:29144048-29144070 TGCTAAACAGCAGGGTGAGTAGG + Intronic
1108459164 13:50647770-50647792 TGCTAACCAGGAGCCAGGGGAGG - Intronic
1111404102 13:87779479-87779501 TGCTGAACAGCCATCAGAGTGGG - Intergenic
1111833631 13:93360324-93360346 TGGGAGACAGGAGTCAGAGGTGG + Intronic
1113632028 13:111894309-111894331 TGCACAAAAGCAGCCAGAGGCGG + Intergenic
1114317208 14:21520339-21520361 AGCTAATCAGGAGTCTGAGGTGG - Intergenic
1114774202 14:25462138-25462160 TGCTCTACCACAGTCAGAGGAGG - Intergenic
1115775273 14:36708012-36708034 AGCTACTCAGCAGTCTGAGGTGG + Intronic
1119540477 14:75435008-75435030 TGGTAAGCAGCAGTCAGGGCTGG - Intronic
1120373992 14:83676835-83676857 TGGTAAACAGCAGTCACAGTTGG - Intergenic
1122438513 14:101714541-101714563 TGGCAGACAGCAGACAGAGGAGG + Intergenic
1122703763 14:103607623-103607645 TCGTAAGCAGCAGTCAGAGCAGG - Intronic
1122997826 14:105275135-105275157 TGATGACCAGCAGCCAGAGGTGG + Intronic
1123879653 15:24665273-24665295 TGCTCACCAGCAGTCCAAGGAGG - Intergenic
1124268080 15:28255220-28255242 TGCAAAACAGGAGGCTGAGGTGG + Intronic
1124374408 15:29121247-29121269 TGCTGAGCAGCAGGCTGAGGGGG + Exonic
1124379835 15:29156025-29156047 TGGCAAACAGCAGGCACAGGTGG + Intronic
1125818857 15:42610444-42610466 TGCTACACAGGAGTCAGTAGGGG - Intronic
1126812587 15:52422827-52422849 AGCTACTCAGGAGTCAGAGGTGG - Intronic
1127129401 15:55846310-55846332 TCCTAAACTGCAGGCAAAGGAGG + Intronic
1127774683 15:62255574-62255596 TGCTAACCAGCAGTTACAGCAGG - Intergenic
1128383816 15:67133004-67133026 TGCAAAACATGGGTCAGAGGAGG - Intronic
1128940700 15:71785401-71785423 AGCTACTCAGCAGGCAGAGGTGG + Intergenic
1128958986 15:71980297-71980319 TGCCAAACAGCATTCTGATGTGG + Intronic
1129681837 15:77662525-77662547 TGCTAAAGAGGAGTTAGAGGGGG - Intronic
1130733113 15:86519891-86519913 TGTTAAACAGCACACAAAGGAGG - Intronic
1131282941 15:91035228-91035250 TGCTAACCAGCAGTTACAGCAGG - Intergenic
1131616538 15:94022280-94022302 TGCTGAAGAGCAGTGAGAGGAGG + Intergenic
1133601920 16:7348044-7348066 TGTTAAACAGAAGTCAAAGGAGG - Intronic
1135506188 16:23038491-23038513 TCTTCAACAGCATTCAGAGGAGG - Intergenic
1138229267 16:55325419-55325441 TCCTATACAGAAGTCTGAGGTGG + Intronic
1138649310 16:58449923-58449945 TGGTAAATAGGAGGCAGAGGAGG - Intergenic
1138694706 16:58802077-58802099 TATTAAAAAGCAGTTAGAGGGGG - Intergenic
1139346125 16:66305065-66305087 TGCTAACGAGCAGGCAGAGCTGG + Intergenic
1147158199 17:38555864-38555886 TCCCAAACATCACTCAGAGGGGG + Intronic
1150505423 17:65693633-65693655 TGCTAAGCACAAGTCAGAAGCGG + Intronic
1153560586 18:6368432-6368454 TGATAAACAGTAGTCACAGCAGG + Intronic
