ID: 1166532552

View in Genome Browser
Species Human (GRCh38)
Location 19:43551810-43551832
Sequence TGGGAGAAACAAAAAGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 745
Summary {0: 1, 1: 0, 2: 3, 3: 85, 4: 656}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166532552 Original CRISPR TGGGAGAAACAAAAAGAGGT TGG Intronic
900424722 1:2571228-2571250 TCAGAGAAACAGAAAGAGGCAGG + Intergenic
900875302 1:5338308-5338330 TGAGAGAAAGAAAAAGAGAGAGG - Intergenic
901363291 1:8722598-8722620 TTGGAGGAACAAAAAAAGGATGG + Intronic
901809174 1:11756778-11756800 CGGGATAAATAAAAAGAGGTCGG + Intergenic
901842835 1:11964618-11964640 TGGGAGAGACAGAAAGCGGGTGG - Intronic
904261637 1:29291049-29291071 TGGGAGGGAGAAAAGGAGGTGGG - Intronic
904736297 1:32636691-32636713 TGGAAAAAAAAAAAAAAGGTGGG + Intronic
905085165 1:35367679-35367701 TTAGAGAAAGATAAAGAGGTGGG + Intronic
905352795 1:37359153-37359175 GAGGAGAAACAGAGAGAGGTTGG + Intergenic
905580427 1:39080080-39080102 TGGGAGAAAAAAAAATGTGTTGG - Intergenic
906076550 1:43056249-43056271 AGGGAGAAAGAAACAGAGGGGGG - Intergenic
906660879 1:47580734-47580756 TGGGAGAGAGACAAGGAGGTCGG + Intergenic
906675436 1:47690139-47690161 GGGGAGACAGAAAAGGAGGTCGG - Intergenic
906928462 1:50144336-50144358 TGGGAGAAACAATAACAGAATGG + Intronic
907038596 1:51237480-51237502 TGGGTGGAGCAAAAAGAGGAGGG - Intronic
907560807 1:55385721-55385743 TGTTAGAAAGAAAGAGAGGTAGG - Intergenic
907606524 1:55823217-55823239 AGAGAGAAAAAAAAAAAGGTTGG + Intergenic
907724556 1:57007013-57007035 AGAGAGAAAAAAAAGGAGGTAGG - Intronic
907791074 1:57664121-57664143 TGGGGGAAAAAAAAGGATGTTGG + Intronic
908165417 1:61452929-61452951 GGGCAAAAAGAAAAAGAGGTGGG + Intronic
908214340 1:61935397-61935419 TGGGAAAAACAAAATTAGGGTGG - Intronic
908308126 1:62846284-62846306 TGAGAAAAACCAAAAGAGTTTGG - Intronic
908645692 1:66275524-66275546 AGGGAGATAAAAAAGGAGGTTGG + Intronic
908849816 1:68364458-68364480 TAGGAGAAAAAAAAAATGGTGGG - Intergenic
909107949 1:71436226-71436248 TGGCAAAAAAAAAAAAAGGTGGG + Intronic
909186543 1:72493695-72493717 TGGGGGAAACAAAACGGGGTGGG + Intergenic
909350500 1:74647395-74647417 TGGAAGAAAAAAAAAGCAGTAGG - Intronic
909657657 1:78048716-78048738 TGGGAGGAAAAAAAAAAGATGGG - Intronic
909975098 1:82036714-82036736 TTGGAGAAAGAAAAAAATGTGGG - Intergenic
910243140 1:85109924-85109946 AGGAAGAAAAAAAAGGAGGTGGG + Intronic
910386935 1:86693947-86693969 TGGAAGAAATAAAAAGGGATGGG - Intergenic
911219263 1:95229989-95230011 AAAGAGAAAAAAAAAGAGGTAGG - Intronic
911400810 1:97372739-97372761 TGAGAGAAAAAAAAAAAGGTGGG + Intronic
911656775 1:100453078-100453100 TGGAATAAACAAAAAGATTTAGG - Intronic
912311918 1:108631539-108631561 TGGGAGAATAAAAAATAAGTGGG + Intronic
912946139 1:114086460-114086482 TGGGAGACAAAAAAAGAGTTGGG + Intergenic
913232958 1:116756962-116756984 TTGGAGAAACAAAGAGATGTGGG - Intronic
913583974 1:120254895-120254917 GGAGAGAAAGAAAAAGAGATCGG + Intergenic
913624207 1:120643446-120643468 GGAGAGAAAGAAAAAGAGATCGG - Intergenic
914565961 1:148866739-148866761 GGAGAGAAAGAAAAAGAGATAGG + Intronic
914606861 1:149263501-149263523 GGAGAGAAAGAAAAAGAGATAGG - Intergenic
915151725 1:153838498-153838520 AGGGGGAAAAAAAAAGAGGCAGG - Intronic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
916409106 1:164527264-164527286 AGGGATAAAAAAAAAGAGGCAGG - Intergenic
916517233 1:165530887-165530909 TGGAAGAAACAGAAAGAGTATGG + Intergenic
916967060 1:169958386-169958408 TTTAAGAAATAAAAAGAGGTCGG - Intronic
917030257 1:170682585-170682607 TGAGAGAAAGAAAAAGAGATGGG - Intronic
917678201 1:177340229-177340251 AGGGAGAAATAAAAAGAGGAGGG + Intergenic
918068989 1:181121258-181121280 TGGAAGACACAAATAGAAGTTGG - Intergenic
918143225 1:181735058-181735080 TGGAAGAAAGAAAAACAGGGAGG - Intronic
918276676 1:182959564-182959586 TGGAAGAACCAAGAAGAGCTGGG - Intergenic
918754504 1:188320947-188320969 TGGTATGAATAAAAAGAGGTGGG - Intergenic
919038986 1:192357411-192357433 AGGGAGACACAGAAAGAGGGAGG + Intronic
919676778 1:200391740-200391762 TTGGGGAAACAAAATGAGGAAGG + Intergenic
