ID: 1166511274

View in Genome Browser
Species Human (GRCh38)
Location 19:43410500-43410522
Sequence CATGGAAAAAATTCTGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 425
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 397}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166511265_1166511274 19 Left 1166511265 19:43410458-43410480 CCAGTGTGGGAGGTTGGAATTTT 0: 1
1: 0
2: 0
3: 14
4: 167
Right 1166511274 19:43410500-43410522 CATGGAAAAAATTCTGAGGATGG 0: 1
1: 0
2: 0
3: 27
4: 397
1166511263_1166511274 25 Left 1166511263 19:43410452-43410474 CCAAGACCAGTGTGGGAGGTTGG No data
Right 1166511274 19:43410500-43410522 CATGGAAAAAATTCTGAGGATGG 0: 1
1: 0
2: 0
3: 27
4: 397
1166511268_1166511274 -4 Left 1166511268 19:43410481-43410503 CCCCCAGGAATACAGGAAGCATG 0: 1
1: 0
2: 0
3: 36
4: 354
Right 1166511274 19:43410500-43410522 CATGGAAAAAATTCTGAGGATGG 0: 1
1: 0
2: 0
3: 27
4: 397
1166511271_1166511274 -6 Left 1166511271 19:43410483-43410505 CCCAGGAATACAGGAAGCATGGA 0: 1
1: 0
2: 1
3: 39
4: 487
Right 1166511274 19:43410500-43410522 CATGGAAAAAATTCTGAGGATGG 0: 1
1: 0
2: 0
3: 27
4: 397
1166511272_1166511274 -7 Left 1166511272 19:43410484-43410506 CCAGGAATACAGGAAGCATGGAA 0: 1
1: 1
2: 2
3: 32
4: 343
Right 1166511274 19:43410500-43410522 CATGGAAAAAATTCTGAGGATGG 0: 1
1: 0
2: 0
3: 27
4: 397
1166511269_1166511274 -5 Left 1166511269 19:43410482-43410504 CCCCAGGAATACAGGAAGCATGG 0: 1
1: 0
2: 5
3: 35
4: 260
Right 1166511274 19:43410500-43410522 CATGGAAAAAATTCTGAGGATGG 0: 1
1: 0
2: 0
3: 27
4: 397

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166511274 Original CRISPR CATGGAAAAAATTCTGAGGA TGG Intronic
900469443 1:2846067-2846089 CAGGGAAGAAAGTCTGAGAACGG - Intergenic
901896393 1:12316669-12316691 CTTGGAAATATTTCTGAGGCTGG - Intronic
901991214 1:13115562-13115584 AATGAAAAAGATGCTGAGGAAGG - Intergenic
902420036 1:16271689-16271711 CATTGAAAAAAGGCTGTGGATGG - Intronic
903366646 1:22809381-22809403 CTTGGAAAAACATCTTAGGAAGG - Intronic
904193701 1:28767904-28767926 AATTTAAAAAATTCTGAGGCCGG + Intronic
905003353 1:34690985-34691007 GATGAAAATAATTCTGTGGATGG + Intergenic
907160118 1:52363538-52363560 CATGAAAACAGTTCTGTGGATGG - Intronic
907529633 1:55081674-55081696 AATGGGAAAAACTCTGAGGCTGG + Intronic
907544088 1:55244223-55244245 GATGGAAAAGATGCTAAGGATGG + Intergenic
907796653 1:57724687-57724709 CATGGCAGAAGTTCTTAGGATGG - Intronic
908345729 1:63230393-63230415 GATGCAAAAAATTCTGGAGATGG - Intergenic
908776772 1:67648235-67648257 CATGAAAAATGTTCTGTGGATGG + Intergenic
909046950 1:70721837-70721859 CATGGAAAGAATTCCATGGAAGG - Intergenic
909135085 1:71788013-71788035 CTTAGAAAACATTCTGAGAATGG + Intronic
909164651 1:72204316-72204338 GAGGGAAAAAATGGTGAGGAAGG - Intronic
909545476 1:76841836-76841858 CATGTAGAGAATTCAGAGGAAGG - Intergenic
910066781 1:83163023-83163045 AATGAAAGAAATTCTGAGCAAGG - Intergenic
910339510 1:86169575-86169597 CATGGAAAAGATTCTAGGGAAGG + Intergenic
910524294 1:88160067-88160089 CAGGAAAAAAAATCTGAGGTTGG + Intergenic
910623898 1:89285712-89285734 CAAGGAAGAAATACTGAGGAAGG + Intergenic
910634004 1:89386937-89386959 GATGGAGATAATTCTGAAGATGG + Intergenic
910743783 1:90551030-90551052 CTTGAGAAAAGTTCTGAGGAGGG - Intergenic
911119767 1:94284151-94284173 CAGAGAAAAAATTCAAAGGAAGG + Intergenic
911699613 1:100936684-100936706 CATGAAAAGAGTTCTGTGGATGG - Intronic
912423439 1:109564506-109564528 AAAGGAAAAGATTCAGAGGAAGG - Intronic
913125631 1:115785312-115785334 CATAAAAAAACTTGTGAGGATGG + Intergenic
913154523 1:116082252-116082274 AATGAAAAAAGTTCTGAAGATGG - Intergenic
914800544 1:150958963-150958985 CAAGGAAAAAATTTAGAGGGCGG - Intronic
915117908 1:153612038-153612060 CCTGGAAAAATTTCAGAGGCTGG - Intronic
916398344 1:164416795-164416817 AATGGAGAAAACTCTGAAGAAGG - Intergenic
917191523 1:172423504-172423526 CCTGGAAAACATTCCGAAGAAGG + Intronic
917264259 1:173203119-173203141 AATGGAAAAAAATCTGTGTAAGG + Intronic