1154460374 18:14578196-14578218 ACCTAAACTGCAGTCTGAGGAGG - Intergenic
1155423241 18:25678554-25678576 TCCTAGACAGCGGTCAGAAGTGG - Intergenic
1157098573 18:44709602-44709624 TGCCAAACAGCAATGAGAGCAGG - Intronic
1157340378 18:46772629-46772651 CTCTTAACAGTAGTCAGAGGTGG + Intergenic
1157570711 18:48710280-48710302 TGCTGGAGAGCAGTCAGAGGGGG - Intronic
1159969191 18:74627985-74628007 AGCTACACAGGAGTCTGAGGTGG - Intronic
1160130151 18:76218285-76218307 TGCTAAACAGCTGTGAGTGTGGG - Intergenic
1162753958 19:12846087-12846109 AGCTACACAGAAGGCAGAGGGGG + Intronic
1164161362 19:22627479-22627501 TGCTAAACACCAGGAAGAAGAGG + Intergenic
1165442314 19:35836368-35836390 AGCTAATCAGGAGTCTGAGGCGG - Intronic
1166267864 19:41696132-41696154 TGCTAAACAGCAGTCAGAGGAGG + Intronic
1166394793 19:42431279-42431301 TGCTACAGACCAGTGAGAGGAGG - Intronic
1166499813 19:43332373-43332395 TGCTAAACAGCAGTCAGAGGAGG - Intergenic
925874051 2:8297044-8297066 TGATAGACAGCAGTCAGGGGTGG - Intergenic
926386210 2:12338144-12338166 TGGGAACCAGCAGTCAGCGGAGG + Intergenic
927039797 2:19217027-19217049 TGCTAAACAGGAGCCTGAGCAGG - Intergenic
928053416 2:28025652-28025674 AGATATTCAGCAGTCAGAGGTGG + Intronic
931358194 2:61555344-61555366 TGCTAATCGGCAGGCTGAGGTGG + Intergenic
931449846 2:62359512-62359534 AGCTACACAGGAGTCTGAGGAGG - Intergenic
935126117 2:100224298-100224320 CCCTACACAGCAGCCAGAGGAGG + Intergenic
936502656 2:113078349-113078371 TGCTAAACAGAAGTCAGGGAGGG - Intergenic
937122215 2:119448782-119448804 TGCAAAACACAAGGCAGAGGTGG + Intronic
938570442 2:132557659-132557681 TGCTCCACCGCAGTCAGAGGAGG + Intronic
940356235 2:152746128-152746150 AGCTACTCAGCAGTCTGAGGTGG - Intronic
941402832 2:165052506-165052528 TGCAAATCAGTAGTGAGAGGAGG - Intergenic
941738592 2:169008410-169008432 TGCTAAGAAGAAGGCAGAGGGGG - Intronic
941807155 2:169721042-169721064 AGCTACACAGCAGGCTGAGGTGG - Intronic
1168898570 20:1340930-1340952 TGCCAGCCAGCAGGCAGAGGGGG - Intronic
1170877381 20:20263008-20263030 TTCCCAACAGCAGTCAGCGGCGG + Exonic
1173017205 20:39236568-39236590 TGCTGAAGAGGAGGCAGAGGAGG - Intergenic
1173346067 20:42201183-42201205 TGCTACTCAGCAGGCTGAGGTGG + Intronic
1173949827 20:46982357-46982379 ATCTTAAAAGCAGTCAGAGGGGG - Intronic
1174912840 20:54625181-54625203 TGCCAAACATCTGTCAGAGCTGG + Intronic
1175709929 20:61211340-61211362 TGCTAAAGAGGAGTCAGAGACGG + Intergenic
1176813731 21:13574639-13574661 ACCTAAACTGCAGTCTGAGGAGG + Intergenic
1177812573 21:25940165-25940187 AACTAAACAGGAGTCAGAGAAGG + Intronic
1178187864 21:30244065-30244087 TGCTCCACCACAGTCAGAGGAGG - Intergenic