920006471 1:202836911-202836933 TAGGAGAAAGAGCAAGAGGTGGG + Intergenic
920014866 1:202898721-202898743 TGGGAAAAACCAAAACAGGATGG + Intronic
920501993 1:206491294-206491316 TGTGTGAGACAAAAAGGGGTCGG - Exonic
921542359 1:216431632-216431654 TGGGAGCAGGACAAAGAGGTGGG + Intergenic
921758720 1:218887328-218887350 GGGGAGAAACAGGAAAAGGTGGG + Intergenic
922120098 1:222657340-222657362 TGAGAGAAACAAGAAGCGGAGGG - Intronic
922135457 1:222820908-222820930 TGGGAGTAACATAAAGCTGTAGG - Intergenic
923496083 1:234526024-234526046 TCGGGGACACAAAAAGAGGCAGG - Intergenic
923548680 1:234943834-234943856 AGGGAGAAATAAATGGAGGTGGG - Intergenic
923925674 1:238624555-238624577 TGAAAGAAACAAAAAGAGAGTGG + Intergenic
923945964 1:238887948-238887970 AGGGAAAAAGAAAAAGAGGAAGG + Intergenic
924400700 1:243677689-243677711 TTGGAGAAAAATAAAAAGGTAGG + Intronic
1063656355 10:7994051-7994073 TGGGAGAGAGAAGAAGGGGTAGG - Intronic
1064573407 10:16719552-16719574 TGGGAGAAACTAAAATAAGAAGG - Intronic
1065602929 10:27388102-27388124 AGGGAGAAATAAAAAGAGGAGGG + Intergenic
1065928435 10:30457135-30457157 AGAAAGAAACAAAGAGAGGTGGG - Intronic
1066129407 10:32377686-32377708 AGGAAGAAAAAAAAAGAGGTGGG - Intronic
1066590130 10:36985643-36985665 TGTGTGGAACAAGAAGAGGTAGG - Intergenic
1067878384 10:50024073-50024095 TGGGAGAAGGAAAAAGAGGGTGG - Intergenic
1067893338 10:50153855-50153877 TGGGAGAAGGAAAAAGAGGGTGG + Intergenic
1068044674 10:51871367-51871389 TGGGGGAAGCAAGAAGACGTGGG - Intronic
1068051689 10:51958210-51958232 TGGGAGAAATTAAATAAGGTAGG - Intronic
1068302072 10:55156813-55156835 TGGGCTAAACAGAGAGAGGTTGG + Intronic
1068420789 10:56789644-56789666 TGGGGGAAACTAAAAGATGGTGG - Intergenic
1068761523 10:60716262-60716284 AGGGGGAAACAAAAACATGTAGG + Intronic
1069053722 10:63821795-63821817 TGTGAGAAGCAGAAAGAGGCAGG - Intergenic
1069131729 10:64712722-64712744 TGGGAGAAGCAAATGAAGGTTGG + Intergenic
1070574986 10:77670935-77670957 AGGGAGAAACAGAAAGAGAGAGG + Intergenic
1070813423 10:79309663-79309685 TAGGAGAAACAGGAAGAGGAAGG + Intronic
1071453188 10:85819343-85819365 GGGGAGTAACAAAAAGTTGTGGG - Intronic
1071519025 10:86317569-86317591 TGGCAGGAAGAAGAAGAGGTGGG + Intronic
1071807461 10:89139728-89139750 TGGAAGACACAAAAATAGGGTGG - Intergenic
1071947951 10:90669157-90669179 TTGTGGAAACAAAAAGAGGAGGG + Intergenic
1072271275 10:93779491-93779513 AGGGAGAAAGAAAAAGAGGAAGG + Intronic
1073096726 10:100984466-100984488 TGGGAGAAAGAGAAAGGGTTTGG - Exonic
1073854188 10:107656041-107656063 TTGGAAGAACAAGAAGAGGTAGG - Intergenic
1074453032 10:113574872-113574894 AGGGAGAAAGAAAAAGTGGAAGG - Intronic
1074577768 10:114686592-114686614 AGGGAGAAAGGAAAAGAGGAAGG - Intergenic
1075741525 10:124699098-124699120 TGGGAGAGAGAAAAGCAGGTGGG - Intronic
1076714155 10:132354795-132354817 TGGGAGAAACAAGAGGAGGCCGG + Intronic
1077629317 11:3799966-3799988 TGGGGGAAAAAAAAGGTGGTGGG + Intronic
1077726781 11:4682816-4682838 TGGGAGAAGACAAAAGGGGTGGG - Intronic
1077738051 11:4812524-4812546 GGGGAAAGAAAAAAAGAGGTAGG + Intronic
1077757389 11:5047358-5047380 TGGGATAATCAAATAGAGATTGG - Exonic
1078459998 11:11507449-11507471 TAGGAGGAAAAGAAAGAGGTGGG - Intronic
1078861460 11:15251148-15251170 TGGAAGAAGCAAAATGAGTTTGG + Intergenic
1079356696 11:19735852-19735874 TGGGAAGAACAAATGGAGGTTGG + Intronic
1079603241 11:22337284-22337306 AGAGATAAAGAAAAAGAGGTGGG - Intergenic
1079979701 11:27136950-27136972 AGTGAGAAAGAAAAAGATGTAGG + Intergenic
1080917172 11:36672064-36672086 TGGAAGAAACAAAAAGGCATAGG + Intergenic
1081126047 11:39323361-39323383 TGGTAAAAACAAAAGGAAGTTGG + Intergenic
1081335566 11:41861875-41861897 TGGCAGAAAAAAAAAGGGGGAGG - Intergenic
1081489514 11:43556653-43556675 GGGGAGAGAGAAAAAGAGGGTGG - Intronic
1081610419 11:44559476-44559498 TTGGAGAAAAAAATAAAGGTCGG + Intergenic
1081663785 11:44904491-44904513 TGGCAGAAACAACGAGAGGAGGG + Intronic
1081745961 11:45472756-45472778 TGTAAAAAACAAAAAGAGGTGGG + Intergenic
1081780121 11:45704654-45704676 TGGGAGAAGAAAGAGGAGGTGGG - Intergenic
