ID: 1166509364

View in Genome Browser
Species Human (GRCh38)
Location 19:43394227-43394249
Sequence CTGGAGTCCCTTCCAACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166509363_1166509364 -9 Left 1166509363 19:43394213-43394235 CCTTTGTCTTAAAACTGGAGTCC No data
Right 1166509364 19:43394227-43394249 CTGGAGTCCCTTCCAACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166509364 Original CRISPR CTGGAGTCCCTTCCAACTGC TGG Intergenic
No off target data available for this crispr