ID: 1166531718

View in Genome Browser
Species Human (GRCh38)
Location 19:43546860-43546882
Sequence TCTGATGCCCCCTGTCCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 135}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166531718_1166531721 -5 Left 1166531718 19:43546860-43546882 CCCACTGGACAGGGGGCATCAGA 0: 1
1: 0
2: 0
3: 13
4: 135
Right 1166531721 19:43546878-43546900 TCAGACCTTCTGAGGAAGCTTGG 0: 1
1: 0
2: 3
3: 10
4: 173
1166531718_1166531722 -4 Left 1166531718 19:43546860-43546882 CCCACTGGACAGGGGGCATCAGA 0: 1
1: 0
2: 0
3: 13
4: 135
Right 1166531722 19:43546879-43546901 CAGACCTTCTGAGGAAGCTTGGG 0: 1
1: 0
2: 0
3: 6
4: 200
1166531718_1166531724 -2 Left 1166531718 19:43546860-43546882 CCCACTGGACAGGGGGCATCAGA 0: 1
1: 0
2: 0
3: 13
4: 135
Right 1166531724 19:43546881-43546903 GACCTTCTGAGGAAGCTTGGGGG 0: 1
1: 0
2: 0
3: 10
4: 141
1166531718_1166531723 -3 Left 1166531718 19:43546860-43546882 CCCACTGGACAGGGGGCATCAGA 0: 1
1: 0
2: 0
3: 13
4: 135
Right 1166531723 19:43546880-43546902 AGACCTTCTGAGGAAGCTTGGGG 0: 1
1: 0
2: 0
3: 22
4: 148
1166531718_1166531726 28 Left 1166531718 19:43546860-43546882 CCCACTGGACAGGGGGCATCAGA 0: 1
1: 0
2: 0
3: 13
4: 135
Right 1166531726 19:43546911-43546933 TCCGCTGCCACCGCTGTGAGAGG 0: 1
1: 0
2: 1
3: 8
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166531718 Original CRISPR TCTGATGCCCCCTGTCCAGT GGG (reversed) Intronic
900217148 1:1487628-1487650 TCTGTTGCCCCCTGTGTAGTTGG + Intronic
900271818 1:1794105-1794127 TCTGATGCTTCCTTCCCAGTGGG - Intronic
901230877 1:7641200-7641222 TCTCCTGCCCCCTGTTCAGCGGG + Intronic
901646340 1:10718708-10718730 TCTGCTGCCCACTCCCCAGTGGG - Intronic
901764681 1:11492255-11492277 TCTGGTGTCCCCTCTCTAGTGGG - Intronic
902078112 1:13803394-13803416 CCTGGTGCTCCCAGTCCAGTGGG + Intronic
903304599 1:22403935-22403957 CCTGGTGCTCCCGGTCCAGTGGG + Intergenic
904409467 1:30316547-30316569 CCTGAGGCCCTCAGTCCAGTGGG + Intergenic
904762875 1:32817964-32817986 TCTGCAGTCCCCTGCCCAGTGGG + Exonic
904854003 1:33481834-33481856 TCAGATGCCCCCTCTCCATCAGG + Intronic
905228089 1:36492979-36493001 TCTGAGGCCCCCTTTCCCATCGG + Intergenic
905259335 1:36706429-36706451 TCTGCTGCCCCCTCCCCAGTGGG - Intergenic
907519618 1:55014657-55014679 TCTGATGCCACCAGCCCAGCTGG - Intergenic
918639871 1:186826879-186826901 TCTGAAGACCCCTCTCCACTTGG - Intergenic
923301913 1:232649113-232649135 TCTGAAGCTACCTGGCCAGTCGG - Intergenic
1065330995 10:24599358-24599380 TCTGATGCCCTCTGTATAGCGGG + Intronic
1065491696 10:26288816-26288838 TCTGAAGCCTCCTCTCCAGCAGG + Intronic
1068147580 10:53090873-53090895 TCTAATGCCCCATTACCAGTGGG + Intergenic
1069045454 10:63738513-63738535 TCTCAGGGCCCCTGGCCAGTTGG - Intergenic
1069691237 10:70354335-70354357 TCTGATGCCACATGTCTAGGTGG + Intronic
1070400463 10:76049010-76049032 TCAGATGCCCACTGCCCATTTGG + Intronic
1075716983 10:124561457-124561479 TATGATGCTGCCCGTCCAGTGGG - Intronic
