ID: 1166500727

View in Genome Browser
Species Human (GRCh38)
Location 19:43339178-43339200
Sequence CTGGAGTCCCTTCCAACTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166500727_1166500730 7 Left 1166500727 19:43339178-43339200 CCAGCAGTTGGAAGGGACTCCAG No data
Right 1166500730 19:43339208-43339230 ACAAAGGTTTACAGTTTCTTTGG No data
1166500727_1166500728 -9 Left 1166500727 19:43339178-43339200 CCAGCAGTTGGAAGGGACTCCAG No data
Right 1166500728 19:43339192-43339214 GGACTCCAGTTTTAAGACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166500727 Original CRISPR CTGGAGTCCCTTCCAACTGC TGG (reversed) Intergenic
No off target data available for this crispr