1082228473 11:49736375-49736397 TGGAAGAAACAAAAAGAGATGGG - Intergenic
1082887002 11:58096099-58096121 AGGGAGAAAGAAAGAGAGGGAGG - Intronic
1083012510 11:59416754-59416776 TGGGAGAATCATCAAGATGTGGG - Intergenic
1083546703 11:63554150-63554172 TGGGGGAAACAACACGGGGTGGG + Intronic
1084196915 11:67528188-67528210 TGGGAGACACCAAAATAGGCAGG - Intergenic
1085541535 11:77274903-77274925 TGGGAGAAATGAAGAGGGGTTGG + Intronic
1085824562 11:79830934-79830956 TTTAAGAAACAAAAAGAAGTCGG - Intergenic
1085897950 11:80662379-80662401 TGTGTGGAACAAGAAGAGGTAGG + Intergenic
1085915636 11:80884642-80884664 TGTGAGAAACAAAAAGCTGATGG - Intergenic
1086138817 11:83471580-83471602 TAGGAAAAACAAAAAGAGCTTGG - Intronic
1086446623 11:86877855-86877877 TGCAAAAAAAAAAAAGAGGTGGG + Intronic
1086610504 11:88749467-88749489 TTGGGGTACCAAAAAGAGGTGGG + Intronic
1086621597 11:88892773-88892795 TGGAAGAAACAAAGAGAGATGGG + Intronic
1087351186 11:97034803-97034825 AGGGAGATACAAACAAAGGTAGG - Intergenic
1088217592 11:107529922-107529944 AGGGAGTAACAGAAAGGGGTAGG + Intronic
1088513020 11:110598167-110598189 GGGGAAAAAAAAAAAAAGGTGGG - Intronic
1089051046 11:115546261-115546283 TGGGAGAGAAAGAAAGAGGATGG - Intergenic
1089054250 11:115572402-115572424 CGGGAGAAAAAAAAGCAGGTTGG + Intergenic
1089916389 11:122161063-122161085 TGTGAAAACCAAATAGAGGTTGG - Intergenic
1089920654 11:122206620-122206642 AGGGAGAAACATTTAGAGGTAGG + Intergenic
1090405267 11:126472847-126472869 TGAGAGAAACCAAAAGGGGCAGG + Intronic
1090475287 11:127014710-127014732 TGGGAGAATAAAAAAGTGGAAGG + Intergenic
1090609921 11:128461916-128461938 TGGGAGGGCAAAAAAGAGGTGGG - Exonic
1091012284 11:132013499-132013521 TGGGAGAAACAAGGAGATTTGGG + Intronic
1091338318 11:134790736-134790758 GGGGAGAGATGAAAAGAGGTTGG - Intergenic
1091345802 11:134853171-134853193 GGGGAGGAACAAAGAGCGGTAGG + Intergenic
1091465082 12:677155-677177 TGTGACAAACAAAAGGAGATGGG - Intergenic
1091753741 12:3038629-3038651 TGGGAGAAACCATAAAAGGCAGG - Intronic
1092596208 12:10007605-10007627 TCTGAGAAAGAAAAAGAGATTGG + Intronic
1092673087 12:10885388-10885410 AGGGAGAAAAAAAAAGATATAGG - Intronic
1092965105 12:13633851-13633873 AGGGAGAATCAGAAACAGGTGGG - Intronic
1093126823 12:15340193-15340215 AGGGAGAAACTAAAGGAGTTAGG + Intronic
1094000659 12:25690514-25690536 TGGGAGCAAACACAAGAGGTTGG - Intergenic
1094469027 12:30785580-30785602 AAGGAGAAAAAAAAAGAGGCTGG + Intergenic
1095715938 12:45345968-45345990 AGGGAGAAACAAAAATGGGGCGG + Intronic
1095744840 12:45646392-45646414 TGGTATAAACAATAAGAGGATGG + Intergenic
1097152731 12:56991523-56991545 TGGGAGGAAGAGAAAGAGGGAGG - Intergenic
1097362797 12:58676498-58676520 TAGGCAAAACAAAAAGATGTTGG - Intronic
1098036210 12:66304555-66304577 AGGGAGACAGAAAAAGAGGTAGG + Intronic
1098167551 12:67713843-67713865 TGGAAGAAAGAAAAAGGGATGGG + Intergenic
1098811036 12:75092737-75092759 TGGCAGAAATATGAAGAGGTTGG - Intronic
1098998308 12:77147332-77147354 TGGCAGAATCTAAAAGACGTGGG - Intergenic
1099002354 12:77193968-77193990 TGAGAGAAAGATAAATAGGTTGG - Intergenic
1099227574 12:79988132-79988154 TGAAAGAAAAAAAAAGAAGTGGG - Intergenic
1099633387 12:85179095-85179117 TGGTATAAATAAAAAGAGGAAGG - Intronic
1099783889 12:87236447-87236469 TGGGAGAAAAAAAAGCAGGCCGG + Intergenic
1100091416 12:90976619-90976641 TGGGAGACAAAAAGAGAGGGAGG - Intronic
1100191061 12:92192134-92192156 TGGGAGAAAAAAAAAAAGTCTGG + Intergenic
1100307988 12:93368915-93368937 AGGGAGAAAGGAAGAGAGGTAGG - Intergenic
1100307997 12:93368961-93368983 AGGGAGAAAGGAAGAGAGGTAGG - Intergenic
1100361101 12:93880269-93880291 TTGAAGAAAAAAAAAGGGGTTGG - Intronic
1100596671 12:96078087-96078109 GGGGGGAAAAAAAAAGAGGGGGG + Intergenic
1100773233 12:97947109-97947131 GGGAAGAAAGAAAAAGAGGCTGG + Intergenic
1101119625 12:101565452-101565474 AGGGAGTTACAAAATGAGGTTGG - Intergenic
1101383138 12:104231816-104231838 TGGAAGAAACAAAAAGGGATGGG - Intronic
1101735264 12:107458631-107458653 TGGGAGATACACATACAGGTAGG + Intronic
1102845254 12:116174503-116174525 TGGGAAAAACAAAAAAGGTTTGG + Intronic
