ID: 1166504042

View in Genome Browser
Species Human (GRCh38)
Location 19:43360550-43360572
Sequence TGGGTTCCCCTTATGAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 2, 1: 0, 2: 2, 3: 13, 4: 115}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166504037_1166504042 25 Left 1166504037 19:43360502-43360524 CCCTTCACATCTGCAATTTTCAA 0: 2
1: 0
2: 2
3: 38
4: 329
Right 1166504042 19:43360550-43360572 TGGGTTCCCCTTATGAAAACTGG 0: 2
1: 0
2: 2
3: 13
4: 115
1166504039_1166504042 1 Left 1166504039 19:43360526-43360548 CCGACTCTTCTTCTCTCTGCATC 0: 2
1: 0
2: 9
3: 65
4: 720
Right 1166504042 19:43360550-43360572 TGGGTTCCCCTTATGAAAACTGG 0: 2
1: 0
2: 2
3: 13
4: 115
1166504038_1166504042 24 Left 1166504038 19:43360503-43360525 CCTTCACATCTGCAATTTTCAAT 0: 2
1: 0
2: 1
3: 67
4: 663
Right 1166504042 19:43360550-43360572 TGGGTTCCCCTTATGAAAACTGG 0: 2
1: 0
2: 2
3: 13
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166504042 Original CRISPR TGGGTTCCCCTTATGAAAAC TGG Intronic
902233528 1:15043403-15043425 TGGGTTCCCCTTATGTAAAATGG - Intronic
902321173 1:15667550-15667572 TGGGTGCAACTTGTGAAAACGGG + Exonic
902780185 1:18699943-18699965 TGGTTTCCCCTTCTGTAAAATGG + Intronic
903647598 1:24904516-24904538 GGGGCTCCCCAGATGAAAACTGG - Intronic
910114618 1:83718270-83718292 TGGTTTCCCCTTAAGACAACTGG - Intergenic
918689876 1:187466763-187466785 TTGGTTCCTCTTATGACAACTGG + Intergenic
923430989 1:233920164-233920186 GGGGTTACCCTTATTAAAAAGGG + Intronic
1068450560 10:57181237-57181259 TGAGTTCTCCTTAGGAGAACTGG + Intergenic
1069594904 10:69664218-69664240 TGGCTTCCCATTATGAACACAGG - Intergenic
1069895552 10:71678297-71678319 TGGGTTCCCCTTCTGTAAAATGG - Intronic
1074131382 10:110580788-110580810 TGGGTATCCCTTATGCAAAATGG - Intronic
1076985600 11:233836-233858 AGGGGTCTCCTAATGAAAACTGG + Intronic
1077316634 11:1922259-1922281 TGGGCACCCCATAGGAAAACAGG + Intronic
1081746792 11:45478739-45478761 TGGGCTCCCCTTATCACAAAGGG - Intergenic
1082797644 11:57389447-57389469 TGGGTTCCCCTCATAGAGACTGG - Intronic
1085429232 11:76432654-76432676 TTGGTTTCCCTTAGGAAAATTGG - Intergenic
1085771669 11:79331181-79331203 TGTGTTCCCCTTGTGGAGACGGG + Intronic
1089140620 11:116280945-116280967 TGGCTTCCCCTTAAAAAACCTGG - Intergenic
1091659824 12:2375047-2375069 TTTGTTCCCCATCTGAAAACTGG - Intronic
1092436636 12:8452471-8452493 TGGGTTGTTCTTTTGAAAACTGG - Intergenic
1094488703 12:30945227-30945249 TGTGTTCCCATTATCAACACAGG + Intronic
1100621019 12:96272964-96272986 TGGGTTCCCCCTAAGAGAAGTGG - Intergenic
1100672495 12:96832017-96832039 TGGGTTCCTCTCATGAAACACGG - Intronic
1103968383 12:124654540-124654562 TGAGTTCCCCATATGTAAAATGG - Intergenic
1104122136 12:125809606-125809628 TGGCTTCTGCTGATGAAAACTGG + Intergenic
1107510990 13:41084761-41084783 TGGGTAACCCTTATGACATCTGG + Intergenic
1111482356 13:88846874-88846896 TGGTTTTCCATTATGAAAAAGGG + Intergenic
1112821694 13:103345527-103345549 TGGTTTCCCCTTATTAAACCAGG + Intergenic
1119265193 14:73260161-73260183 TGGGTTCCTCTTCTGAGAAATGG + Intronic
1119584086 14:75816080-75816102 TGGCTTCCCCTTTTGTAAAATGG + Intronic
1120241442 14:81954063-81954085 TGGTATACCTTTATGAAAACTGG - Intergenic
1120606277 14:86582590-86582612 AGTGTTCCCCCTTTGAAAACTGG - Intergenic
1122024022 14:98861559-98861581 TGGTTTCCCCATATGAAAACTGG - Intergenic
1122045118 14:99017565-99017587 TGGGTTCCCTCTCTGAAAGCAGG + Intergenic
