ID: 1166499814

View in Genome Browser
Species Human (GRCh38)
Location 19:43332376-43332398
Sequence CTTTGCTAAACAGCAGTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 2, 1: 0, 2: 0, 3: 22, 4: 165}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166499814_1166499820 8 Left 1166499814 19:43332376-43332398 CCTCTGACTGCTGTTTAGCAAAG 0: 2
1: 0
2: 0
3: 22
4: 165
Right 1166499820 19:43332407-43332429 TGGGGCTGATGGCGCTGTCCTGG No data
1166499814_1166499825 30 Left 1166499814 19:43332376-43332398 CCTCTGACTGCTGTTTAGCAAAG 0: 2
1: 0
2: 0
3: 22
4: 165
Right 1166499825 19:43332429-43332451 GGGAGGCCCTTTCAGTAGCAAGG 0: 2
1: 0
2: 0
3: 8
4: 113
1166499814_1166499823 13 Left 1166499814 19:43332376-43332398 CCTCTGACTGCTGTTTAGCAAAG 0: 2
1: 0
2: 0
3: 22
4: 165
Right 1166499823 19:43332412-43332434 CTGATGGCGCTGTCCTGGGGAGG 0: 2
1: 0
2: 1
3: 16
4: 171
1166499814_1166499819 -3 Left 1166499814 19:43332376-43332398 CCTCTGACTGCTGTTTAGCAAAG 0: 2
1: 0
2: 0
3: 22
4: 165
Right 1166499819 19:43332396-43332418 AAGCTCTCAGGTGGGGCTGATGG No data
1166499814_1166499818 -10 Left 1166499814 19:43332376-43332398 CCTCTGACTGCTGTTTAGCAAAG 0: 2
1: 0
2: 0
3: 22
4: 165
Right 1166499818 19:43332389-43332411 TTTAGCAAAGCTCTCAGGTGGGG No data
1166499814_1166499822 10 Left 1166499814 19:43332376-43332398 CCTCTGACTGCTGTTTAGCAAAG 0: 2
1: 0
2: 0
3: 22
4: 165
Right 1166499822 19:43332409-43332431 GGGCTGATGGCGCTGTCCTGGGG 0: 2
1: 0
2: 2
3: 9
4: 222
1166499814_1166499821 9 Left 1166499814 19:43332376-43332398 CCTCTGACTGCTGTTTAGCAAAG 0: 2
1: 0
2: 0
3: 22
4: 165
Right 1166499821 19:43332408-43332430 GGGGCTGATGGCGCTGTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166499814 Original CRISPR CTTTGCTAAACAGCAGTCAG AGG (reversed) Intergenic
900629709 1:3627872-3627894 CTATGCTAACCAGCAGCCACTGG - Intronic
900687343 1:3957162-3957184 CTGGGCCCAACAGCAGTCAGCGG - Intergenic
901457758 1:9373164-9373186 CTTTGCTGAACAGAAATCACTGG - Intergenic
901482246 1:9533319-9533341 GTTTGCCAACAAGCAGTCAGAGG + Intergenic
901756596 1:11444987-11445009 CAATGCTAACCACCAGTCAGGGG + Intergenic
902824839 1:18965801-18965823 ATTTGTAAACCAGCAGTCAGAGG - Intergenic
903995024 1:27300279-27300301 CTGTGCCAAGCAGCAGTAAGAGG - Intronic
905029194 1:34870222-34870244 CTTTTCTATAAAGAAGTCAGTGG + Intronic
905036435 1:34921258-34921280 CTTTCCCAAAAAGCAGCCAGAGG - Intronic
905905396 1:41614763-41614785 ATTTAGTATACAGCAGTCAGAGG + Intronic
906996850 1:50805341-50805363 TTTTGCTAAACAGAATTTAGGGG - Intronic
910554044 1:88510188-88510210 CCTTGATCACCAGCAGTCAGAGG - Intergenic
911559586 1:99388406-99388428 CATAGCTAAAGAGAAGTCAGTGG + Intergenic
913588999 1:120304698-120304720 CTTTGCAAAACACCAGTGACTGG + Intergenic
913619186 1:120593671-120593693 CTTTGCAAAACACCAGTGACTGG - Intergenic
914335622 1:146712538-146712560 CCTTTAGAAACAGCAGTCAGGGG + Intergenic
914571022 1:148916581-148916603 CTTTGCAAAACACCAGTGACTGG + Intronic
914601810 1:149213690-149213712 CTTTGCAAAACACCAGTGACTGG - Intergenic