1178997723 21:37420467-37420489 TGATAAATAGCAGTTAGTGGGGG + Intronic
1182469210 22:30537181-30537203 TGCTAAACAAAAATCATAGGAGG + Intronic
1184646494 22:45898056-45898078 GGCTACACACCAGGCAGAGGAGG + Intergenic
949934889 3:9108918-9108940 TGGAAAACAGCAGAAAGAGGAGG + Intronic
950064381 3:10100073-10100095 TGCTACACAGGAGGCTGAGGTGG + Intronic
951127584 3:19001943-19001965 AGAGAAACAGCAGTCAGAGCAGG - Intergenic
952009416 3:28883302-28883324 TGAGAAACAGCAGACACAGGAGG - Intergenic
952293499 3:32040722-32040744 AGCTAAACAGGAGGCTGAGGTGG + Intronic
952999351 3:38917920-38917942 TGCTTAACAGCAGTCAAACTTGG - Intronic
953774957 3:45808698-45808720 TGGGAAAGAGCAGGCAGAGGTGG - Intergenic
954264148 3:49460228-49460250 TGGTCCACAGGAGTCAGAGGGGG + Intergenic
955065524 3:55530829-55530851 TTACAAGCAGCAGTCAGAGGTGG + Intronic
958510078 3:95036981-95037003 TACTACACAGCAGACACAGGTGG - Intergenic
962556656 3:136559469-136559491 TGAGAAACTGCAGTCAGAGTAGG + Intronic
962718151 3:138146197-138146219 TTTTAAAAAGCAGTTAGAGGTGG + Intergenic
963101182 3:141606006-141606028 TGCTAAGCAGCAGTCAACAGAGG - Intronic
964426060 3:156555050-156555072 CTCCAAACAGCAGTCTGAGGAGG - Exonic
965121068 3:164558316-164558338 TGCTAAAGATCAGTCACAAGAGG + Intergenic
965913831 3:173816387-173816409 GGCTAAATAGCATTCAGTGGTGG + Intronic
966914639 3:184578037-184578059 TGCTAAAGGGCAGTTCGAGGCGG - Intronic
967194696 3:187016298-187016320 TGCTAAAAAGGAGACAGAGAAGG + Intronic
969091576 4:4697939-4697961 TGCTAATCAGGAGGCTGAGGTGG - Intergenic
972396051 4:38660774-38660796 TGCTTAAAAGCACTCAGGGGGGG + Intergenic
973618693 4:52706141-52706163 TGCTGAAAAACAGGCAGAGGTGG - Intergenic
974272527 4:59669579-59669601 TGCAAAACAGCAGTGATAAGTGG + Intergenic
986963345 5:13241691-13241713 AGTTAAACAGCAGTCAGATGTGG + Intergenic
988057325 5:26115233-26115255 TGCTACTCAGGAGTCAGAGGTGG - Intergenic
988144752 5:27291704-27291726 TGCTCCACCACAGTCAGAGGAGG + Intergenic
990515437 5:56527245-56527267 TGCCAAGGAGCAGCCAGAGGTGG - Intronic
991478758 5:67053519-67053541 AGCAATACAGTAGTCAGAGGAGG - Intronic
992138568 5:73772489-73772511 AGCTAATCAGCAGGCTGAGGTGG - Intronic
992258685 5:74948369-74948391 TGCTAAGCAGCAGGCAGAACAGG + Intergenic
992481441 5:77156135-77156157 TGATTAACAGCAGAGAGAGGTGG + Intergenic
993099582 5:83520886-83520908 TACTCAAAAGCAGTTAGAGGAGG + Exonic
994570236 5:101505915-101505937 TCCTCAAGAGCAGTCAGAGTGGG - Intergenic
997480343 5:134179779-134179801 TGCTATAAAGCATTCACAGGAGG + Intronic
997691395 5:135829815-135829837 AGCCACACAGCAGTCAGTGGAGG - Intergenic
