ID: 1166529357

View in Genome Browser
Species Human (GRCh38)
Location 19:43533487-43533509
Sequence GGAAGCCCCGCCCCCGGGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 240}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166529351_1166529357 -6 Left 1166529351 19:43533470-43533492 CCGTGGCGGGAGGAGCCGGAAGC 0: 1
1: 0
2: 1
3: 9
4: 144
Right 1166529357 19:43533487-43533509 GGAAGCCCCGCCCCCGGGGAGGG 0: 1
1: 0
2: 1
3: 32
4: 240
1166529349_1166529357 0 Left 1166529349 19:43533464-43533486 CCGTGGCCGTGGCGGGAGGAGCC 0: 1
1: 0
2: 1
3: 20
4: 190
Right 1166529357 19:43533487-43533509 GGAAGCCCCGCCCCCGGGGAGGG 0: 1
1: 0
2: 1
3: 32
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166529357 Original CRISPR GGAAGCCCCGCCCCCGGGGA GGG Exonic