ID: 1166513337

View in Genome Browser
Species Human (GRCh38)
Location 19:43426206-43426228
Sequence GTGTGGATTAATGCAAATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166513337_1166513340 2 Left 1166513337 19:43426206-43426228 CCTTAATTTGCATTAATCCACAC No data
Right 1166513340 19:43426231-43426253 TAATTTGCATGTAATTGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166513337 Original CRISPR GTGTGGATTAATGCAAATTA AGG (reversed) Intergenic
No off target data available for this crispr