917627075 1:176857108-176857130 CTTGAAAAAGATTCTGAGAATGG - Intergenic
918451143 1:184660701-184660723 CTTTGAAAAAATGCTGAGAAAGG + Intergenic
918694782 1:187531901-187531923 GATGTAAAATATTCTGAGGGTGG - Intergenic
919069890 1:192740821-192740843 CATGGAAAAAAATGGAAGGATGG - Intergenic
919439850 1:197618592-197618614 CATTAAAAGAATTCTGATGAGGG - Intronic
919621022 1:199864835-199864857 CATGGACATAAATCTGAGGTTGG + Intergenic
920345046 1:205301106-205301128 CATGGAAAAAATCCAGGGGGTGG - Intergenic
920573471 1:207036210-207036232 CATGGCAAAAACTCTAAGCATGG + Intronic
921512337 1:216047459-216047481 GATGGAGAAAATGCTGAGGCTGG + Intronic
924042699 1:239998702-239998724 CATGGAAATAATTGTGAAAAGGG - Intergenic
924467981 1:244315319-244315341 CATGGAAATGATTGTCAGGAAGG + Intergenic
1064308706 10:14191733-14191755 CAGGGAATATATTCTGAGGCTGG - Intronic
1064485365 10:15783051-15783073 GTTGGAAAAAATTCTAAGGAGGG - Intronic
1065540032 10:26754703-26754725 CATGAAAATAAATCTCAGGATGG - Intronic
1065719153 10:28608876-28608898 CTTTCAAAAAATTCTGAGAAGGG + Intronic
1066009916 10:31185271-31185293 CATGGAAAAAAAACTGGGGCAGG - Intergenic
1068427795 10:56889950-56889972 GATGGAGAAAATTCAGTGGATGG - Intergenic
1068595263 10:58896270-58896292 CAAGGAAAGAATCCTGTGGAGGG - Intergenic
1068699536 10:60004963-60004985 CAGGGAAATATATCTGAGGAAGG - Intergenic
1069877600 10:71572666-71572688 CAGGGAAAAAATTATAAGAAAGG - Intronic
1070048874 10:72867125-72867147 CAATGAAAAAATTCAGATGAAGG - Intronic
1071551868 10:86572189-86572211 TAAGGAAAAAATTCTGAAAATGG + Intergenic
1072065158 10:91861240-91861262 GGTGGAGAAAATTCTGTGGATGG + Intronic
1073402390 10:103269128-103269150 CATGATAAAAATTCAGAGGGTGG - Intergenic
1073648937 10:105338121-105338143 GATGGAAAGAGTTCTGTGGATGG + Intergenic
1074420059 10:113300519-113300541 CATGGAATAAATTCAAGGGAGGG - Intergenic
1074896332 10:117780645-117780667 GATGGAAAAAACTCTGTGGATGG - Intergenic
1075278005 10:121112787-121112809 CAAGGACACAATGCTGAGGATGG + Intergenic
1077477937 11:2799710-2799732 CAAGGGAAAAATGCAGAGGAGGG - Intronic
1077694228 11:4379016-4379038 CATGGAAATGACTCTGAGGTGGG - Intergenic
1078196645 11:9142343-9142365 GACACAAAAAATTCTGAGGATGG + Intronic
1078761540 11:14255703-14255725 CATAGAAAGGACTCTGAGGATGG - Exonic
1079781239 11:24608826-24608848 AATAGCAAAAATTTTGAGGAGGG + Intronic
1080277043 11:30514255-30514277 CATGAAGAAAAGTCTGTGGATGG + Intronic
1080582515 11:33655878-33655900 CTTAGAAAAAAGTCTGAGTAAGG + Intronic
1080947791 11:36994555-36994577 CAAGGAAAATAGTCTGGGGAAGG + Intergenic
1081358367 11:42142182-42142204 CATAGAAAAAACTCTCAGTATGG + Intergenic
1081895499 11:46582263-46582285 CATGTATGAAATTCTCAGGATGG - Intronic
1081946689 11:47002082-47002104 TATGGAAAAAAGTCAGGGGAGGG - Intronic
1082957338 11:58884574-58884596 CAGGGAAAAAGTTATGATGATGG + Intronic
1083422270 11:62560768-62560790 CATGGAAAACAGCCTGGGGAGGG - Intronic
1083481301 11:62949317-62949339 GATGGAAAAAATTCTGGGGTGGG + Intronic
1083844854 11:65325456-65325478 CATGAAAACAATTCTGGAGATGG - Intergenic
1085821147 11:79795099-79795121 CAATGCAAAAATTATGAGGAAGG - Intergenic
1086024428 11:82272918-82272940 TATGGAATAGATTCTGAGGATGG - Intergenic
1087656464 11:100929115-100929137 CATGAAAAAATTGGTGAGGAGGG + Intronic
1087671726 11:101114793-101114815 CAAGGAAAACAGTCTGGGGATGG - Intronic
1088027439 11:105203042-105203064 AATGCAAAAAATTGTGAGCAAGG - Intergenic
1088125982 11:106423929-106423951 CCTGGATAAAATGCTGAAGAGGG - Intergenic
1088215878 11:107508600-107508622 GATGAAAAAAATTCTGGAGATGG - Intronic
1089411008 11:118242872-118242894 CAGGGCAAAAATTCAGAGGGAGG + Intronic
1090087343 11:123662385-123662407 CATGGAATAAATGCTTAGAAAGG - Intergenic
1090218778 11:124996640-124996662 GATGGAAAAAACTCTGGAGATGG - Intronic
1091459547 12:633517-633539 CATTTAAAAACTTCTGAGGCTGG + Intronic
1093550999 12:20411235-20411257 AATGGAAAGAGTTCTGAAGATGG - Intronic
