ID: 1166506420

View in Genome Browser
Species Human (GRCh38)
Location 19:43374256-43374278
Sequence TTGAAAATTGCAGATGTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166506412_1166506420 28 Left 1166506412 19:43374205-43374227 CCCCCAGTTTTCATAAGGGGAAC No data
Right 1166506420 19:43374256-43374278 TTGAAAATTGCAGATGTGAAGGG No data
1166506415_1166506420 25 Left 1166506415 19:43374208-43374230 CCAGTTTTCATAAGGGGAACCCA No data
Right 1166506420 19:43374256-43374278 TTGAAAATTGCAGATGTGAAGGG No data
1166506413_1166506420 27 Left 1166506413 19:43374206-43374228 CCCCAGTTTTCATAAGGGGAACC No data
Right 1166506420 19:43374256-43374278 TTGAAAATTGCAGATGTGAAGGG No data
1166506417_1166506420 5 Left 1166506417 19:43374228-43374250 CCAAGATGCAGAGAGAAGAAGAG No data
Right 1166506420 19:43374256-43374278 TTGAAAATTGCAGATGTGAAGGG No data
1166506414_1166506420 26 Left 1166506414 19:43374207-43374229 CCCAGTTTTCATAAGGGGAACCC No data
Right 1166506420 19:43374256-43374278 TTGAAAATTGCAGATGTGAAGGG No data
1166506416_1166506420 6 Left 1166506416 19:43374227-43374249 CCCAAGATGCAGAGAGAAGAAGA No data
Right 1166506420 19:43374256-43374278 TTGAAAATTGCAGATGTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166506420 Original CRISPR TTGAAAATTGCAGATGTGAA GGG Intergenic
No off target data available for this crispr