1102983287 12:117259195-117259217 TGGGAGAGACAAAAAGTGATGGG + Intronic
1103006623 12:117425943-117425965 CGGGAAAAAGAAAAAGAAGTTGG + Intronic
1103175440 12:118859403-118859425 AGGGAGAAACAAACAAAGGTGGG - Intergenic
1103366864 12:120389896-120389918 AGGGAGGAAGAAAAAGAGGAAGG + Intergenic
1104803721 12:131571796-131571818 TGGGAGAAAGAAAAAGAGAGAGG - Intergenic
1105607758 13:21941395-21941417 TTGGAGAAGAAAAAAGAAGTAGG - Intergenic
1105685851 13:22781064-22781086 AGAGAGAAAGAGAAAGAGGTGGG + Intergenic
1105694612 13:22875568-22875590 TGGAAGAAACAAAAGGAGGGAGG + Intergenic
1105782053 13:23714352-23714374 CAGGAGAAGAAAAAAGAGGTTGG - Intergenic
1106626812 13:31428973-31428995 GGGGAGGAATGAAAAGAGGTTGG - Intergenic
1106646674 13:31641921-31641943 TGGGAGAAATAGGAAGAAGTTGG + Intergenic
1106879999 13:34118951-34118973 TGGAAGGAAAAAAAAGAAGTGGG - Intergenic
1107101477 13:36597988-36598010 AGAGAGAAAGAAAAAGAGGGAGG + Intergenic
1107939906 13:45374363-45374385 AGAGAGAAAGAGAAAGAGGTGGG + Intergenic
1108048014 13:46401673-46401695 TGAGAGAGAGAAAAAGAGGAAGG - Intronic
1108781696 13:53844034-53844056 TCGGGGAAAAAAAAAGTGGTTGG - Intergenic
1109085791 13:57969906-57969928 AGAAAGAAACAGAAAGAGGTGGG + Intergenic
1109242922 13:59913289-59913311 GGGGAGAGACAAAGGGAGGTTGG - Intronic
1109293476 13:60502247-60502269 TGGAAGAAACAAAAAGGCATGGG - Intronic
1109622020 13:64923380-64923402 TAGGAAGGACAAAAAGAGGTTGG - Intergenic
1109650522 13:65319250-65319272 TGGAAAAAAAAAAAAAAGGTGGG + Intergenic
1109755327 13:66751274-66751296 TGGGAGATCCAAAAAGAAATAGG - Intronic
1109814193 13:67557989-67558011 TGAGAAATACTAAAAGAGGTAGG + Intergenic
1110943221 13:81379693-81379715 TGGAAGAAAAACAAAGATGTAGG + Intergenic
1111864509 13:93751857-93751879 TGAGAGAAAAGAAAAGTGGTAGG - Intronic
1112757211 13:102650118-102650140 AGGAAAAAACAAAAACAGGTAGG - Intronic
1113705693 13:112431709-112431731 TGGGAGAACTAAAGAGAGGTGGG + Intronic
1115233056 14:31182188-31182210 TGGAAAAAAAAAAAAGAGGCTGG - Intronic
1115847309 14:37554283-37554305 TGGGACAACCAAACAGAGCTTGG - Intergenic
1115853850 14:37609085-37609107 TGGGAGACAGAAAAAGTGGGAGG - Intronic
1116351381 14:43868093-43868115 TGGAAGTAACAAGAAGAAGTAGG + Intergenic
1116571232 14:46518282-46518304 AGGGAGAGATGAAAAGAGGTTGG + Intergenic
1116799394 14:49427441-49427463 TGGCAGAAAGAAAAAGACTTCGG + Intergenic
1118329534 14:64804710-64804732 TGGGAGAAGCATGAAGGGGTGGG + Intronic
1118418759 14:65575618-65575640 GGGGAAAAAAAAAAAGAGGAAGG - Intronic
1119129963 14:72163043-72163065 TGGGAGAAAGAATGGGAGGTGGG + Intronic
1119479731 14:74951866-74951888 TGGGAGAAACAAAAGGGGCTGGG + Intronic
1120057320 14:79939564-79939586 TGGTAGGAAGAAAAAGAGGTGGG + Intergenic
1120213594 14:81658531-81658553 AGAGAGAAACACAAAGAGGGAGG - Intergenic
1120558518 14:85960218-85960240 TGAGAAAAACAAGAAGAGTTAGG - Intergenic
1120868746 14:89318453-89318475 TGAGAGAAAGAAAAAGGGGCCGG - Intronic
1122085975 14:99305118-99305140 AGAGAGAAAAAAAAAGGGGTGGG - Intergenic
1124584949 15:30996213-30996235 TGGGGGAAACAAAAAGAGGGAGG + Intergenic
1124803682 15:32860133-32860155 AGAGAGAAAGAAAAAGAGGAAGG + Intronic
1124814158 15:32971869-32971891 TGGTAGAAAGAAGAGGAGGTGGG - Intronic
1125090586 15:35787169-35787191 CAGGGGAAATAAAAAGAGGTTGG - Intergenic
1125722486 15:41851924-41851946 TGGGAGGAATAAAGAGAGCTGGG - Intronic
1126328277 15:47505185-47505207 TGGGACCAACTAGAAGAGGTGGG - Intronic
1126945286 15:53812401-53812423 TTGGAGAAACATAAAGACTTGGG - Intergenic
1127768630 15:62212102-62212124 TGGGAGAAACACTAAGTGTTGGG - Intergenic
1127969584 15:63947846-63947868 TGGGAGAAGGAAGAAGAGCTGGG - Intronic
1128024976 15:64427949-64427971 TGGGGGAAAAAAAAAGAGGGGGG - Intronic
1128109101 15:65065275-65065297 TGCAAGAAGCAGAAAGAGGTTGG + Intronic
1128352893 15:66903235-66903257 TGGTAGAAACAGAATGAGCTGGG + Intergenic
1128524560 15:68403456-68403478 TGGGAGCAAGAAAGAGAGGGGGG - Intronic
1129083373 15:73061930-73061952 TGGGAGCATCAAAAAGAAATTGG - Intronic
1129106346 15:73310132-73310154 TGGTAGATGAAAAAAGAGGTTGG + Intergenic