998038481 5:138936125-138936147 TGCTACACAGCAGTAACAGCAGG - Intergenic
998127113 5:139632018-139632040 TCCTGTACAGCAGTCACAGGAGG - Intergenic
998161705 5:139816698-139816720 TGAGAAGCAGCAGCCAGAGGTGG - Intronic
999728783 5:154459675-154459697 TGCTAAACCTCAGACAGATGAGG + Exonic
999788147 5:154910996-154911018 TGTTAAACATAAGTAAGAGGAGG - Intronic
1000833157 5:166128129-166128151 TGCTCCACAGTAGACAGAGGAGG + Intergenic
1001011871 5:168106138-168106160 TGCTGAACAGCTGTCACTGGAGG + Intronic
1001677698 5:173532145-173532167 TTCTAAGCAGCAGGCATAGGAGG - Intergenic
1002063737 5:176641922-176641944 TGCTCAACAGAAGTCAGCTGAGG - Intronic
1005093186 6:22080803-22080825 TGTGAAACAGGACTCAGAGGTGG + Intergenic
1005632536 6:27722015-27722037 TGCTAAACGGCACTCAGTGAAGG + Intergenic
1005923910 6:30424385-30424407 TGCAAAACAGCAGCCAGAGCAGG - Intergenic
1006743304 6:36324298-36324320 GGCTAAAGAGCTGCCAGAGGTGG + Intronic
1007073562 6:39053130-39053152 AGCAAAGCAGCGGTCAGAGGGGG - Intronic
1011396395 6:86913732-86913754 TGCTCACCAGCAGTCAGGGATGG + Intergenic
1012928931 6:105296806-105296828 TGCAAAACAGAAGGAAGAGGAGG - Intronic
1014699233 6:124662980-124663002 AGCTACTCAGCAGTCAGAAGTGG + Intronic
1014905626 6:127023585-127023607 TGGTAACCAGCTGTCAGTGGTGG + Intergenic
1018203463 6:161415719-161415741 TCCCAGACAGCAGTCAGAGCAGG + Intronic
1018432971 6:163737382-163737404 TGAAAAACAGCAGCAAGAGGGGG - Intergenic
1019045782 6:169144572-169144594 TGCTATTCACCAGGCAGAGGAGG + Intergenic
1019436815 7:1026480-1026502 CGCTAACTAGCAGTCGGAGGCGG + Intronic
1020788353 7:12595181-12595203 TGCTCCACCACAGTCAGAGGAGG + Intronic
1021215989 7:17915541-17915563 TGCTCCACCACAGTCAGAGGAGG - Intronic
1021561783 7:21975077-21975099 AGCTATAAAGCAGGCAGAGGAGG + Intergenic
1022488425 7:30798385-30798407 TGCTGAACAACTGTAAGAGGGGG + Intronic
1022690315 7:32644448-32644470 AGAAAAGCAGCAGTCAGAGGTGG - Intergenic
1023352243 7:39332323-39332345 TGCTATACAGCTGTCACAGTGGG + Intronic
1023377777 7:39575988-39576010 ATCTAAGCAGCAGTCAGAGTCGG - Intronic
1023575327 7:41620756-41620778 TGCTATTCAGGAGGCAGAGGTGG + Intergenic
1023619623 7:42056387-42056409 AGCTAAAAAGCATTCACAGGAGG + Intronic
1023956516 7:44891030-44891052 TGCCAAAAAGCAGTCAAAGCAGG - Intergenic
1026164679 7:67899501-67899523 AGCTAATCAGGAGTCTGAGGTGG - Intergenic
1029073198 7:97916662-97916684 TCCCAAGCAGCATTCAGAGGTGG + Intergenic
1030080449 7:105773585-105773607 GGCTAAACAGGAGACACAGGGGG + Intronic
1031449275 7:121894516-121894538 AGCTAAACAGGAGGCTGAGGTGG - Intronic
1032450472 7:132026099-132026121 TGCAAACCAGCAGCCAGAGCGGG + Intergenic
