ID: 1166499821

View in Genome Browser
Species Human (GRCh38)
Location 19:43332408-43332430
Sequence GGGGCTGATGGCGCTGTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166499813_1166499821 12 Left 1166499813 19:43332373-43332395 CCTCCTCTGACTGCTGTTTAGCA 0: 2
1: 0
2: 0
3: 16
4: 220
Right 1166499821 19:43332408-43332430 GGGGCTGATGGCGCTGTCCTGGG No data
1166499814_1166499821 9 Left 1166499814 19:43332376-43332398 CCTCTGACTGCTGTTTAGCAAAG 0: 2
1: 0
2: 0
3: 22
4: 165
Right 1166499821 19:43332408-43332430 GGGGCTGATGGCGCTGTCCTGGG No data
1166499811_1166499821 24 Left 1166499811 19:43332361-43332383 CCACTGCCATGGCCTCCTCTGAC 0: 2
1: 1
2: 7
3: 48
4: 481
Right 1166499821 19:43332408-43332430 GGGGCTGATGGCGCTGTCCTGGG No data
1166499812_1166499821 18 Left 1166499812 19:43332367-43332389 CCATGGCCTCCTCTGACTGCTGT 0: 2
1: 0
2: 4
3: 41
4: 413
Right 1166499821 19:43332408-43332430 GGGGCTGATGGCGCTGTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166499821 Original CRISPR GGGGCTGATGGCGCTGTCCT GGG Intergenic
No off target data available for this crispr