1130702608 15:86200557-86200579 TGGGAGCAAAAAAAAAAGGGGGG - Intronic
1130733740 15:86526839-86526861 TTGGAGAAACAGAAGGGGGTTGG + Intronic
1130937460 15:88482362-88482384 TGGGATGGACAAAAGGAGGTGGG + Intergenic
1133085256 16:3357357-3357379 AAGAAGAGACAAAAAGAGGTAGG - Intergenic
1133228568 16:4355166-4355188 GGGGCGAAACACCAAGAGGTGGG + Intronic
1135206350 16:20487688-20487710 TGGGAAAAACAAAGAAAGGCAGG + Intergenic
1135560751 16:23474863-23474885 AGGGAAAAAAAAAAAAAGGTGGG + Intronic
1135857735 16:26027523-26027545 TTGGAGAAGCAAAATGAGATAGG - Intronic
1136530675 16:30866573-30866595 TGGAAAAAAAAAAAAAAGGTGGG + Intronic
1136646392 16:31621597-31621619 GGGCAGAAAGAGAAAGAGGTTGG + Intergenic
1136658751 16:31734666-31734688 GGGGAGGAATAGAAAGAGGTTGG - Intronic
1136912116 16:34153027-34153049 AGAGAGAAACAGAAAGAGATGGG - Intergenic
1137006031 16:35275065-35275087 AGGGAGAGAGGAAAAGAGGTGGG + Intergenic
1137368757 16:47884909-47884931 TGGGAGGAAAAAGAAGATGTTGG + Intergenic
1137823552 16:51468288-51468310 TAGGAGAAGCAAGAAGAGTTTGG - Intergenic
1138135908 16:54522642-54522664 TGGGAGAAAGAACAAGGGGCTGG - Intergenic
1138301794 16:55936568-55936590 AGGGAGATACAAAAAAAGATTGG - Intronic
1138936135 16:61726412-61726434 AGGGAGAGAGAAAAAGAGGGAGG - Intronic
1139003599 16:62543945-62543967 TGGGAAAGAAAAAAAGAAGTAGG - Intergenic
1139056109 16:63186304-63186326 TGGGAGAGATAAAGAGAGTTAGG + Intergenic
1139133425 16:64173585-64173607 CTGGAAAAAAAAAAAGAGGTTGG - Intergenic
1139585092 16:67897568-67897590 TGCGACAAACAAAAAGAAGGCGG - Intronic
1139674903 16:68517005-68517027 TGGGAAGAACAAAAAGACATTGG - Intergenic
1140088281 16:71815807-71815829 AGAGAGAAACAAAAGGAGGAGGG + Intergenic
1140307092 16:73813214-73813236 AGAGAGAAAGAGAAAGAGGTAGG - Intergenic
1140620572 16:76726050-76726072 TGGGAGAGTCAAGATGAGGTGGG - Intergenic
1140740335 16:77936042-77936064 GGGGAGAAAAAAAAGGAGGTGGG + Intronic
1140819254 16:78647854-78647876 TGAGAGAGAAAAAAAGAGCTGGG - Intronic
1141355434 16:83341036-83341058 TGTGAGAAAAACAAATAGGTAGG - Intronic
1141464832 16:84198546-84198568 TGGCAGAGACAAAAGGGGGTTGG - Intergenic
1142943199 17:3400684-3400706 TGGGACAAACAGAAAGAAGAAGG + Intergenic
1143935489 17:10480171-10480193 GGGGGGAATCAAAAAGATGTTGG - Intergenic
1144099868 17:11933849-11933871 TGGGGGAAAGAAAGAGAGGAAGG - Intronic
1144218906 17:13082269-13082291 TGACAAAAACAAAAACAGGTTGG + Intergenic
1144316054 17:14062625-14062647 CTGGGGAAACAAAAAGAAGTTGG - Intergenic
1144378253 17:14667136-14667158 GGGGAGAAGAGAAAAGAGGTAGG + Intergenic
1144593493 17:16545204-16545226 TGGAAGAAATAAAAAGGGATGGG + Intergenic
1144641421 17:16939479-16939501 GGGGAGAGAGAAAGAGAGGTGGG - Exonic
1145721527 17:27077540-27077562 AGGAAGAAACAAAAAAATGTAGG + Intergenic
1146072571 17:29697420-29697442 AGGAAGAAAAAAAAATAGGTTGG + Intronic
1146117684 17:30156314-30156336 GGGGAGAGATAAAGAGAGGTTGG - Intronic
1146382295 17:32340195-32340217 TGAGAGACTGAAAAAGAGGTAGG - Intronic
1146627738 17:34446907-34446929 TGGGAGAGAGAGACAGAGGTTGG - Intergenic
1146666561 17:34708981-34709003 TGGGGGAAAACAAAAGAGCTGGG - Intergenic
1146983443 17:37188566-37188588 GGGTAAAAAAAAAAAGAGGTTGG + Intronic
1147111853 17:38268536-38268558 TGGAAAAAATAAAAGGAGGTAGG - Intergenic
1147378101 17:40034978-40035000 GGGGAGAAAAAAAAGGAAGTGGG + Intronic
1147421968 17:40326415-40326437 TGGGAGAAAGAACCAGAAGTCGG - Intronic
1147504337 17:41000208-41000230 AGGGAAAAACAAGAAGAGTTTGG - Intergenic
1147722272 17:42546669-42546691 TGGGAGACACAACAAGGGGTGGG + Intergenic
1147723457 17:42552839-42552861 TGGGAGACACAACAAGGGGTGGG + Exonic
1147819506 17:43233269-43233291 TGGGGGAAACCAAAAGAGCGAGG + Intergenic
1147820598 17:43239417-43239439 TGGGGGAAACCAAAAGAGCGAGG + Intergenic
1147820810 17:43240682-43240704 TGGGGGAAACCAAAAGAGCGAGG + Intergenic
1147821620 17:43245151-43245173 TGGGGGAAACCAAAAGAGCGAGG + Intergenic
1147822714 17:43251309-43251331 TGGGGGAAACCAAAAGAGCGAGG + Intergenic
1147825231 17:43266105-43266127 TGGGGGAAACCAAAAGAGCGAGG + Intergenic