1076121013 10:127936541-127936563 TCTGAAGACCCCTGTGGAGTGGG - Intronic
1076375288 10:129979593-129979615 TCTGATGTCCCCTGGGCATTGGG - Intergenic
1076601629 10:131660561-131660583 TCTGAGGCCCCCTGTGAGGTAGG - Intergenic
1077365817 11:2161184-2161206 TCTGATGCAGCCTGTCCTGGAGG + Exonic
1080871544 11:36241130-36241152 CCTGATGGCCTCTGTCTAGTTGG - Intergenic
1082889289 11:58121448-58121470 ACTAATGTCACCTGTCCAGTAGG - Intronic
1083729753 11:64646355-64646377 TCTCATGCCCCCTTTCCAGAAGG + Intronic
1085449695 11:76624455-76624477 TCTGGAGTCCACTGTCCAGTGGG - Intergenic
1085637850 11:78172086-78172108 TTTGAGGACCCCTGCCCAGTGGG + Exonic
1091048790 11:132349406-132349428 TCTGCTGACTCCTGCCCAGTAGG - Intergenic
1093298052 12:17416350-17416372 TTTCATGCCCACTGTTCAGTGGG - Intergenic
1098053801 12:66482189-66482211 CCTGATGCTCCCTGTCCATAAGG + Intronic
1098652616 12:72992083-72992105 GCTGATGGCACCTGTCAAGTAGG - Intergenic
1099392392 12:82097605-82097627 TCTTATGGCCCCTGGCCAGGAGG + Intergenic
1101241784 12:102846423-102846445 TCTGATGACACTTGTCCACTGGG - Intronic
1103344956 12:120243055-120243077 TTTGGTGCCCTGTGTCCAGTTGG - Intronic
1112213291 13:97402925-97402947 TCGCATGCCCCTTGTCCAGTTGG + Intergenic
1112486619 13:99825940-99825962 TCTGTAGCCCTTTGTCCAGTGGG - Intronic
1113595420 13:111528419-111528441 ACTGAGGCCTGCTGTCCAGTGGG + Intergenic
1113595430 13:111528504-111528526 ACTGATGCCCGCTGTCCACCTGG + Intergenic
1118285366 14:64465700-64465722 TCGGATACCCCGTATCCAGTGGG - Intronic
1118388217 14:65274425-65274447 TCTGATCTCCCCTCTCCAGAAGG - Intergenic
1124720633 15:32108447-32108469 TCTGATGCCCCCTGTTCCCGAGG + Intronic
1125510216 15:40288697-40288719 TCTGATGCCCCCATCCCACTGGG - Exonic
1126229806 15:46311494-46311516 TGTGCTGCCCCCTGTTCTGTGGG - Intergenic
1129697336 15:77748095-77748117 TTTGAGGCACCCTCTCCAGTGGG + Intronic
1132783718 16:1642688-1642710 TCTGATGTCAGCTGACCAGTAGG + Intronic
1135801298 16:25499244-25499266 TCTGATTCCCCTTGCACAGTGGG - Intergenic
1136068794 16:27775938-27775960 TCTGTTGCCCCCTCTGCAATGGG - Intronic
1141636779 16:85318102-85318124 TCTGAAGCCTCCTGCCCACTTGG - Intergenic
1141666721 16:85469631-85469653 TCTGAGGCCCCCAGTACTGTGGG + Intergenic
1143161511 17:4874759-4874781 TCTGAATCACCCTTTCCAGTAGG + Intronic
1143662770 17:8336944-8336966 CCTGATGTCACCTGTGCAGTGGG - Intergenic
1147164465 17:38586057-38586079 TCTCAGGCCTTCTGTCCAGTGGG - Intronic
1155504182 18:26516832-26516854 TTTGATGCCCACTGTCCTGAGGG - Intronic
1159556396 18:69950361-69950383 TTTCATGCCCCCAGTCTAGTTGG + Intronic
1161363934 19:3867984-3868006 GTTGCTGCCCCCTGCCCAGTCGG + Intronic
1161624784 19:5320013-5320035 TCAGATGCCTCCTGTCCACCAGG - Intronic
1162520492 19:11176602-11176624 CCTGATGCCCCCTCAGCAGTGGG + Exonic
1162532295 19:11242965-11242987 TCTGATGCCCCTGGCACAGTAGG + Intronic
1163337425 19:16682399-16682421 TCAGAAGCACCCTGTCCTGTAGG + Exonic
1165214920 19:34264117-34264139 TCTGATGCTCCCAGTTCATTTGG + Intronic