1093766996 12:22975375-22975397 AATTGCAAAAATTCTGTGGAGGG - Intergenic
1094784122 12:33825761-33825783 CAAGGAAGAAATCCTGGGGATGG + Intergenic
1095139588 12:38645355-38645377 CATGGAGACAATTCTGAGAAGGG + Intergenic
1095203629 12:39414259-39414281 CATTGAATAAATTGTGAGGGAGG - Intronic
1095494948 12:42774246-42774268 CTTGGGAAAGATTCAGAGGAAGG - Intergenic
1095646831 12:44557759-44557781 CATGGAAATAAATGAGAGGATGG + Intronic
1098272537 12:68782908-68782930 CAAGGAAAGAAGTCTGAGGCAGG + Intronic
1098793684 12:74861139-74861161 TATGAATAAAATTCAGAGGAAGG + Intergenic
1100410346 12:94311242-94311264 CATAGGAAAAGTTATGAGGAAGG - Intronic
1102355653 12:112233021-112233043 CATGGAGAAAGTTGTGAAGATGG - Exonic
1102669836 12:114608657-114608679 GATGAAAGAAGTTCTGAGGATGG - Intergenic
1102739522 12:115194758-115194780 CATGGAAAAAGTCTTGAGGGCGG - Intergenic
1102899054 12:116621947-116621969 CATTGGAAAAATTCTCAGAAAGG + Intergenic
1104022513 12:125002838-125002860 CATGGCAAGAATTCTGCAGAAGG + Intronic
1104497902 12:129257822-129257844 CATGGAGATAACTCTGAGAAAGG + Intronic
1104699997 12:130895713-130895735 AATTTATAAAATTCTGAGGAAGG - Intergenic
1105450698 13:20496731-20496753 CATGGCAAAAAGGCTGAGGTAGG + Intronic
1105543623 13:21336452-21336474 CATGGAAAAATCTCTAAGGCAGG + Intergenic
1107217996 13:37944931-37944953 CAGGGAAAGAATTTGGAGGAAGG + Intergenic
1108570884 13:51749478-51749500 CATAGAGAAAATTAGGAGGAGGG + Intronic
1108750365 13:53441734-53441756 CACGGACAACATTCTGAAGAAGG - Intergenic
1108851857 13:54739659-54739681 TATGAAAAAAATACTGAAGATGG - Intergenic
1109075179 13:57824745-57824767 CCAGGAGGAAATTCTGAGGAGGG - Intergenic
1110069653 13:71158254-71158276 GATGAAAAATATTCTGTGGATGG + Intergenic
1110447798 13:75606715-75606737 CATGGATAATATATTGAGGATGG + Intergenic
1110595693 13:77318290-77318312 CATGGAAAAATTACCGATGATGG - Intronic
1110684950 13:78361298-78361320 CATTGAAAATATTTTTAGGAGGG - Intergenic
1110830654 13:80026625-80026647 CATTTAAAAAAGTCTGATGAAGG - Intergenic
1110875493 13:80504365-80504387 CATGTAAAAAATTCACAGGTTGG + Intergenic
1111020634 13:82444780-82444802 CAAGGAAAAAATCAGGAGGAGGG - Intergenic
1111612149 13:90617984-90618006 GCTGGAATACATTCTGAGGATGG - Intergenic
1112794194 13:103037144-103037166 CATGGAAAAACTTACGAGAAAGG - Intergenic
1112999113 13:105611557-105611579 CATGGAAGAAATTCTCATGCCGG - Intergenic
1113033192 13:106017173-106017195 CAGAGTAAAAATTCTGAGCAAGG + Intergenic
1113102202 13:106732974-106732996 AATGGAAAAAATTGTGATGATGG + Intergenic
1113160412 13:107374078-107374100 CATGGAAAACATGCTAATGAAGG - Intronic
1114321835 14:21553233-21553255 AGTCGAAAAATTTCTGAGGAAGG + Intergenic
1116323766 14:43503744-43503766 AATGCAAAAAAATCTGAGTATGG + Intergenic
1117279404 14:54223036-54223058 GATGAAAAAAATTCTGGAGATGG + Intergenic
1117819421 14:59632320-59632342 AATGAAAAAAATTGGGAGGAGGG - Intronic
1119693647 14:76695785-76695807 CAGGGAAGAAACCCTGAGGAGGG - Intergenic
1119881402 14:78102802-78102824 GATGGAAAAAGTGCTGTGGATGG + Intergenic
1120313137 14:82856985-82857007 CATGTAAGAATTTCTTAGGATGG + Intergenic
1121881466 14:97504237-97504259 CATGTCATAAATTCTGAAGAGGG - Intergenic
1122248638 14:100422650-100422672 CACGGAACAAATACTCAGGAGGG - Intronic
1124433459 15:29627583-29627605 AATGAAAAAAATTCTGGAGATGG - Intergenic
1124973133 15:34509888-34509910 CAAGGAAGAAATTCTAGGGAAGG - Intergenic
1126993165 15:54407317-54407339 CAAAGAAAAAATTCCCAGGAGGG + Intronic
1127337274 15:58000435-58000457 AATGGCAAAAATTATGAAGATGG - Intronic
1127399011 15:58566611-58566633 CATGGAAGAAATTCAGTGGAAGG + Intronic
1128203571 15:65830682-65830704 CATGGAAGATCCTCTGAGGAAGG - Intronic
1128308343 15:66614675-66614697 CATGGAGATAGTTCAGAGGAGGG + Intronic
1128466855 15:67919899-67919921 CATGTAGAAAATTCTGAGAGAGG - Intergenic
1129483962 15:75850693-75850715 CAAGGAAAGAATTCTAAGGAAGG + Intronic
1129526036 15:76215056-76215078 AATGGAAAAAATCTTGAGCAAGG + Intronic
1130264238 15:82384798-82384820 CAGGGAAGAAATTCTAGGGAAGG + Intergenic
