ID: 1166509368

View in Genome Browser
Species Human (GRCh38)
Location 19:43394255-43394277
Sequence GAAATCCCAGCAAGATAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166509363_1166509368 19 Left 1166509363 19:43394213-43394235 CCTTTGTCTTAAAACTGGAGTCC No data
Right 1166509368 19:43394255-43394277 GAAATCCCAGCAAGATAAGAAGG No data
1166509366_1166509368 -3 Left 1166509366 19:43394235-43394257 CCTTCCAACTGCTGGTGACAGAA No data
Right 1166509368 19:43394255-43394277 GAAATCCCAGCAAGATAAGAAGG No data
1166509367_1166509368 -7 Left 1166509367 19:43394239-43394261 CCAACTGCTGGTGACAGAAATCC No data
Right 1166509368 19:43394255-43394277 GAAATCCCAGCAAGATAAGAAGG No data
1166509365_1166509368 -2 Left 1166509365 19:43394234-43394256 CCCTTCCAACTGCTGGTGACAGA No data
Right 1166509368 19:43394255-43394277 GAAATCCCAGCAAGATAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166509368 Original CRISPR GAAATCCCAGCAAGATAAGA AGG Intergenic