1147826072 17:43270840-43270862 TGGGGGAAACCAAAAGAGCGAGG + Intergenic
1147826351 17:43272617-43272639 TGGGGGAAACCAAAAGAGCGAGG + Intergenic
1147827239 17:43277469-43277491 TGGGGGAAACCAAAAGAGCGAGG + Intergenic
1147828351 17:43283625-43283647 TGGGGGAAACCAAAAGAGCGAGG + Intergenic
1147829461 17:43289789-43289811 TGGGGGAAACCAAAAGAGCGAGG + Intergenic
1147830552 17:43295924-43295946 TGGGGGAAACCAAAAGAGCGAGG + Intergenic
1147831236 17:43299512-43299534 TGGGGGAAACCAAAAGAGCGAGG + Intergenic
1149255363 17:54820633-54820655 TGGTAGAAATAAAAAGTGATAGG + Intergenic
1149749320 17:59129886-59129908 TGGGAGGAAGGAAAAGAGGGAGG + Intronic
1149962857 17:61131060-61131082 AGGGGGAAAAAAAAAGATGTTGG + Intronic
1149994966 17:61401500-61401522 TGGGAGCAACAACCACAGGTGGG + Intronic
1150316455 17:64173262-64173284 TGGGAGAAAAAAAAAGGAGAGGG - Intronic
1150465187 17:65386637-65386659 AGGGAGAGAGAAAAAGAGGAAGG - Intergenic
1150734153 17:67721779-67721801 TGAGAGGAACAAAAAGATTTTGG - Intronic
1150995900 17:70317152-70317174 TGGAAGATGCAAAATGAGGTTGG - Intergenic
1151812342 17:76452181-76452203 AGGGTAAAACAAAAAGAGGCTGG + Intronic
1153225106 18:2893997-2894019 TGGGAGAAAAGAAAACAGGGAGG - Intronic
1153850957 18:9093838-9093860 AAGGAGAAAGAAAGAGAGGTGGG - Intergenic
1154063580 18:11085878-11085900 TGGGAGAAAAAAAGGGAGGTAGG + Intronic
1154465645 18:14641261-14641283 CGGGAGAACGAAAAAGAGGATGG - Intergenic
1154484812 18:14865219-14865241 TGGGAGAAGGATAAAGAGGGTGG - Intergenic
1154509224 18:15077591-15077613 TGAGAGAAATGAAAAGAGGCAGG - Intergenic
1154510672 18:15098240-15098262 TGGGAGGAAAAAACAGAGGATGG - Intergenic
1154961758 18:21316440-21316462 TGGCAGAGACAAAAAGATCTGGG - Intronic
1155672070 18:28383817-28383839 TGAGAGAAAGAACAAGAGGCAGG - Intergenic
1156588422 18:38458964-38458986 GGGGAGAAAAAAAAAGAGAGTGG + Intergenic
1156764989 18:40641890-40641912 TGGGAGGAAAGAAAAGAGGTGGG + Intergenic
1156820937 18:41372048-41372070 TTTGAAAAAAAAAAAGAGGTTGG - Intergenic
1157661784 18:49451909-49451931 TACAAGAAACAAAAAGAGATGGG + Intronic
1158016124 18:52786285-52786307 TGGAAGAAACAAAAAGGGATGGG - Intronic
1158234225 18:55295035-55295057 ATGGAGAATCAAAAACAGGTTGG + Intronic
1158332116 18:56374512-56374534 TGAGAGAAAGAAGAAGAGGCAGG - Intergenic
1159345130 18:67192271-67192293 ATGGAGAAACAAAAAGAGATGGG - Intergenic
1159664948 18:71146272-71146294 GGGCACAAAAAAAAAGAGGTAGG + Intergenic
1159879380 18:73844219-73844241 TGGGGAAAAAAAAAAGAGATTGG + Intergenic
1160343855 18:78113194-78113216 TGGGAGAAAAAGAATGATGTAGG - Intergenic
1162019166 19:7860917-7860939 TGGGGGAAACACACACAGGTGGG - Intronic
1162461328 19:10815913-10815935 AGGGAGAAGCAAAGAGAGGCGGG + Intronic
1163207368 19:15813533-15813555 GGAGAGAAAGAAAGAGAGGTGGG + Intergenic
1165387513 19:35519510-35519532 AGGGAGAAACACAGAGAGGAAGG - Intergenic
1165447754 19:35866042-35866064 TGAGAGAGACAAAAAGAGACAGG - Intronic
1166107837 19:40606134-40606156 TGGGAGGGACTAAAAGATGTTGG - Intronic
1166295401 19:41887003-41887025 TGGGAGAGACAGCAAGAGATGGG + Intronic
1166532552 19:43551810-43551832 TGGGAGAAACAAAAAGAGGTTGG + Intronic
1166738592 19:45100752-45100774 GAGGAGAAACAGAAACAGGTGGG + Intronic
1166778145 19:45324624-45324646 TGGGAGGAAGAAGATGAGGTTGG + Intergenic
1166916077 19:46196833-46196855 TGGGAGAAGGAAGAAGAGGAGGG - Intergenic
1167797748 19:51720753-51720775 TGGAAGAAACAAAATCAGGCTGG - Intronic
1168075522 19:53979048-53979070 AGGCAGAAAAAAAAAGAGGGGGG + Intronic
925115553 2:1375484-1375506 GGGGAGAAGGAAAAAGAGGGAGG + Intronic
925469426 2:4142948-4142970 TGGAAGAAACAAAAAATGGCGGG - Intergenic
926853458 2:17226635-17226657 AGGAAGAAAGAAAAAGAGGAGGG + Intergenic
928922694 2:36541920-36541942 TTGTTGAAACAAAAAGAAGTGGG - Intronic
928969757 2:37015541-37015563 AGGGAGATACAAAAAGAGCAAGG + Intronic
929052442 2:37849588-37849610 TAGAAGAAACCAAAAGGGGTGGG - Intergenic
929811123 2:45190201-45190223 AGGGAGAAAGAAAAAGAACTTGG - Intergenic
931105218 2:59047916-59047938 TGGGAGAAACAGGAAAATGTGGG + Intergenic
931165826 2:59746680-59746702 TGGAAGAAAAAAAAAGAGGAAGG + Intergenic
