ID: 1166509363

View in Genome Browser
Species Human (GRCh38)
Location 19:43394213-43394235
Sequence GGACTCCAGTTTTAAGACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166509363_1166509364 -9 Left 1166509363 19:43394213-43394235 CCTTTGTCTTAAAACTGGAGTCC No data
Right 1166509364 19:43394227-43394249 CTGGAGTCCCTTCCAACTGCTGG No data
1166509363_1166509368 19 Left 1166509363 19:43394213-43394235 CCTTTGTCTTAAAACTGGAGTCC No data
Right 1166509368 19:43394255-43394277 GAAATCCCAGCAAGATAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166509363 Original CRISPR GGACTCCAGTTTTAAGACAA AGG (reversed) Intergenic