ID: 1166520180

View in Genome Browser
Species Human (GRCh38)
Location 19:43475008-43475030
Sequence GTGGGACGCGTGGCTCCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 116}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166520174_1166520180 -3 Left 1166520174 19:43474988-43475010 CCATTCCTAGAGAGCCGGCTGTG 0: 1
1: 0
2: 1
3: 14
4: 105
Right 1166520180 19:43475008-43475030 GTGGGACGCGTGGCTCCCAGAGG 0: 1
1: 0
2: 0
3: 7
4: 116
1166520168_1166520180 27 Left 1166520168 19:43474958-43474980 CCCAGCTATGACCTTAAGAGTTG 0: 1
1: 0
2: 0
3: 4
4: 96
Right 1166520180 19:43475008-43475030 GTGGGACGCGTGGCTCCCAGAGG 0: 1
1: 0
2: 0
3: 7
4: 116
1166520171_1166520180 16 Left 1166520171 19:43474969-43474991 CCTTAAGAGTTGAAGGCCTCCAT 0: 1
1: 0
2: 0
3: 7
4: 107
Right 1166520180 19:43475008-43475030 GTGGGACGCGTGGCTCCCAGAGG 0: 1
1: 0
2: 0
3: 7
4: 116
1166520177_1166520180 -8 Left 1166520177 19:43474993-43475015 CCTAGAGAGCCGGCTGTGGGACG 0: 1
1: 0
2: 1
3: 7
4: 105
Right 1166520180 19:43475008-43475030 GTGGGACGCGTGGCTCCCAGAGG 0: 1
1: 0
2: 0
3: 7
4: 116
1166520173_1166520180 0 Left 1166520173 19:43474985-43475007 CCTCCATTCCTAGAGAGCCGGCT 0: 1
1: 0
2: 0
3: 4
4: 69
Right 1166520180 19:43475008-43475030 GTGGGACGCGTGGCTCCCAGAGG 0: 1
1: 0
2: 0
3: 7
4: 116
1166520169_1166520180 26 Left 1166520169 19:43474959-43474981 CCAGCTATGACCTTAAGAGTTGA 0: 1
1: 0
2: 0
3: 4
4: 61
Right 1166520180 19:43475008-43475030 GTGGGACGCGTGGCTCCCAGAGG 0: 1
1: 0
2: 0
3: 7
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166520180 Original CRISPR GTGGGACGCGTGGCTCCCAG AGG Intronic