1166531718 19:43546860-43546882 TCTGATGCCCCCTGTCCAGTGGG - Intronic
1166620024 19:44289004-44289026 CATGATTCCCCCTGTCAAGTGGG - Exonic
1167815324 19:51875740-51875762 TTTGATGGCCCCTGCCCAGAGGG + Intronic
926487262 2:13477562-13477584 TTTGATCCCCCATGGCCAGTGGG + Intergenic
929235489 2:39601158-39601180 TCTGATGCACACTCCCCAGTAGG + Intergenic
930870919 2:56170030-56170052 TTGGATGCCCCCTGGCCAGGTGG + Intergenic
932008451 2:67951480-67951502 TCTGATGCCCACTGTCTCATCGG + Intergenic
932621011 2:73264981-73265003 TCTGAAGCCCCTGGTGCAGTGGG - Intronic
933705230 2:85284637-85284659 TCTGAGGCTCACTGTACAGTCGG - Intronic
936661040 2:114544063-114544085 TCTAAAGCTCACTGTCCAGTAGG + Intronic
938169937 2:129066577-129066599 GCTGATCCCCACTGTACAGTGGG - Intergenic
940969082 2:159875481-159875503 CCTGATGACCCCTGTCCTGAAGG - Exonic
942480596 2:176384202-176384224 TCTGTTGCCCCCAGTCCATAGGG + Intergenic
946388185 2:219398856-219398878 TCTGATGCACCCCCTCCAGGTGG + Intronic
948723713 2:239919285-239919307 TCTCATGCCCCCTTTGCACTGGG + Intronic
1170058498 20:12233844-12233866 TCTGATACCTCCTCTCCAGTAGG + Intergenic
1172191212 20:33063014-33063036 TCTGAGGCTCCCACTCCAGTGGG + Intronic
1172759817 20:37314195-37314217 TCTGCTCCCCACTGTCCAGTGGG - Intronic
1175264082 20:57692178-57692200 TACGATGCCCCCTGTGTAGTGGG + Intronic
1175616570 20:60404972-60404994 TCTGAAGCACCCTTTCCACTAGG + Intergenic
1179479379 21:41668069-41668091 TCTGATGCCCACTGATCATTTGG - Intergenic
1180955482 22:19739474-19739496 GCTCACGCCCCCTGTCCAGCAGG - Intergenic
1185024877 22:48403145-48403167 GATGATGACACCTGTCCAGTTGG - Intergenic
1185236288 22:49715297-49715319 GCTGATGCCCTGTGCCCAGTGGG - Intergenic
949928472 3:9059995-9060017 TCTGGTGGCCCCAGTGCAGTTGG - Intronic
952002138 3:28798227-28798249 TGTGATGCCCACTTTCCTGTAGG - Intergenic
954673517 3:52303351-52303373 TCTGATACCCACTGGCCAGTAGG + Intergenic
962336489 3:134536229-134536251 TCTGTTGCCCCCAGTTGAGTAGG + Intronic
963288258 3:143459533-143459555 TGTGATACCCAGTGTCCAGTTGG + Intronic
963655884 3:148049550-148049572 TCTGATGCCCCTCTGCCAGTGGG - Intergenic
968737475 4:2304804-2304826 CTTCATGCCCCCTGTCCGGTGGG + Exonic
969091558 4:4697599-4697621 TCTGATGGGGCCTGTCCTGTGGG + Intergenic
970270867 4:14345941-14345963 TATGAAGCCCACTCTCCAGTGGG - Intergenic
972927302 4:44026186-44026208 TCTGATGCTCAATATCCAGTAGG - Intergenic
973998775 4:56488498-56488520 TCTCATGGCCTCTGTGCAGTTGG + Intronic
974091206 4:57313344-57313366 TCTGATGCCTCCTGGCAAATAGG + Intergenic
976069118 4:81221266-81221288 GCTGATGCTCCCTCTACAGTGGG - Intergenic
982057036 4:151561915-151561937 TCTGATTACCCCTCTCCAATTGG + Intronic
983646176 4:169993678-169993700 CCAGATTCCCCCTGGCCAGTGGG - Intronic
985782315 5:1877837-1877859 TCAGAAGCCCCCTCTCCGGTGGG + Exonic
985863789 5:2495578-2495600 TCTGATGACCACTGTCCTGTGGG + Intergenic
987209899 5:15670438-15670460 TATTATGTCCCCTGACCAGTGGG - Intronic
989243822 5:39230778-39230800 TCAGCTGTACCCTGTCCAGTTGG - Intronic