914889211 1:151607871-151607893 CTCTGCTTAAAAGCAATCAGAGG + Intergenic
915216773 1:154345739-154345761 CTTTGCTACACATCAGGCACAGG - Intronic
921166395 1:212510838-212510860 CTTTGACAAACAGAATTCAGTGG - Intergenic
921327605 1:214002225-214002247 CTTACCTAAACAGCAGCCACGGG - Intronic
922162801 1:223090733-223090755 CTTTTCCACACAGCAGCCAGAGG - Intergenic
923684406 1:236143603-236143625 GATTGCTAAACAGCAGGCTGGGG + Intronic
923940059 1:238812335-238812357 CATTGCTAAACAGAAGTAACAGG - Intergenic
1065042112 10:21707645-21707667 CTTTGCTACATAAGAGTCAGAGG + Intronic
1072260600 10:93667458-93667480 CTTTGCTATAGTGCGGTCAGTGG - Intergenic
1074413788 10:113249636-113249658 CTTTCCTACCCAGCAGCCAGAGG - Intergenic
1074542584 10:114377583-114377605 CTTGGCAAAATAGCAGTCAATGG + Intronic
1075316631 10:121458566-121458588 CTTTGCTAATCTGCAGCCTGTGG - Intergenic
1076398568 10:130160951-130160973 CTTTCATAAACAGCATGCAGGGG - Exonic
1076539014 10:131202006-131202028 CTTTCCTAAGGAGCAGTCATCGG - Intronic
1077466526 11:2736207-2736229 CTTTCCTAACCAGCAGTCCAGGG + Intronic
1078187752 11:9066614-9066636 CTGTGCTAAACACCATTAAGGGG + Intronic
1078712563 11:13808874-13808896 CTTTGCAAAACACAACTCAGAGG - Intergenic
1078963897 11:16314088-16314110 TTGTGCTAAAAAACAGTCAGTGG + Intronic
1079397709 11:20079827-20079849 CTTTACAAAACAGAAGTCAAGGG - Intronic
1080250713 11:30229955-30229977 ATTAGCAACACAGCAGTCAGAGG + Intergenic
1080691953 11:34565737-34565759 GTTTCCTAAACTGTAGTCAGGGG - Intergenic
1082091322 11:48091982-48092004 CATTTCTAAACAGCACCCAGGGG - Intronic
1084283876 11:68119242-68119264 CTTAGCTCATAAGCAGTCAGAGG + Intronic
1085758237 11:79219347-79219369 CTCTGCTCAACAGCACTCAGAGG - Intronic
1087114198 11:94506702-94506724 CTTAGCTACACAGGAGGCAGTGG - Intergenic
1088696506 11:112370707-112370729 CTCTTCCAAACAGCAGCCAGAGG - Intergenic
1089618417 11:119708427-119708449 CTTTGCTTAAAAGGCGTCAGTGG - Intronic
1091110454 11:132961699-132961721 CTTTGCAAATCATCAGTCAAAGG - Intronic
1092205271 12:6610988-6611010 CTTTACTAACCAGTAGTGAGTGG + Intergenic
1092678219 12:10945936-10945958 CCTAGCTAACCAGCAGTCAGAGG + Intronic
1092989410 12:13880524-13880546 ATTTCCTAAACAGCTCTCAGAGG - Intronic
1094142765 12:27198099-27198121 CCTAGCTCAACAGCAGCCAGGGG + Intergenic
1095436739 12:42197174-42197196 ACTTGCTAAACAGCAGGCTGGGG - Intronic
1096280440 12:50247951-50247973 ATTTACTAATCAGCAGCCAGTGG + Intronic
1096909363 12:54966656-54966678 CTTGCCTAAACATCAGTCATGGG - Intronic
1098861602 12:75716926-75716948 CGTTGCTACTCAGCAGGCAGGGG + Intergenic
1098999927 12:77167567-77167589 CTAAGCTAAACATCAGTGAGTGG + Intergenic
1099605751 12:84799298-84799320 CTTTGCTCAACAGAATACAGCGG - Intergenic
1100687592 12:97003801-97003823 CTGTGCTAGACAGCAGTCCAGGG + Intergenic
1102523481 12:113494090-113494112 CTTTCCTACAAAGCAGTAAGGGG + Intergenic
1108161506 13:47645116-47645138 CTTTGCAAAACAGTAGTCTCAGG - Intergenic
1109597956 13:64581349-64581371 CATTGCTAAACAGTAGTGACTGG + Intergenic