1123950341 15:25266011-25266033 AGGGTTCACAATATGAAAACTGG + Intergenic
1125426303 15:39552960-39552982 TTGGTTCCCCTTATGAGATGAGG - Intergenic
1126669223 15:51101144-51101166 TGGGGTCACCTCATGAAAGCTGG - Intronic
1126942213 15:53779650-53779672 TGGGTTCCTCTCATGACAATTGG - Intergenic
1127396845 15:58550048-58550070 TGGTTTCCCCATCTGAAAAACGG - Intronic
1133406262 16:5526925-5526947 TGGTTTCCTCTTATGCAAAATGG + Intergenic
1133553209 16:6879270-6879292 TGGGCTGCCCTTCAGAAAACTGG - Intronic
1136021902 16:27445841-27445863 TGGTTTCCCCTTCTGTAAAATGG - Intronic
1137729853 16:50681299-50681321 TAAGTTCCCCGTTTGAAAACAGG + Exonic
1138529232 16:57626034-57626056 TCGGTTCCCCTTCTGTAAAGTGG + Intronic
1140022265 16:71249624-71249646 TGGGTTCCTCATTTGTAAACTGG - Intergenic
1141717198 16:85733846-85733868 TTGGTTCCCCTGGTGAAAATCGG - Intronic
1143450570 17:7034410-7034432 TGGTTTCCCCATCTGTAAACTGG - Intergenic
1143635097 17:8159874-8159896 TGAGTACCCCACATGAAAACTGG + Exonic
1153087795 18:1308206-1308228 TGGGTCCCTCTTATGACACCTGG - Intergenic
1156306049 18:35879021-35879043 TGGCTTCCCCTAATGCAAAGTGG - Intergenic
1156839732 18:41597180-41597202 TGGGTACACCTTTTGAAAACTGG - Intergenic
1157382709 18:47234549-47234571 TGGATTCCTCTTTTGAAAAAGGG + Intronic
1163836911 19:19580519-19580541 TGAGCTCTCCTTCTGAAAACTGG - Intronic
1166504042 19:43360550-43360572 TGGGTTCCCCTTATGAAAACTGG + Intronic
1166506415 19:43374208-43374230 TGGGTTCCCCTTATGAAAACTGG - Intergenic
1167739320 19:51314600-51314622 TAGGTTCCCCTTTTGAGAACTGG + Intronic
926490946 2:13525925-13525947 TGGGTTCCCAGTAGGAAAAGAGG - Intergenic
929094093 2:38247495-38247517 TGGGTTCCAGGTCTGAAAACTGG - Intergenic
934967107 2:98732070-98732092 TAGTTTCCTCTTATGAAAAATGG - Intergenic
936241542 2:110792255-110792277 AGGGCTCCCCAGATGAAAACTGG + Intronic
939771235 2:146322057-146322079 CAGGTTGCCCTTATGAAGACAGG + Intergenic
942434152 2:175952967-175952989 TGGTTTCTTCTTTTGAAAACTGG - Intronic
943179780 2:184527795-184527817 TGGGTTCTCTTTGTGCAAACTGG - Intergenic
943686282 2:190821822-190821844 TGGATTCACCTTCTGAAATCAGG + Intergenic
1172197823 20:33104217-33104239 TGGTTTCCACATCTGAAAACAGG - Intronic
1172257804 20:33535313-33535335 TGGGATTCCCTTACAAAAACTGG + Intronic
1173818660 20:46006818-46006840 TAGTTTCCCCCTCTGAAAACAGG + Intergenic
1174777682 20:53360709-53360731 TGGTTTCCCCATCTGAAAAATGG - Intronic
1176996730 21:15563422-15563444 TGGGACACCCTTATGAAAAGAGG - Intergenic
1177205512 21:18005938-18005960 TGGGTTCCCCCCATGAAACGTGG - Intronic
1181993338 22:26855144-26855166 TGGGTCCCCCATTTAAAAACAGG + Intergenic
1182063142 22:27412168-27412190 TGGTTTCCTCATATGTAAACTGG - Intergenic
1182071485 22:27466841-27466863 TGGTCTCCCCATCTGAAAACAGG + Intergenic
1183424668 22:37733121-37733143 TAGTTTCCCCTTCTGAAAAATGG - Intronic
1185315346 22:50176623-50176645 TGGTTTCCCCTTGTGCACACAGG + Intronic
949327985 3:2888548-2888570 TGGGTTCCGGGTATGAAAAATGG - Intronic
953381362 3:42475013-42475035 TGGGTTCTCCTCATGAAATAAGG - Intergenic
955510093 3:59671376-59671398 AGGTTTCCCCTTAAGAAAATTGG + Intergenic
956798945 3:72739565-72739587 TGGCTTCCCCTTCTGTATACTGG + Intergenic
956839508 3:73124646-73124668 TGGGACCCCCTAAGGAAAACTGG - Intergenic
959793343 3:110391995-110392017 TGGGTTCAACTTGTGAACACAGG - Intergenic
961411423 3:126724051-126724073 TCAGTTCCCCTAATGAAGACTGG - Intronic
961524852 3:127490295-127490317 TGGTTTCCCCATCTGTAAACTGG - Intergenic