1130276777 15:82482834-82482856 CAAGGAAGAAATTCTAGGGAAGG - Intergenic
1130469142 15:84210198-84210220 CAAGGAAGAAATTCTAGGGAAGG - Intergenic
1130474497 15:84252044-84252066 CAAGGAAGAAATTCTAGGGAAGG + Intergenic
1130476632 15:84324754-84324776 CAAGGAAGAAATTCTAGGGAAGG - Intergenic
1130481912 15:84366092-84366114 CAAGGAAGAAATTCTAGGGAAGG + Intergenic
1130495133 15:84463376-84463398 CAAGGAAGAAATTCTAGGGAAGG + Intergenic
1130508123 15:84565967-84565989 CAAGGAAGAAATTCTAGGGAAGG - Intergenic
1130591435 15:85214809-85214831 CAAGGAAGAAATTCTAGGGAAGG - Intergenic
1130818159 15:87463000-87463022 AAAGGAATAAATTCTGAGAAAGG - Intergenic
1131208567 15:90473319-90473341 CCTGGAAAGAATTCTGAGTTAGG + Intronic
1133449401 16:5891145-5891167 CAAAGAAAAAATCCTAAGGAGGG - Intergenic
1133626290 16:7573447-7573469 CATGCAGAAAATTCAGAGAATGG - Intronic
1134045329 16:11096927-11096949 CTAGGAAAAAATCCTTAGGATGG + Intronic
1134600108 16:15527169-15527191 GATGAAAAAAATTCTGGGGAGGG - Intronic
1134856379 16:17523342-17523364 CATGTATAAGATGCTGAGGAGGG + Intergenic
1135843929 16:25901249-25901271 CATGTAAAAATGTCTGAGAATGG + Intronic
1139681460 16:68567486-68567508 CTTGGAAAAAATTCTGGCAAAGG - Intronic
1140028906 16:71318340-71318362 CATGAATAAAATTCTAGGGAAGG - Intergenic
1140850264 16:78928623-78928645 AATGAAAGAAATTCTGAGAAGGG + Intronic
1141148038 16:81545705-81545727 TTTGGAAACAATGCTGAGGAGGG - Intronic
1142111504 16:88334278-88334300 TTTGAAAAAAATTCTGGGGATGG + Intergenic
1145192839 17:20861157-20861179 CATGGACAGGATGCTGAGGAGGG - Intronic
1145319026 17:21752339-21752361 GATGGAAAGAATTCTGGAGATGG + Intergenic
1145403255 17:22563155-22563177 CATGGACAGGATGCTGAGGAGGG - Intergenic
1148568726 17:48649202-48649224 AATAGAAAAAATTCTGGGGCCGG - Intergenic
1148590702 17:48814662-48814684 TTTGGAAAAAACTCAGAGGAGGG + Intronic
1148957140 17:51363290-51363312 CAAAGAAAAAATTCAAAGGATGG - Intergenic
1149041250 17:52191539-52191561 CATAGGTAAAATTCTGAGAAGGG - Intergenic
1149570342 17:57667750-57667772 CATGGTGTAAATTCTGGGGATGG - Intronic
1149752532 17:59159729-59159751 CATGGAAACATTTCAGAGAAAGG - Intronic
1149953411 17:61017447-61017469 CAGAGAAACAATTTTGAGGATGG - Intronic
1150296889 17:64015167-64015189 GATGGAAAAATTTCTGGAGATGG + Intronic
1151081151 17:71330349-71330371 CTAGGAAAAAAGTATGAGGAAGG + Intergenic
1155184527 18:23375630-23375652 CCTGGAATAAATACTGAGCAAGG + Intronic
1155568996 18:27169438-27169460 CATTTAAAAAATGCTGACGATGG - Intronic
1155997177 18:32342463-32342485 CAGGGAAAAAAGTCACAGGACGG - Intronic
1156163061 18:34383557-34383579 CATGGACATAATTCCAAGGAAGG - Intergenic
1156168251 18:34450068-34450090 ATTGGAAAAAATTATGTGGAGGG + Intergenic
1156300767 18:35834067-35834089 GCTGGAAAAGATTCTGAGCATGG - Intergenic
1158704890 18:59783445-59783467 CATTGAAAGAATGCTGGGGATGG + Intergenic
1159179968 18:64890160-64890182 CCTGCAAGATATTCTGAGGATGG + Intergenic
1159604669 18:70462660-70462682 CAGGGAAACAATTCTTGGGAGGG - Intergenic
1161799383 19:6407826-6407848 CAAGGAAAAAATTCTGGGCTGGG + Intergenic
1163959161 19:20671135-20671157 CATGGTGAAGTTTCTGAGGATGG - Intronic
1165478151 19:36044266-36044288 TATGGAAAACATTGTGAAGATGG - Intronic
1166511274 19:43410500-43410522 CATGGAAAAAATTCTGAGGATGG + Intronic
1167064032 19:47170808-47170830 CAGAGAAAGAATTCTGAAGAGGG - Intronic
1167802057 19:51749999-51750021 CATAGTAACAATTTTGAGGAAGG - Intronic
1167976194 19:53227931-53227953 AATGGAGAAAATTGTCAGGATGG - Intergenic
924990809 2:311305-311327 ACTGGAAAAAATACTCAGGAGGG - Intergenic
925732029 2:6926127-6926149 AAAGGAAAACATGCTGAGGATGG - Intronic
928482052 2:31692902-31692924 CTTGGAAAACCTCCTGAGGATGG - Intergenic
929708732 2:44244099-44244121 CATTTAAAATATACTGAGGAGGG - Intronic
931458440 2:62430608-62430630 GATGAAAAGAATTCTGTGGATGG + Intergenic
932074758 2:68652448-68652470 CATGGCACTAATTCTGCGGATGG + Intronic
933837374 2:86256734-86256756 CATGGAAATAATTGTCACGAAGG - Intronic
