ID: 1166506418

View in Genome Browser
Species Human (GRCh38)
Location 19:43374232-43374254
Sequence GATGCAGAGAGAAGAAGAGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166506414_1166506418 2 Left 1166506414 19:43374207-43374229 CCCAGTTTTCATAAGGGGAACCC No data
Right 1166506418 19:43374232-43374254 GATGCAGAGAGAAGAAGAGTCGG No data
1166506407_1166506418 16 Left 1166506407 19:43374193-43374215 CCCACTGCTTCACCCCCAGTTTT No data
Right 1166506418 19:43374232-43374254 GATGCAGAGAGAAGAAGAGTCGG No data
1166506415_1166506418 1 Left 1166506415 19:43374208-43374230 CCAGTTTTCATAAGGGGAACCCA No data
Right 1166506418 19:43374232-43374254 GATGCAGAGAGAAGAAGAGTCGG No data
1166506408_1166506418 15 Left 1166506408 19:43374194-43374216 CCACTGCTTCACCCCCAGTTTTC No data
Right 1166506418 19:43374232-43374254 GATGCAGAGAGAAGAAGAGTCGG No data
1166506413_1166506418 3 Left 1166506413 19:43374206-43374228 CCCCAGTTTTCATAAGGGGAACC No data
Right 1166506418 19:43374232-43374254 GATGCAGAGAGAAGAAGAGTCGG No data
1166506412_1166506418 4 Left 1166506412 19:43374205-43374227 CCCCCAGTTTTCATAAGGGGAAC No data
Right 1166506418 19:43374232-43374254 GATGCAGAGAGAAGAAGAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166506418 Original CRISPR GATGCAGAGAGAAGAAGAGT CGG Intergenic
No off target data available for this crispr