1114340240 14:21735737-21735759 CTTGGCTAAATAGGGGTCAGTGG + Intergenic
1115604669 14:34988760-34988782 CTTTTCTATAAAGCAGTCAAAGG - Intronic
1115750977 14:36489415-36489437 CTTGGCTAAACAGAGTTCAGTGG - Intronic
1117978201 14:61319035-61319057 CTCTGCTTAACAGCCTTCAGAGG + Intronic
1121278006 14:92680801-92680823 CTTTGCTAAACTGCAGCACGTGG - Intronic
1121728547 14:96170523-96170545 CTTTGCTAAACAAATGCCAGGGG - Intergenic
1122562807 14:102628858-102628880 CTTTTCTCTACTGCAGTCAGAGG + Intronic
1124781255 15:32637116-32637138 AATTGCTAAACAGCAGTCATTGG + Exonic
1124955826 15:34359721-34359743 CTTTGCTGAAGAGCAAGCAGAGG - Exonic
1126752544 15:51891803-51891825 CTCTGCTAAACAACAGAGAGTGG - Intronic
1128623233 15:69171036-69171058 CACTGTTAAACAGTAGTCAGAGG - Intronic
1133609594 16:7420674-7420696 CTTTGATAAATAGCAGTAATTGG + Intronic
1135732780 16:24908296-24908318 CTTTGCAAAAAAGCAATGAGAGG + Intronic
1137719239 16:50618294-50618316 CTGGGCTAAACAGGAATCAGAGG + Intronic
1139733867 16:68970688-68970710 CTATGTTAAACAACAGTAAGAGG + Intronic
1139998004 16:70998690-70998712 CCTTTAGAAACAGCAGTCAGGGG - Intronic
1143740233 17:8947351-8947373 CTTTGTGAAATAGCAGTGAGAGG + Intronic
1148771204 17:50067951-50067973 CTTTGCCAAACAGGAGTCAAAGG - Intronic
1150715397 17:67568640-67568662 CTTTACTATTCAGCAGGCAGAGG - Intronic
1150774038 17:68065031-68065053 CTATGCCAACCAGCAGTCATAGG + Intergenic
1155261768 18:24050249-24050271 CTTTGCTAGACACCAGAGAGAGG + Intronic
1155394402 18:25371555-25371577 TTTTGCTATATAGCAGTGAGTGG - Intergenic
1157287030 18:46384041-46384063 TTTTTCTTAACAGCAGACAGAGG + Intronic
1158873790 18:61713521-61713543 TTCTTCTGAACAGCAGTCAGAGG - Intergenic
1159816511 18:73080449-73080471 CTTTGTTGAACAGCAGGCAATGG + Intergenic
1166267863 19:41696129-41696151 CTTTGCTAAACAGCAGTCAGAGG + Intronic
1166499814 19:43332376-43332398 CTTTGCTAAACAGCAGTCAGAGG - Intergenic
1167206889 19:48108577-48108599 CTTTGCTAAAGAACAGTCGTGGG - Intronic
1167886623 19:52505267-52505289 CTTCTCTAAGCAGCAGTCAGTGG + Intronic
1167892046 19:52548119-52548141 CTTCTCTAAGCAGCAGTCAGTGG + Intronic
1167908139 19:52679226-52679248 CTTCTCTAAGCAGCAGTCAGTGG - Intronic
1167912243 19:52713507-52713529 CTTCTCTAAGCAGCAGTCAGTGG - Intronic
925874052 2:8297047-8297069 CTGTGATAGACAGCAGTCAGGGG - Intergenic
927139850 2:20122479-20122501 CTTTGCTACACGGCAGACGGGGG + Intergenic
927884497 2:26710208-26710230 CTTTCCCAAAGAGCAGTCGGGGG - Intronic
930631007 2:53755238-53755260 CATTGCTACACAGGCGTCAGTGG - Intronic
933994419 2:87657278-87657300 GTGTGATAAACAGCAGTCAGTGG - Intergenic
936299439 2:111293635-111293657 GTGTGATAAACAGCAGTCAGTGG + Intergenic
939580768 2:143942747-143942769 CTCTGCTTAACAGGAGCCAGGGG - Exonic
941868932 2:170363361-170363383 CATTGGTAAACAACAGTCAGAGG + Intronic
942507717 2:176661243-176661265 CTTTGTTGTACAGCAGTCATGGG - Intergenic
944997607 2:205311606-205311628 CATTACAAAACAGCAGTTAGAGG - Intronic
946646753 2:221845766-221845788 CTTTGGGAAAAAGCAGTCTGTGG - Intergenic