931291220 2:60875677-60875699 TGGTAGAAAGAAAATGAGATGGG - Intergenic
931328156 2:61249783-61249805 TGGTAGAAACAGAAACAGGCTGG - Intronic
931335037 2:61332077-61332099 TGGTAGAAAGAAAAAGACTTTGG + Intronic
931674770 2:64683366-64683388 TTGGAGAAAAAGAAAGAGATAGG + Intronic
932509242 2:72268770-72268792 TGGGAGCAAGAAGCAGAGGTGGG - Intronic
933234542 2:79850374-79850396 AGGGAGAAACAAACAGAGGGAGG - Intronic
933240786 2:79918177-79918199 TGGAAGGAAGAAAAAGAGGGAGG - Intronic
933569683 2:83994885-83994907 TGGGAGAAACACCAAGATGGGGG - Intergenic
933769582 2:85734494-85734516 TGGGAGAAAAAAAAAGGAGTGGG + Intergenic
933904323 2:86874793-86874815 ACGGAGAAAGAAAAAAAGGTGGG + Intergenic
935143607 2:100378026-100378048 AGGGAGAAACAGAAAGAGGTAGG - Intergenic
935603467 2:104946419-104946441 TGGGAGGGACAAGGAGAGGTTGG + Intergenic
935941155 2:108240641-108240663 TGGAAGAAACAAAAAGGGATGGG - Intergenic
936367915 2:111877347-111877369 ACGGAGAAAGAAAAAAAGGTGGG - Intronic
936766414 2:115854397-115854419 TGGGAGAAATATAAAGAGTACGG - Intergenic
937742490 2:125372999-125373021 AGAGAGAAAAAAAAAGAGCTGGG - Intergenic
938222156 2:129579217-129579239 TGGGAAAAAAAAAAAGAAGTTGG - Intergenic
938342040 2:130542024-130542046 AGAGAGAAAGAAAAAGAGGGAGG + Intronic
938347792 2:130578687-130578709 AGAGAGAAAGAAAAAGAGGGAGG - Intronic
938505892 2:131882700-131882722 TGGGAGGAAAAAACAGAGGATGG - Intergenic
938732765 2:134159296-134159318 GGGAAGAAAAAAAAAGAGGAAGG - Intronic
940001825 2:148974150-148974172 TGGGAGAATCAATTAAAGGTTGG + Intronic
940018447 2:149131495-149131517 TATGAGAAAGAAAAAGAGGAGGG + Intronic
940142852 2:150513273-150513295 ATGGACAAAGAAAAAGAGGTGGG + Intronic
940164734 2:150757868-150757890 AGAGAAAAACAAAAAGAGGCAGG - Intergenic
940330895 2:152473409-152473431 AGAGACAAACAAAAAGAGGTTGG + Intronic
940593350 2:155758298-155758320 TGGGAACAACAAAAAGAGGCTGG + Intergenic
940923152 2:159332107-159332129 TGGGAGAAAGTAACTGAGGTAGG + Intronic
940956235 2:159731191-159731213 TAGGTGATACAAAAAGATGTCGG - Intronic
941366595 2:164618268-164618290 TGGAAAAAAAAAAAAGAGGCCGG - Intronic
941419886 2:165270651-165270673 TAGGAGAAACCAAAGCAGGTTGG - Intronic
941714184 2:168746203-168746225 TTGTAGAAACACAAAGAAGTAGG + Intronic
941811273 2:169758118-169758140 TAGGAAAAAAAAAAAGAAGTTGG + Intronic
942159804 2:173172184-173172206 AGAGAGAAACAAAGATAGGTGGG + Intronic
942695925 2:178645361-178645383 TGCAAGAAAAAAAAAGAGATGGG + Intronic
942811162 2:180002697-180002719 TGGGACATACAGAAAGAAGTAGG + Intronic
943066838 2:183096530-183096552 TGAAAAAAACAAAATGAGGTCGG - Exonic
943492666 2:188575402-188575424 TGGGGGAAAGAAAGAGAGGTTGG + Intronic
943947968 2:194091514-194091536 GGGGAGAAAGAAACAGATGTTGG + Intergenic
944209391 2:197190984-197191006 TGAGAAAAACAAATAGTGGTAGG + Intronic
945427914 2:209730109-209730131 TGGGAGATGGAGAAAGAGGTAGG + Intronic
945591466 2:211737394-211737416 TAGGAGAGACAAGAAGAAGTGGG - Intronic
945620498 2:212130452-212130474 TGGTAGCAACATAAAAAGGTTGG + Intronic
945779333 2:214148625-214148647 GAGAAAAAACAAAAAGAGGTAGG - Intronic
946244633 2:218380054-218380076 TGAAAGAAAGAAAAAGAGGCCGG - Intergenic
946986867 2:225283121-225283143 TTGGAGAAACAGAAGGTGGTGGG - Intergenic
947495639 2:230634168-230634190 TGGGATAAAGAATAAGAGGAAGG + Intergenic
1169215126 20:3789109-3789131 TGGGACTTACAGAAAGAGGTGGG - Intronic
1169402335 20:5293698-5293720 TGCTTGAAACAAAAAGAAGTTGG - Intergenic
1169645587 20:7806174-7806196 TGGGAAAAGCAGAGAGAGGTTGG - Intergenic
1169674643 20:8139999-8140021 CGTGAGAAGCTAAAAGAGGTGGG + Intronic
1169922478 20:10749947-10749969 TGGGAGACCCAAAAAGTGGTGGG + Intergenic
1169986697 20:11453014-11453036 AGAGAGAAACAGGAAGAGGTAGG + Intergenic
1170203282 20:13768320-13768342 TGGGAGAAAGAAAAAGGAGAAGG + Intronic
1170435304 20:16320453-16320475 TGGAAGAAACAAAAACACGATGG + Intronic
1170806186 20:19633980-19634002 TGGCAGATATAGAAAGAGGTGGG - Intronic
1171309250 20:24133067-24133089 TGGCAGAAAAAAAAAGAAGATGG + Intergenic
1172931266 20:38588041-38588063 TGGGATGAGAAAAAAGAGGTGGG - Intronic