935866660 2:107394397-107394419 CAAGGAAATAATTGTGAGCAAGG + Intergenic
936004463 2:108870867-108870889 GATGGAAAAAACTCTGGAGATGG + Intronic
936006657 2:108894924-108894946 CGCTGAAAACATTCTGAGGAGGG + Exonic
936416362 2:112317538-112317560 TTTGGAAAAAATTCTGTGAAGGG + Intronic
937627208 2:124056903-124056925 CTTGGAGAAAATGCTGAGAATGG - Intronic
937936314 2:127248378-127248400 CATGGTAACAATACTGATGATGG + Intergenic
938281337 2:130065655-130065677 CTTGGAACAAATTCTGAGTCTGG + Intergenic
939262336 2:139826925-139826947 CTGAGAAAAAATTCTCAGGAGGG - Intergenic
939413872 2:141866935-141866957 CATGGCAAAAACTCTGAGTTTGG - Intronic
939441400 2:142254971-142254993 CAAAGAGAAAATTCTGAGGATGG + Intergenic
940718708 2:157258217-157258239 CAAGGAAGACATTGTGAGGAGGG + Exonic
940761421 2:157742959-157742981 GATGGAAAACATGCAGAGGAGGG - Intronic
940920913 2:159305640-159305662 GATGAAAAGAATTCTGGGGATGG + Intergenic
941377037 2:164744394-164744416 GAAGGAAGAAATTCTGTGGAAGG - Intronic
941560571 2:167039443-167039465 CAAGGAAACAATTTTGAGGCAGG + Intronic
942290439 2:174464403-174464425 TATGGCAAAAATTGTGAGGATGG + Intronic
943624600 2:190184597-190184619 CAAGAACAGAATTCTGAGGAAGG + Intronic
944003791 2:194876875-194876897 CAAGGAAAAGCTTCTGAAGAAGG - Intergenic
945459926 2:210094107-210094129 AATAAAAAAAATTCTGAAGATGG + Intronic
946217307 2:218194514-218194536 CATGGCAAAAATGCTGAAGGTGG - Intergenic
947873500 2:233453020-233453042 CAAGGAAAAAAGCCTCAGGAGGG - Intronic
948271043 2:236673515-236673537 GATGGAAAACATTCAGAGCAGGG + Intergenic
1169690904 20:8330721-8330743 CATGTAACAGATTCTGAAGATGG + Intronic
1173566787 20:44045161-44045183 AATGGAAAGAATTCTGCAGACGG + Intronic
1174430184 20:50462359-50462381 CATGGAAAGACTTCTGTGAAAGG + Intergenic
1174556252 20:51397639-51397661 GATGCAAAAAGTCCTGAGGAGGG + Intronic
1175281260 20:57805445-57805467 GATGGACAAGATACTGAGGATGG - Intergenic
1177016131 21:15789692-15789714 CATGGAATAAGTTCTGGGAAAGG - Intronic
1179563523 21:42232153-42232175 CTTTGAAAAAATTTTGAGAATGG + Intronic
1180120967 21:45747830-45747852 CAAGGAGAAAACTCAGAGGAGGG - Intronic
1180750296 22:18119789-18119811 CGTGGAAGAAATTCTGGGCATGG - Intronic
1181140057 22:20797782-20797804 CATGGAGAGAATCCAGAGGAAGG + Intronic
1185178157 22:49342666-49342688 CATTGAAAAACTTCTGCGTAGGG + Intergenic
950607317 3:14094236-14094258 CATGGAAGAAATTCTGAAAGAGG + Intergenic
950900635 3:16494093-16494115 CATTTAAAAAAATCTCAGGACGG - Intronic
951834542 3:26967600-26967622 CATGGCTAAAATTCAGAAGATGG - Intergenic
953399265 3:42598788-42598810 GATGGAAAATGTTCTGTGGACGG + Intronic
953475078 3:43198676-43198698 CATGGATAACATTTTGAGAAGGG + Intergenic
953980122 3:47409407-47409429 CCTCGAACAACTTCTGAGGAAGG - Exonic
954048912 3:47956804-47956826 CATGGAAAAAATCATCATGAAGG + Intronic
955065557 3:55531031-55531053 CTTGGAAAAAAATCAGAGAAGGG - Intronic
955362088 3:58284310-58284332 TATTGAAAAGATTCTGGGGAGGG - Intronic
955553517 3:60110326-60110348 CATGGAAGAAATTTTCAAGATGG - Intronic
955742554 3:62107546-62107568 CATGGAAAAAAATCTCCAGAGGG - Intronic
956656051 3:71551823-71551845 CATGGAAAGAATTTAAAGGATGG + Intronic
958613866 3:96464864-96464886 CATTTAAAATTTTCTGAGGAAGG + Intergenic
958827767 3:99052547-99052569 CATGGAAATAATTATAAGCAAGG - Intergenic
958959600 3:100496293-100496315 CATGGAGAACGTTCTGATGATGG + Intronic
959693701 3:109226826-109226848 CATGGGAAAAATTGTAAGAAGGG - Intergenic
959836335 3:110922797-110922819 CATGGAAACAAATCTCATGAAGG - Intergenic
960390853 3:117075923-117075945 CAGGGAAAAAAACATGAGGATGG - Intronic
960713851 3:120557045-120557067 GATGGAAAAATTTCTTAGGTAGG - Intergenic
960825129 3:121774791-121774813 GATGAAAAAAGTTCTGAAGATGG + Intronic
962046524 3:131765812-131765834 CAAGGAAAAACTTATGATGAAGG + Intronic
962111808 3:132458667-132458689 CAGGGAAAGAATTCTGAGCAGGG - Intronic
963304257 3:143632846-143632868 CATGGACACAATTCTGAGCAGGG + Intronic
