ID: 1166519538

View in Genome Browser
Species Human (GRCh38)
Location 19:43471236-43471258
Sequence CTGAAACTCTCCCACACAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166519538_1166519548 21 Left 1166519538 19:43471236-43471258 CCAGCTGTGTGGGAGAGTTTCAG No data
Right 1166519548 19:43471280-43471302 ACCAGAAGAACTAGCATCTCGGG No data
1166519538_1166519542 -6 Left 1166519538 19:43471236-43471258 CCAGCTGTGTGGGAGAGTTTCAG No data
Right 1166519542 19:43471253-43471275 TTTCAGGGAGGAACCCCAACTGG No data
1166519538_1166519551 25 Left 1166519538 19:43471236-43471258 CCAGCTGTGTGGGAGAGTTTCAG No data
Right 1166519551 19:43471284-43471306 GAAGAACTAGCATCTCGGGAGGG No data
1166519538_1166519550 24 Left 1166519538 19:43471236-43471258 CCAGCTGTGTGGGAGAGTTTCAG No data
Right 1166519550 19:43471283-43471305 AGAAGAACTAGCATCTCGGGAGG No data
1166519538_1166519547 20 Left 1166519538 19:43471236-43471258 CCAGCTGTGTGGGAGAGTTTCAG No data
Right 1166519547 19:43471279-43471301 GACCAGAAGAACTAGCATCTCGG No data
1166519538_1166519552 30 Left 1166519538 19:43471236-43471258 CCAGCTGTGTGGGAGAGTTTCAG No data
Right 1166519552 19:43471289-43471311 ACTAGCATCTCGGGAGGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166519538 Original CRISPR CTGAAACTCTCCCACACAGC TGG (reversed) Intergenic
No off target data available for this crispr