989243902 5:39231814-39231836 TCAGCTGCACCCTGTCTAGTTGG + Intronic
997207832 5:132060327-132060349 ACTGAGGCCTCCTGCCCAGTGGG - Intergenic
998739069 5:145177941-145177963 TCTCAGGCCTCATGTCCAGTAGG - Intergenic
999065761 5:148683909-148683931 GTTAATGCCCTCTGTCCAGTGGG - Intergenic
1000352566 5:160363411-160363433 TCTGAGGCATCCTGTCAAGTGGG - Intronic
1004300621 6:14454189-14454211 TATGAGGCCACCAGTCCAGTTGG + Intergenic
1007183118 6:39944983-39945005 TCTGATGGGGCCTGTCCAGTGGG + Intergenic
1007217753 6:40253720-40253742 TCTGCTGCCCCCTGTGCTATGGG + Intergenic
1007953945 6:45899397-45899419 TGAGATGGCCCCTGGCCAGTGGG + Exonic
1012382932 6:98641870-98641892 TCTTATGCCCCATGTACAGTGGG + Intergenic
1013595468 6:111656522-111656544 GATGAGGCCCACTGTCCAGTGGG - Intergenic
1014142166 6:117956298-117956320 CCTGATGTCCACTGTCCAGAAGG - Intronic
1014609471 6:123523313-123523335 ACTGATGCCCCCTGTACTGCAGG - Intronic
1014645346 6:123966057-123966079 TTTTATGGACCCTGTCCAGTGGG - Intronic
1017290149 6:152726582-152726604 GCTCATGTGCCCTGTCCAGTTGG - Intergenic
1018383256 6:163280056-163280078 TCTGCTGCCACCTGGCCAGCTGG + Intronic
1019499202 7:1355931-1355953 TCTGCTGCCCCCTGCCCAGCTGG + Intergenic
1022878807 7:34564684-34564706 TCTGATGCAGTATGTCCAGTAGG + Intergenic
1025263847 7:57439898-57439920 CCTGCTGCCTCCTCTCCAGTGGG + Intergenic
1025635386 7:63316211-63316233 CCTGCTGCCTCCTCTCCAGTGGG - Intergenic
1025647308 7:63431959-63431981 CCTGCTGCCTCCTCTCCAGTGGG + Intergenic
1034880242 7:154757362-154757384 GCTGATGCCCACTGCCCAGTGGG + Intronic
1038429892 8:27491582-27491604 TCTGCTGCCTCCTGTCTAATGGG + Intronic
1042028810 8:64451818-64451840 TCTGCTGTCACCTGTTCAGTTGG + Intergenic
1043538072 8:81227927-81227949 TTTGATGCCTACTGTCCACTGGG + Intergenic
1044705636 8:95005810-95005832 TATGAAGCCAGCTGTCCAGTTGG - Intronic
1047230630 8:122995326-122995348 TCTGATGCCCCCTTTCTTCTTGG - Intergenic
1048989885 8:139755033-139755055 TCTCATCACCCCTGTCCTGTTGG - Intronic
1049613914 8:143568133-143568155 TCTGCTGCCGCCTGGTCAGTAGG - Exonic
1053267088 9:36723347-36723369 TCAGATGTCCCCTGCCCACTGGG - Intergenic
1055145205 9:72925366-72925388 ACAGATGGCTCCTGTCCAGTGGG - Intronic
1057098880 9:92338949-92338971 TCTGCTGCACCCTGGCCAGTGGG - Intronic
1057860947 9:98640477-98640499 TCTGATGCCCCAGGTCCTGCTGG + Intronic
1061167706 9:128933761-128933783 TCTGATGTCCCCTTTCCACAGGG + Exonic
1061708399 9:132470523-132470545 TGTGGTGCCCCCTGGGCAGTAGG + Intronic
1191607475 X:63078369-63078391 TCATAAGCCCCCTGTCCAGAAGG - Intergenic
1192033376 X:67538815-67538837 TCAGATGCCCCATGTAAAGTGGG - Intergenic
1194053185 X:89098665-89098687 TCTTATGCTCACTGTCCACTTGG - Intergenic
1200182230 X:154157592-154157614 TCTGTCTCCCCCTGTCCAGGGGG - Intronic
1200187884 X:154194706-154194728 TCTGTCTCCCCCTGTCCAGGGGG - Intergenic
1200193534 X:154231846-154231868 TCTGTCTCCCCCTGTCCAGGGGG - Intronic
1200199289 X:154269650-154269672 TCTGTCTCCCCCTGTCCAGGGGG - Intronic