ID: 1166506415

View in Genome Browser
Species Human (GRCh38)
Location 19:43374208-43374230
Sequence TGGGTTCCCCTTATGAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166506415_1166506420 25 Left 1166506415 19:43374208-43374230 CCAGTTTTCATAAGGGGAACCCA No data
Right 1166506420 19:43374256-43374278 TTGAAAATTGCAGATGTGAAGGG No data
1166506415_1166506418 1 Left 1166506415 19:43374208-43374230 CCAGTTTTCATAAGGGGAACCCA No data
Right 1166506418 19:43374232-43374254 GATGCAGAGAGAAGAAGAGTCGG No data
1166506415_1166506419 24 Left 1166506415 19:43374208-43374230 CCAGTTTTCATAAGGGGAACCCA No data
Right 1166506419 19:43374255-43374277 ATTGAAAATTGCAGATGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166506415 Original CRISPR TGGGTTCCCCTTATGAAAAC TGG (reversed) Intergenic
No off target data available for this crispr