ID: 1166502893

View in Genome Browser
Species Human (GRCh38)
Location 19:43354263-43354285
Sequence ATCCGGTGCTCAGTGACGCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 26
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 24}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166502893_1166502907 24 Left 1166502893 19:43354263-43354285 CCCCGCGTCACTGAGCACCGGAT 0: 1
1: 0
2: 0
3: 1
4: 24
Right 1166502907 19:43354310-43354332 CTACACCTTCGTGTGCCGCCAGG 0: 1
1: 0
2: 0
3: 2
4: 25
1166502893_1166502908 27 Left 1166502893 19:43354263-43354285 CCCCGCGTCACTGAGCACCGGAT 0: 1
1: 0
2: 0
3: 1
4: 24
Right 1166502908 19:43354313-43354335 CACCTTCGTGTGCCGCCAGGAGG 0: 1
1: 0
2: 0
3: 4
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166502893 Original CRISPR ATCCGGTGCTCAGTGACGCG GGG (reversed) Exonic