947019331 2:225657223-225657245 CTCTGCTACACAGGAGTCTGAGG - Intergenic
947329070 2:229009304-229009326 TTTTACTAAGCAGCAGTGAGTGG - Intronic
948201147 2:236130574-236130596 CTTTGGTAAACAGAAGACACTGG + Exonic
1172044153 20:32067769-32067791 CTGTGCTCAACAGCCGTCTGTGG - Intronic
1172625081 20:36342221-36342243 CTTTGCCAAAGAGGAGTCTGAGG - Intronic
1172761110 20:37323031-37323053 GTTCTCAAAACAGCAGTCAGAGG + Intergenic
1174217985 20:48931929-48931951 CTTTTCTCAACAGCAGCCAGAGG - Intronic
1177495385 21:21883473-21883495 CTTTGCTACACAAAATTCAGTGG + Intergenic
1182710163 22:32317576-32317598 CTTAGCTACACAGGAGGCAGGGG - Intergenic
1183749836 22:39713595-39713617 CTTGGCTAAACAGCAGGTACAGG + Intergenic
1183773892 22:39949941-39949963 CCTTGCTCAAAAGCATTCAGGGG + Intronic
1184654696 22:45935247-45935269 CCTTGCTCAGCAGCTGTCAGTGG + Intronic
1184832458 22:46997442-46997464 CTTCTCAAAATAGCAGTCAGCGG + Intronic
950169768 3:10830366-10830388 CTTTACTGAAGAGCAGGCAGGGG + Intronic
950563134 3:13747457-13747479 CTTCCCTATGCAGCAGTCAGCGG + Intergenic
952129713 3:30347007-30347029 CTTTACTAAATAGCATTCATTGG - Intergenic
953531352 3:43742256-43742278 CTTTGGTATACAGCAGAAAGTGG - Intergenic
957970596 3:87376802-87376824 CCTTGGTAAGCAGGAGTCAGTGG + Intergenic
960154989 3:114290645-114290667 TTTTGACAAACAGAAGTCAGCGG + Intronic
961966199 3:130905791-130905813 CTTTGCCAGACAGCAGTTAAAGG + Intronic
962718150 3:138146194-138146216 CTTTTTTAAAAAGCAGTTAGAGG + Intergenic
964615020 3:158654320-158654342 CTTTGGGAAACAGAAGTGAGAGG - Intronic
969388797 4:6875192-6875214 CTTTGATAAGCAGCGGTCATGGG + Intronic
975332648 4:73135256-73135278 TTTTGTTCAACAGCAGTCAGTGG - Exonic
977474706 4:97490842-97490864 ATTTCCTAAACACCAGTCATTGG + Intronic
978162432 4:105565134-105565156 CTATGCCAATTAGCAGTCAGAGG + Intronic
978223873 4:106310401-106310423 CAATGTTAAACAGCAGTCAGAGG + Intronic
979188430 4:117828301-117828323 CTTAGCTCAAAGGCAGTCAGAGG + Intergenic
981107542 4:140897997-140898019 CTTTGTTAGACAGCAGAGAGAGG - Intronic
986274015 5:6257798-6257820 ATTAGCCACACAGCAGTCAGAGG + Intergenic
986587497 5:9334322-9334344 CTTTGCCAAACAGGAATCTGAGG + Intronic
989144977 5:38240034-38240056 ATTTTCTAAATAGGAGTCAGTGG - Intergenic
990595158 5:57305585-57305607 CTTTGCTACACACGAGACAGAGG - Intergenic
991972575 5:72155228-72155250 CTTTGCTATACAGTACTCTGGGG - Intronic
992327754 5:75679525-75679547 CTATGGAAAACAGCATTCAGTGG + Intronic
998124971 5:139612210-139612232 GTTTGCTAATCAGAATTCAGTGG + Intronic
998127114 5:139632021-139632043 CTTTCCTGTACAGCAGTCACAGG - Intergenic
998219295 5:140263362-140263384 CTTTGGTATGCAGCAGTCATGGG - Intronic
998490778 5:142544623-142544645 TTTTGCCACACAGCAGCCAGAGG - Intergenic
1003202874 6:3978525-3978547 CTTTCATAAACAGCATGCAGGGG - Intergenic
1004674895 6:17832130-17832152 CGTAGCTTAACAGCAGTCACTGG - Intronic
1008517368 6:52330726-52330748 CCTTGCTAAATAGCTTTCAGAGG - Intergenic
1013356475 6:109350010-109350032 CTTGGCTAAGCTGCAGGCAGAGG - Intergenic