1034636681 7:152572823-152572845 TGCTAATCAGGAGGCTGAGGTGG + Intergenic
1034917763 7:155055240-155055262 AGCTACTCAGCAGGCAGAGGTGG - Intergenic
1035439577 7:158885125-158885147 TGATAAACAGTGGGCAGAGGGGG - Intronic
1035988506 8:4461661-4461683 AGCTATACAGCAGGCTGAGGTGG - Intronic
1036150782 8:6296216-6296238 AGCTAAACAGGAGGCTGAGGTGG + Intergenic
1036405735 8:8453746-8453768 TACTTAACATCAGTGAGAGGGGG - Intergenic
1037979753 8:23243641-23243663 TGCTGCATAACAGTCAGAGGAGG - Exonic
1042487131 8:69358608-69358630 TGCTACTCAGGAGTCTGAGGTGG - Intergenic
1043887412 8:85617838-85617860 TGCTACTCAGAAGTCTGAGGTGG - Intergenic
1043982695 8:86659329-86659351 TGCTAACCAGCAGTTACAGCAGG - Intronic
1047446113 8:124921271-124921293 TGCTCCACTACAGTCAGAGGAGG + Intergenic
1048140521 8:131789937-131789959 TCCTAAACAGCAGGCTCAGGTGG + Intergenic
1048457144 8:134588466-134588488 TGCTAAGCAGCACCCACAGGAGG + Intronic
1049095088 8:140544002-140544024 TTCTAAGAAGCAGTCAGAGGTGG - Intronic
1050211640 9:3265141-3265163 TGGTAGCCAGCAGCCAGAGGAGG + Intronic
1050436370 9:5614772-5614794 TGTTAAAAAGCAGTGAGGGGTGG - Intergenic
1051592878 9:18794294-18794316 AGCTACACAGGAGGCAGAGGTGG + Intronic
1051618814 9:19031811-19031833 TTCTAATCAGCAGCCAGAGTTGG + Intronic
1056210522 9:84360801-84360823 TGCTAATCAGGAGGCTGAGGTGG + Intergenic
1058080565 9:100696860-100696882 TGCAAAACAGTAGGCAGTGGTGG + Intergenic
1061063314 9:128261709-128261731 TGCTAACCAGCAGTTACAGCAGG - Exonic
1185849466 X:3471897-3471919 TGCTCAACAGCAGAGAGAGAGGG - Intergenic
1187486715 X:19711136-19711158 TGCTTAAGAACAGTCAGATGTGG - Intronic
1188256511 X:27967558-27967580 TGCAAAGCAGGAGCCAGAGGAGG - Intergenic
1190554178 X:51617105-51617127 AGCTAAACATCCATCAGAGGAGG + Intergenic
1192049430 X:67710431-67710453 TGCTACTCAGGAGGCAGAGGTGG - Intronic
1192099293 X:68246905-68246927 TGCAAAAAACCAGTAAGAGGTGG + Intronic
1194509513 X:94775959-94775981 TGCTACTCAGGAGGCAGAGGTGG - Intergenic
1195067053 X:101247215-101247237 TGAGAAACAGCAGACAGATGAGG - Intronic
1195684821 X:107576023-107576045 AGCTACACAGCAGTCACATGAGG + Intronic
1196440461 X:115715198-115715220 TGCTACTCAGCAGGCTGAGGTGG - Intergenic
1196868937 X:120094949-120094971 AGCTACACAGCAGGCTGAGGTGG + Intergenic
1197522711 X:127519861-127519883 TACTAAAAAGCAGTCAGGGCCGG + Intergenic
1197751623 X:129967945-129967967 AGCTACTCAGCAGGCAGAGGTGG - Intergenic
1199488362 X:148372439-148372461 TGCACTAGAGCAGTCAGAGGTGG + Intergenic
1199810830 X:151346972-151346994 TGCTAAGTACCATTCAGAGGAGG + Intergenic
1200217102 X:154372798-154372820 TGCTAAAGACCAGTGAGAGATGG + Intronic