963492923 3:146023562-146023584 CCTGGAAAGAAATCTGAAGACGG + Intergenic
963571825 3:147007946-147007968 CATGGAAAACATTCCTAAGAAGG - Intergenic
965273273 3:166646896-166646918 CGTGGAAAAATCTCTGAGAAGGG + Intergenic
965332769 3:167397446-167397468 CATGAAAAAAATTATCAGAATGG + Intergenic
967037522 3:185658924-185658946 AATGGAAAGAATCCTGAGAAGGG + Intronic
967308716 3:188085642-188085664 CATGGCAATAATTCGGAGGCTGG + Intergenic
967473138 3:189886358-189886380 CATGGAAATAATGGTGAGCAAGG - Intronic
969501302 4:7555025-7555047 CCTGGCAAAACTCCTGAGGATGG + Intronic
970945770 4:21689859-21689881 CATGTAATAATGTCTGAGGATGG - Intronic
971455051 4:26836368-26836390 CATGGACAAAATTGAGAAGAGGG + Intergenic
971785802 4:31100695-31100717 AATGGAAAAAATCCTAAAGAGGG - Intronic
972147628 4:36047405-36047427 TATGGACAAAATTATGAAGACGG - Intronic
972372773 4:38440818-38440840 TATGGCAAAAATTATGAGGGTGG - Intergenic
972620336 4:40742068-40742090 CCTGGAAAACATTCTGTGTATGG - Intergenic
972788748 4:42350557-42350579 CATTTAAAAAATTTTTAGGATGG - Intergenic
973076676 4:45936615-45936637 CATGGAAAAAATTGTGATAGAGG - Intergenic
974356450 4:60818946-60818968 CATGGAAAAATAAATGAGGAAGG - Intergenic
975270677 4:72428990-72429012 CATGGAAAAGTCTCTGAGGTTGG - Intronic
975650415 4:76587354-76587376 CATTGAAAACATTCTGAAAATGG + Intronic
975712936 4:77178647-77178669 AATGTAAAAAATCCTGTGGAAGG + Intronic
976750056 4:88444506-88444528 GAGAGAAAAAGTTCTGAGGAGGG - Intergenic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
977135492 4:93298634-93298656 GTTGGAGTAAATTCTGAGGATGG - Intronic
979003840 4:115262587-115262609 CATGGAAAAAATCAGGAGGCTGG + Intergenic
979405752 4:120309079-120309101 TATGAAACAAATTCTGAGAAGGG + Intergenic
980025771 4:127764623-127764645 CATGGAAAAAAATCTAGGAAGGG - Intronic
980459588 4:133090556-133090578 AATGGAAAAAAGTCTGGGCATGG + Intergenic
980884248 4:138744958-138744980 CACTGAAAAAAATCTGATGACGG + Intergenic
981237264 4:142434001-142434023 CATGTAAAAAATTGTAATGAGGG + Intronic
981430427 4:144651831-144651853 CATTGTAAAAATTGTGATGAAGG + Intronic
983214251 4:164988106-164988128 CATGGAAAAAATATTAAAGAAGG - Intergenic
983813806 4:172097618-172097640 TAAAGCAAAAATTCTGAGGATGG + Intronic
984076503 4:175188115-175188137 CATAGCAAAACTACTGAGGAAGG + Intergenic
984145254 4:176052661-176052683 CTTGAGAAACATTCTGAGGAAGG - Intergenic
984523838 4:180832557-180832579 GATGCAGAAAATTCTGAGTAAGG + Intergenic
985428358 4:189853705-189853727 CAAAGAAAAAATTCTGAGAGTGG - Intergenic
986241936 5:5968008-5968030 CATGTAAAGAATTTTGAGTAAGG + Intergenic
990752684 5:59035088-59035110 CATGGAAAGTATATTGAGGATGG - Intronic
990907845 5:60822824-60822846 AGTGGGAAAAATTCTGAAGAGGG + Intronic
991079192 5:62577463-62577485 CTTGGGAAAAATTCAGAGAAAGG - Intronic
991472886 5:66988073-66988095 AATGGAAATAATTCAGAGGATGG - Intronic
992124146 5:73624739-73624761 AATAGAAAAAATTTTGAGCAGGG - Intergenic
992301274 5:75383388-75383410 CATGGAAAACAATCTGCTGAAGG - Intronic
992610486 5:78504321-78504343 CAGGAGAAAAATTCTGAGGCAGG + Intronic
992679223 5:79136456-79136478 GATGTAAACAATTTTGAGGAAGG - Intronic
993469175 5:88285910-88285932 CTTGCAAAAAATGCTAAGGAAGG + Intergenic
993489912 5:88534426-88534448 GATGAAAAAAGTTCTGTGGATGG + Intergenic
993834756 5:92805155-92805177 TATGGAGAAAATTCTGATAAAGG - Intergenic
993959779 5:94282912-94282934 GGTGTAAAAAATTCTGAGGGTGG + Intronic
994682979 5:102912445-102912467 AATGGAAAAAGTCCTGAGGTAGG - Intronic
994946152 5:106394714-106394736 GATGGAAAAAGTTCTGGAGATGG - Intergenic
997014572 5:129917795-129917817 CTTTGAAAAAATTCTGATGCTGG + Intronic
997662001 5:135596398-135596420 CAAGGAAAAATCTCTGGGGAAGG + Intergenic
998233056 5:140373830-140373852 GAGGGAAAATATTCTAAGGAAGG + Intronic
999121907 5:149216191-149216213 CATGGCAAAAATTGTGAGACTGG - Intronic
1000527563 5:162377405-162377427 CATGGAAAAATTTGGGATGAGGG + Intergenic
1001631790 5:173180810-173180832 AACTGAAAAAATTCTGAAGAAGG + Intergenic