1013411051 6:109883935-109883957 CTATGAAAAATAGCAGTCAGAGG + Intergenic
1015928230 6:138331232-138331254 TTTTGCTTAACTGCAGTGAGTGG - Intronic
1016464605 6:144313240-144313262 CGTGGCTAAGCAGCAGCCAGTGG - Intronic
1016610769 6:145986440-145986462 CTTTGGTAGAAAGAAGTCAGAGG + Intergenic
1018259826 6:161959013-161959035 CTTTGCATTACAGCAGTCACTGG + Intronic
1019657670 7:2205236-2205258 CTTTGCTAAAGAACAGGCACGGG + Intronic
1020061661 7:5157037-5157059 CCCTGCGAAACAGCAGTCACCGG + Intergenic
1020166497 7:5811624-5811646 CCCTGCGAAACAGCAGTCACCGG - Intergenic
1022949102 7:35318581-35318603 CTTTGCTAAACAGCTGTCTCAGG + Intergenic
1025173884 7:56787007-56787029 CTTTGCTAAACTGGAGTGATTGG - Intergenic
1025698217 7:63790948-63790970 CTTTGCTAAACTGGAGTGATTGG + Intergenic
1030241598 7:107332146-107332168 TCTTGCTGAAAAGCAGTCAGTGG - Intronic
1032287616 7:130553494-130553516 CTTTGCTAAAGAACAGATAGGGG + Intronic
1033087159 7:138353103-138353125 CTTTGATAAACACCAGTTGGTGG - Intergenic
1034919261 7:155065952-155065974 CCTTGGGAGACAGCAGTCAGGGG - Intergenic
1035821392 8:2596068-2596090 CTGTGCTACACAGCGGTCAGTGG + Intergenic
1037389092 8:18374148-18374170 CTTTTCTGAACAGCACTCTGGGG + Intergenic
1038625906 8:29193086-29193108 CTGTGTGAAACAGCAGGCAGGGG + Intronic
1039731493 8:40283631-40283653 CTTTACTACACAGCAGTCTGAGG + Intergenic
1042895030 8:73657711-73657733 ATTTGCTAAAAAGAATTCAGAGG + Intronic
1043887413 8:85617841-85617863 CTTTGCTACTCAGAAGTCTGAGG - Intergenic
1047428500 8:124768397-124768419 ACTTGCCAAACAGTAGTCAGTGG - Intergenic
1047859584 8:128950335-128950357 CTTTGTAAAAGAGCAGTAAGAGG - Intergenic
1048866633 8:138766238-138766260 CTGTCCTAAGCTGCAGTCAGAGG - Intronic
1050436371 9:5614775-5614797 ATTTGTTAAAAAGCAGTGAGGGG - Intergenic
1050487796 9:6152850-6152872 CTTTGGAAAACAGAAGCCAGTGG + Intergenic
1051977751 9:22973387-22973409 CTTTGCTAAATTGCAGCCAAAGG + Intergenic
1054358350 9:64086933-64086955 ATTTCCTAAACAGCAGCCAAGGG + Intergenic
1055778104 9:79788562-79788584 CTTTGCTAAAATGCAGGCAATGG - Intergenic
1056636806 9:88338002-88338024 CTTTTCTAAACAGCAATCCGTGG - Intergenic
1057828887 9:98392200-98392222 AGTGGCTAAACAACAGTCAGAGG - Intronic
1185521789 X:745728-745750 CTTTGCAAAACAGAACTCAAGGG + Intergenic
1186331744 X:8541876-8541898 CTTTGGTGAAGAGCAGTCAGGGG + Intronic
1187538357 X:20164952-20164974 CTTTGCAAAACAGCTGAGAGCGG - Exonic
1187560435 X:20397824-20397846 CTATGGGAAACAGCAGACAGGGG + Intergenic
1188349303 X:29107917-29107939 CTTTACTTAACAGAAGTCTGGGG + Intronic
1188559075 X:31447369-31447391 CTTTGTGAAACAGCAGTGATGGG + Intronic
1189223632 X:39394397-39394419 ACATGCTAAACTGCAGTCAGAGG - Intergenic
1194679545 X:96835483-96835505 CTTTCCAAAAGAGGAGTCAGGGG + Intronic
1197344102 X:125311113-125311135 CTTTTACAAACAGCAGACAGAGG + Intergenic
1197577311 X:128231043-128231065 CTTTGCCAAAGATCAGTCTGAGG - Intergenic
1198156932 X:133970188-133970210 CTTTGCTTAACAGCAGCTAGTGG - Intronic
1201430871 Y:13900742-13900764 CTTTGGTGAAGAGCAGTCAGGGG - Intergenic