ID: 1166502893 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 19:43354263-43354285 |
| Sequence | ATCCGGTGCTCAGTGACGCG GGG (reversed) |
| Strand | - |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 26 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 1, 4: 24} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1166502893_1166502907 | 24 | Left | 1166502893 | 19:43354263-43354285 | CCCCGCGTCACTGAGCACCGGAT | 0: 1 1: 0 2: 0 3: 1 4: 24 |
||
| Right | 1166502907 | 19:43354310-43354332 | CTACACCTTCGTGTGCCGCCAGG | 0: 1 1: 0 2: 0 3: 2 4: 25 |
||||
| 1166502893_1166502908 | 27 | Left | 1166502893 | 19:43354263-43354285 | CCCCGCGTCACTGAGCACCGGAT | 0: 1 1: 0 2: 0 3: 1 4: 24 |
||
| Right | 1166502908 | 19:43354313-43354335 | CACCTTCGTGTGCCGCCAGGAGG | 0: 1 1: 0 2: 0 3: 4 4: 45 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1166502893 | Original CRISPR | ATCCGGTGCTCAGTGACGCG GGG (reversed) | Exonic | ||