ID: 1166502265

View in Genome Browser
Species Human (GRCh38)
Location 19:43350683-43350705
Sequence GTCCTGCGTAACCACAGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166502265_1166502270 14 Left 1166502265 19:43350683-43350705 CCTGGTCTGTGGTTACGCAGGAC No data
Right 1166502270 19:43350720-43350742 TAATCTATATAGGCTGGGCGTGG No data
1166502265_1166502266 4 Left 1166502265 19:43350683-43350705 CCTGGTCTGTGGTTACGCAGGAC No data
Right 1166502266 19:43350710-43350732 TCCTTAAGAATAATCTATATAGG No data
1166502265_1166502269 9 Left 1166502265 19:43350683-43350705 CCTGGTCTGTGGTTACGCAGGAC No data
Right 1166502269 19:43350715-43350737 AAGAATAATCTATATAGGCTGGG No data
1166502265_1166502268 8 Left 1166502265 19:43350683-43350705 CCTGGTCTGTGGTTACGCAGGAC No data
Right 1166502268 19:43350714-43350736 TAAGAATAATCTATATAGGCTGG No data
1166502265_1166502271 17 Left 1166502265 19:43350683-43350705 CCTGGTCTGTGGTTACGCAGGAC No data
Right 1166502271 19:43350723-43350745 TCTATATAGGCTGGGCGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166502265 Original CRISPR GTCCTGCGTAACCACAGACC AGG (reversed) Intergenic
No off target data available for this crispr