ID: 1166506416

View in Genome Browser
Species Human (GRCh38)
Location 19:43374227-43374249
Sequence TCTTCTTCTCTCTGCATCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166506416_1166506419 5 Left 1166506416 19:43374227-43374249 CCCAAGATGCAGAGAGAAGAAGA No data
Right 1166506419 19:43374255-43374277 ATTGAAAATTGCAGATGTGAAGG No data
1166506416_1166506423 27 Left 1166506416 19:43374227-43374249 CCCAAGATGCAGAGAGAAGAAGA No data
Right 1166506423 19:43374277-43374299 GGAGCTGAGCAGGAAATTCAGGG No data
1166506416_1166506424 28 Left 1166506416 19:43374227-43374249 CCCAAGATGCAGAGAGAAGAAGA No data
Right 1166506424 19:43374278-43374300 GAGCTGAGCAGGAAATTCAGGGG No data
1166506416_1166506421 17 Left 1166506416 19:43374227-43374249 CCCAAGATGCAGAGAGAAGAAGA No data
Right 1166506421 19:43374267-43374289 AGATGTGAAGGGAGCTGAGCAGG No data
1166506416_1166506422 26 Left 1166506416 19:43374227-43374249 CCCAAGATGCAGAGAGAAGAAGA No data
Right 1166506422 19:43374276-43374298 GGGAGCTGAGCAGGAAATTCAGG No data
1166506416_1166506420 6 Left 1166506416 19:43374227-43374249 CCCAAGATGCAGAGAGAAGAAGA No data
Right 1166506420 19:43374256-43374278 TTGAAAATTGCAGATGTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166506416 Original CRISPR TCTTCTTCTCTCTGCATCTT GGG (reversed) Intergenic
No off target data available for this crispr