1003408404 6:5841600-5841622 CATGGAAAAAGCTCTGAGGCAGG - Intergenic
1003634902 6:7823105-7823127 CATGGAAAATGTTCTGAGTTGGG + Intronic
1003811531 6:9788428-9788450 GATGAAAAAAATTCTGGAGATGG + Intronic
1003962487 6:11221635-11221657 GATGGAGAAGATTCTCAGGAAGG - Intronic
1004995992 6:21193668-21193690 AAGGGAAAAAAGTCTGAAGAGGG - Intronic
1005382272 6:25248262-25248284 CATGGAATAATTTCTCAGGCAGG - Intergenic
1005641647 6:27801998-27802020 CATGGAAACATTGCAGAGGAAGG + Intergenic
1006970240 6:38036274-38036296 CAAGGAAAAAAATCTGAGCAGGG + Intronic
1007239456 6:40414490-40414512 CATGGAATAATTTCTCAGAAAGG + Intronic
1007580302 6:42954793-42954815 CATGGCAAAACTGCTGACGAGGG + Intergenic
1007929945 6:45681374-45681396 GATGGAAAAAGTTCTGAAGATGG + Intergenic
1008147703 6:47911645-47911667 CATGGAAAGGGCTCTGAGGATGG + Intronic
1008152520 6:47971692-47971714 CATGGAGTGCATTCTGAGGAAGG - Intronic
1008656940 6:53624697-53624719 CAGGGACATAATTCTGAGGTGGG + Intergenic
1010593536 6:77737587-77737609 CATGGAGACCTTTCTGAGGAAGG + Intronic
1010676789 6:78754511-78754533 CATGGAAATAATTCTCAAGATGG + Intergenic
1012431585 6:99169774-99169796 CATGGAAAAATTTCTAAGTTGGG + Intergenic
1012522258 6:100135887-100135909 AATGAAAAAAGTTCTGAAGATGG + Intergenic
1012610247 6:101209376-101209398 CTTGGAAATATATCTGAGGAAGG - Intergenic
1012935745 6:105365432-105365454 CATGAAAAAAATCTTGAGGTGGG - Intronic
1013570432 6:111418786-111418808 CATGGCAAAAACTCTTAGGGAGG + Intronic
1014924036 6:127249442-127249464 CATGCAAAAAAATCTCAGTAGGG - Intergenic
1017132441 6:151119243-151119265 GATGGAAAAAGTTCTGGAGATGG + Intergenic
1017438544 6:154441164-154441186 GATGGAAAAAAAACTGAGGTGGG + Intronic
1017512439 6:155126361-155126383 GATGGAAAGAGTTCTGAAGATGG + Intronic
1018055157 6:160045973-160045995 CATGAATAAAATTCTAAGGCGGG - Intronic
1018070468 6:160160509-160160531 CTTGGCAAAACTTCTGAGGAAGG + Intergenic
1018165921 6:161096328-161096350 CATTAAAAAAATACTAAGGAGGG + Intronic
1018773651 6:166994535-166994557 CAAGGTGAAAATTATGAGGACGG - Intergenic
1019709844 7:2513174-2513196 CATGGAGCAAATGCTCAGGAAGG + Intronic
1020126275 7:5534057-5534079 CAGGTGATAAATTCTGAGGAGGG - Intronic
1020776950 7:12466371-12466393 CAACGAAACAATTCTCAGGAAGG + Intergenic
1021127851 7:16874332-16874354 CATGGAAAAAATTCTTGTGTGGG + Intronic
1021898181 7:25257186-25257208 AATAAAAAAAATTCTGATGAAGG - Intergenic
1023343598 7:39248581-39248603 CATGGATAAAATTCTTAGGTGGG + Intronic
1023501666 7:40857152-40857174 CATCTAAAAAATTATGAGCAAGG - Intronic
1023723709 7:43120583-43120605 CATAGAGAAAGTTCTGAGGTTGG - Intronic
1024102547 7:46047628-46047650 CATGGAATAAATTCAGAAAAGGG - Intergenic
1024515327 7:50247863-50247885 GATCAAAAAAATTCTGAGGATGG + Intergenic
1026146420 7:67750435-67750457 CATGGTTAAAATTCTGAGTGCGG + Intergenic
1027277325 7:76571736-76571758 AATGAAAGAAATTCTGAGCAAGG + Intergenic
1027794757 7:82678687-82678709 GAGGAAAAAAATGCTGAGGATGG - Intergenic
1028674271 7:93441203-93441225 CATGAAAAATTTTCTGAGTATGG + Intronic
1029295810 7:99539584-99539606 AGTGGAAAAAATACTGAGCAAGG - Intergenic
1029337048 7:99910080-99910102 GATTGAAAAAATGCTGAAGACGG + Intronic
1029588196 7:101488748-101488770 CAATGAAAAAGTTCTGAAGATGG - Intronic
1029993631 7:104984950-104984972 CATGTAAAACATTCTGAGATGGG + Intergenic
1030505436 7:110416366-110416388 GATGGGAAAAATTCAGAGGTAGG - Intergenic
1031115956 7:117668930-117668952 CAAGAAAAAAATTCTGTGGAAGG - Intronic
1031467107 7:122126251-122126273 CATGGAAAAAATTAAAATGAAGG - Intronic
1034358654 7:150474574-150474596 CCTGGAAAAAATTGAGAGCATGG + Exonic
1035286905 7:157812419-157812441 AAAGGAGAGAATTCTGAGGAGGG + Intronic
1035296559 7:157870676-157870698 TATGGAAGAGATTCTGAAGAAGG - Intronic
1036424974 8:8636627-8636649 CTTGGTAAAAAATGTGAGGAAGG - Intergenic
1037529894 8:19762863-19762885 CAGGGAAAATAGCCTGAGGAAGG + Intergenic
1037530151 8:19765045-19765067 CATGTATACAATTCTGAGGCGGG + Intergenic