963871323 3:150417588-150417610 TTGTTTCCTCTTATGAAAAATGG + Intronic
967479422 3:189956876-189956898 TGGGGTCCACTGATGAAAAGAGG - Exonic
967967979 3:194977172-194977194 TGAGTTCCCCAAATGAAACCAGG + Intergenic
968871724 4:3245947-3245969 TGGGTTCCCCTTGTGTGCACAGG + Intronic
972597623 4:40544017-40544039 TCGGTGCACCTTATGCAAACAGG - Intronic
975206252 4:71646974-71646996 TGGGTTCCCCTTGTCCAAAAGGG + Intergenic
975678615 4:76852601-76852623 TGGTTTTCCCTTATAAAAATAGG + Intergenic
979999603 4:127472467-127472489 TGGGTTCAAGTTAGGAAAACTGG - Intergenic
983304798 4:165972442-165972464 TGGGTTCCAGGTTTGAAAACTGG + Intronic
984753376 4:183300158-183300180 TGGGCTCCCATCATGTAAACTGG + Intronic
986313296 5:6570835-6570857 TGGGTTTCTCTTCTGGAAACAGG + Intergenic
988157611 5:27475625-27475647 TGGGAACCCCTTGGGAAAACTGG + Intergenic
989686895 5:44099774-44099796 TGGATTTCCTCTATGAAAACAGG - Intergenic
993710422 5:91219251-91219273 TAGGTTCCTCCTATGAAGACTGG + Intergenic
998189275 5:140008886-140008908 TCAGTTCCCCATATGAAAAATGG + Intronic
999435055 5:151557251-151557273 TGGTTTCCCCTCAGGAGAACTGG - Intronic
1005091061 6:22057408-22057430 TGGCCTCCTCTTATGAAGACAGG - Intergenic
1005881600 6:30066779-30066801 TGGGTTTCTCTAAAGAAAACGGG - Intronic
1008684934 6:53914855-53914877 AGGGTTACCCATATGAAAACAGG - Intronic
1012672736 6:102076022-102076044 TAGGTTTCCCTTAGGGAAACAGG - Intergenic
1012983360 6:105852753-105852775 TGGGATTCCCTTACAAAAACTGG + Intergenic
1013438399 6:110137424-110137446 TTGGTTAGACTTATGAAAACAGG + Intronic
1015844040 6:137498996-137499018 TATTTTCCCCGTATGAAAACTGG - Intergenic
1018072447 6:160177029-160177051 TGAATTCCCCCTATGAAAAAGGG + Intronic
1018412222 6:163561854-163561876 TTTTTTCCCCTTATTAAAACAGG + Intronic
1021276125 7:18653673-18653695 TGTGTTGCCCTTATTAAAACAGG + Intronic
1021826467 7:24557539-24557561 TGGGATCCACAGATGAAAACTGG - Intergenic
1022886256 7:34648395-34648417 TGGATTCCCCTTGTGAAAATGGG - Intergenic
1022978550 7:35580525-35580547 TGGGTTCCCCTTCTGTAAAATGG - Intergenic
1024083412 7:45874218-45874240 TGTCTTTCCCTTATTAAAACAGG - Intergenic
1024772317 7:52737458-52737480 TGGCTTCCCCTTATGTAAGTTGG + Intergenic
1026203989 7:68239605-68239627 TAGGGTCCCCTTCTGATAACAGG + Intergenic
1027534681 7:79382576-79382598 TGCTTTCCCCTTATGCAAATGGG - Intronic
1028125307 7:87105730-87105752 TGGATTCCCCTCTTGAAAACTGG - Intergenic
1030136129 7:106251445-106251467 TGGTTTTCCTTTAAGAAAACTGG - Intronic
1034138743 7:148796939-148796961 TGGGTACCCATTATGACGACAGG + Intronic
1043482787 8:80669712-80669734 TGTGTTTGCCTTATGAACACTGG + Intronic
1048855338 8:138681956-138681978 TGGTTTCCCCTTATTCAAGCAGG - Intronic
1052712859 9:32078289-32078311 TGGGTTCCCCTCATGACACATGG - Intergenic
1055488372 9:76779453-76779475 TGGGATGCACTTATGAAAAATGG + Intronic
1057298423 9:93862482-93862504 TGGGTTCCTCATTGGAAAACAGG - Intergenic
1058981062 9:110171056-110171078 TGGTTTCCTCTTGTGAAAAATGG - Exonic
1059910008 9:119032554-119032576 TGTGTTTCCATTTTGAAAACAGG - Intergenic
1060281726 9:122219690-122219712 TCGATTCCTCCTATGAAAACCGG - Intronic
1060284513 9:122236985-122237007 TGTGTTCCTCTTCTGAAAACAGG - Intergenic
1060825201 9:126683767-126683789 TGGTTTTCCCATTTGAAAACTGG - Intronic
1195705879 X:107737796-107737818 TGAGTTCCCATTGAGAAAACAGG + Intronic
1200947392 Y:8858891-8858913 TGGCTTGCCCTTATGATACCGGG - Intergenic
1201364712 Y:13190955-13190977 TGGGTCCCCATTAGGAAAATGGG - Intergenic