1037955971 8:23058980-23059002 GATGAAATAACTTCTGAGGATGG - Intronic
1038038334 8:23704712-23704734 AAGAGGAAAAATTCTGAGGAGGG + Intronic
1038175721 8:25180947-25180969 CATGGAGAAGTTGCTGAGGAAGG + Intergenic
1042077588 8:65013432-65013454 AATGGTAAAAATTGTGAAGATGG - Intergenic
1042632927 8:70840588-70840610 CATAAAAAGAAGTCTGAGGATGG - Intergenic
1043934737 8:86130416-86130438 CATAGAAAAAATTGAGATGATGG - Intronic
1044968585 8:97597756-97597778 GGTGAAAAAAATTCTGATGATGG + Intergenic
1045080708 8:98623138-98623160 CATGGAACATATTGTGAGGGAGG + Intronic
1046103013 8:109636091-109636113 CATGGAAGAAGTTCTGAGCATGG + Intronic
1046287666 8:112115800-112115822 CCTAGAAAAAATTCTGTAGATGG - Intergenic
1046300344 8:112278101-112278123 TATGGAACCAATTCTGGGGAGGG + Intronic
1046381995 8:113463530-113463552 CAGGGAAAACATTCTGGAGAAGG + Intergenic
1046566937 8:115914004-115914026 CAGGGAAGAAAATCTGAGGTAGG - Intergenic
1046922671 8:119749492-119749514 CATGGAATAAAATCTTAAGATGG + Intronic
1046942594 8:119945396-119945418 TATGTAAAAAATACTTAGGAAGG - Intronic
1047067235 8:121298177-121298199 CATGAAAACAATTCTGAATACGG - Intergenic
1047348575 8:124051880-124051902 AAGGGAGAAAATTTTGAGGATGG + Intronic
1047768237 8:128007597-128007619 CATGGGAGAAATTCTGTGAAGGG + Intergenic
1049875210 8:145013351-145013373 TATGGCAAAGATTCTGAGGAAGG - Intergenic
1050185434 9:2967944-2967966 CAATGAAAAAAATCTGGGGAAGG - Intergenic
1050186274 9:2977815-2977837 GATGAAAAAAGTTCTGTGGATGG + Intergenic
1050408845 9:5339940-5339962 GAAGGAGAAAATTCTGTGGAGGG - Intergenic
1050510962 9:6395017-6395039 CATAGAAAAATGTCTGAGAAAGG + Intergenic
1050756802 9:9014665-9014687 CATGGGAGACAATCTGAGGAAGG + Intronic
1050815555 9:9807160-9807182 AATGGAAATAATTCTGCTGAGGG - Intronic
1051144770 9:14015434-14015456 CATGGAAAAAGGTCAGATGAAGG - Intergenic
1053246282 9:36537076-36537098 CATGGAATAAATGCTTAGAAAGG + Intergenic
1053548156 9:39045521-39045543 GATGAAAAAAATTCTGGAGATGG - Intergenic
1053812278 9:41865559-41865581 GATGAAAAAAATTCTGGAGATGG - Intergenic
1054618317 9:67321880-67321902 GATGAAAAAAATTCTGGAGATGG + Intergenic
1055362164 9:75503974-75503996 CATCTGAAAAATTATGAGGAGGG - Intergenic
1056263858 9:84876645-84876667 TATGGAAAAAAATGGGAGGATGG - Intronic
1057456260 9:95214886-95214908 TATGAAAAGAGTTCTGAGGATGG + Intronic
1059177270 9:112178839-112178861 GATGAAAAAAGTTCTGTGGATGG + Intergenic
1059371559 9:113843777-113843799 CATAAAAAAACTTCTGAGGCTGG + Intergenic
1060061947 9:120468559-120468581 CCTTGCAAAAATCCTGAGGAGGG + Intronic
1060098573 9:120816269-120816291 GATGAAAATAATTCTGAAGATGG + Exonic
1060767277 9:126304366-126304388 CTTGGAAAAAGTTCTGAGTAGGG + Intergenic
1186787531 X:12967800-12967822 CATTGACATAATTCTGAGAAAGG + Intergenic
1187190507 X:17030552-17030574 CATGGAATACCTTCTGGGGATGG + Intronic
1188111162 X:26197497-26197519 CAAGGTAAAGATGCTGAGGAAGG + Intergenic
1188951796 X:36384913-36384935 CACGGACAAAATTATGTGGACGG - Exonic
1189717295 X:43880038-43880060 CATATAAAAAATTCTAGGGAAGG - Intronic
1190505656 X:51123718-51123740 CATGGAAAAATCTGTGAGTATGG + Intergenic
1190738224 X:53269724-53269746 CATGGAAGCTGTTCTGAGGAAGG + Intronic
1192144015 X:68668767-68668789 GATGGCAAAAATTCTGAAGTTGG - Intronic
1194646186 X:96460997-96461019 CTTTGAACAAATTCTGAGGGTGG - Intergenic
1195024802 X:100865922-100865944 CATGGAAAGATATCTGAGGCTGG + Intronic
1195151128 X:102071567-102071589 CTGAGAAAATATTCTGAGGAAGG + Intergenic
1195696869 X:107673994-107674016 CATGGGAAACCTTCAGAGGAAGG + Intergenic
1196863064 X:120045605-120045627 CATGGAGAAAGTTCTAAAGAGGG + Intergenic
1196880038 X:120190739-120190761 CATGGAGAAAGTTCTAAAGAGGG - Intergenic
1197098172 X:122620414-122620436 CCTGGATAATATTCTGAAGAGGG + Intergenic
1198040642 X:132848285-132848307 CATGGAGACAGTGCTGAGGAAGG - Intronic
1202376493 Y:24242823-24242845 CAAGGAAGAAATTCTAGGGAAGG - Intergenic
1202494287 Y:25427296-25427318 CAAGGAAGAAATTCTAGGGAAGG + Intergenic