1173096058 20:40029619-40029641 AGGAAGGAACAAAAAGAGGATGG + Intergenic
1173230070 20:41188047-41188069 AGGGGGAAATGAAAAGAGGTTGG - Intronic
1174209408 20:48865536-48865558 CAAAAGAAACAAAAAGAGGTGGG + Intergenic
1175041636 20:56057682-56057704 AGGGAGAAAGGAAAAGAGGGAGG + Intergenic
1175293733 20:57894868-57894890 TGGGAGAAAGAAAATGAGGGAGG + Intergenic
1175768826 20:61610121-61610143 TGAGAGGAATAAAGAGAGGTCGG - Intronic
1176660812 21:9633789-9633811 AGTCAGAAACAAAAACAGGTGGG - Intergenic
1176787179 21:13271037-13271059 TGGGAGAAAAAAACAGAGGATGG + Intergenic
1176788845 21:13294217-13294239 TGAGAGAAATGAAAAGAGGCAGG + Intergenic
1176796515 21:13374256-13374278 TGGGAGAAGGATAAAGAGGGTGG + Intergenic
1176808912 21:13517221-13517243 CGGGAGAACGAAAAAGAGGATGG + Intergenic
1176848278 21:13893384-13893406 TGGTAAAAAAAAAAAAAGGTGGG + Intergenic
1177097135 21:16849855-16849877 GGGGAAAAACAGAAAAAGGTAGG - Intergenic
1177294665 21:19159185-19159207 TAGGAGAAACCAGAAGAGATGGG - Intergenic
1177379253 21:20317015-20317037 AGGGAGAAATGAGAAGAGGTTGG + Intergenic
1177926696 21:27225790-27225812 TGGTAGAAACAGAAGGAGGAGGG + Intergenic
1177986350 21:27979654-27979676 TGGGAGGAAAAAACAGAGGCTGG + Intergenic
1177988008 21:28002358-28002380 TGAGAGAAATGAAAAGAGGCAGG + Intergenic
1178016854 21:28356727-28356749 TGGGAGAAAGAAACACAGGGAGG - Intergenic
1178519527 21:33276920-33276942 TGGGAGAGACAGAAAAAGATAGG + Intronic
1180340843 22:11617330-11617352 AGAGAGAAACAGAAAGAGATGGG - Intergenic
1181293688 22:21818009-21818031 TGGGAGGTACAAAAAGAAGGTGG + Intronic
1181335070 22:22123218-22123240 TGGGAGGAGTAAAGAGAGGTTGG - Intergenic
1182011146 22:27001715-27001737 TAGGAGAGAAAAAAAAAGGTGGG - Intergenic
1182028549 22:27139110-27139132 TGGATGAAAGAAAAAGAGGCTGG - Intergenic
1182137820 22:27922282-27922304 TAAAAGAAAAAAAAAGAGGTTGG - Intergenic
1182174085 22:28265379-28265401 AGGGAGAAATGAGAAGAGGTAGG + Intronic
1182237878 22:28890668-28890690 TGGGAGTAACAATAAGGGATTGG + Intronic
1182921790 22:34087100-34087122 TGGGAGAAACAGAAACAGATGGG - Intergenic
1183131296 22:35839359-35839381 TGGCATAACCAAAAAGAGGCAGG + Intronic
1183336194 22:37248174-37248196 AGGGAGAAACAGGGAGAGGTGGG - Intergenic
949655901 3:6218927-6218949 TGCCTGAAACAAAAACAGGTAGG - Intergenic
949680999 3:6514395-6514417 TGGGAGAGATATAAAGAGATTGG - Intergenic
950770773 3:15309237-15309259 GGGGAGAAAAAAACAGGGGTAGG + Intronic
950797254 3:15520313-15520335 TGTGAGAAACAGAAGGAGGTGGG - Intronic
951817156 3:26766860-26766882 TGAGAGAAACAAAAAGCGTGGGG + Intergenic
952675052 3:36019150-36019172 AGGGAAAAATAGAAAGAGGTTGG - Intergenic
953531893 3:43746865-43746887 TGGGAGCAAGGAACAGAGGTAGG + Intergenic
953582115 3:44166817-44166839 TGGGAAAACCAAACAGAGGAGGG - Intergenic
953740383 3:45533601-45533623 TGGGAGAAACAAAATGAAGGAGG - Intronic
953824510 3:46239184-46239206 TTGGAGAAAAACAAAGAGGACGG - Intronic
956150708 3:66239259-66239281 TGGCAAAAAAAAAAAAAGGTTGG - Intronic
956903412 3:73740815-73740837 TGGGAGAAAGAAAGGGAGGAGGG - Intergenic
957222730 3:77404948-77404970 TGGGAGAAACAACATCAGTTGGG - Intronic
958141307 3:89565385-89565407 TGGAAGAAACAAACAGAGAAGGG + Intergenic
959217160 3:103465676-103465698 AGGGAGAAATGAAGAGAGGTTGG - Intergenic
959418858 3:106109672-106109694 AGAGAGAAAGAAAAAGAGGAAGG - Intergenic
959940296 3:112074044-112074066 TGGGAGAAAGAAGAGGTGGTTGG + Intronic
960321969 3:116247974-116247996 TGGGAGAAAAACAAAGAGTATGG + Intronic
960391614 3:117084027-117084049 TGGGCAAAACAAGATGAGGTAGG - Intronic
960492131 3:118330220-118330242 TGGGAGAAATGAGAAGATGTTGG + Intergenic
960537482 3:118829157-118829179 AAGAAGAAACAAAAAGAGGGAGG + Intergenic
961143774 3:124577211-124577233 TGGAAAAAAAAAAAAGAGGGTGG + Intronic
961483956 3:127204661-127204683 TGGGACAAAGCTAAAGAGGTGGG - Intergenic
962312718 3:134337515-134337537 TGGGAGAGACAGACAGGGGTGGG - Intergenic
962611564 3:137081546-137081568 TGAGAGAAACAGGAAGAAGTTGG + Intergenic
963280279 3:143377830-143377852 TGGGAGAAACAGACAGGGGCAGG - Intronic
963455694 3:145543827-145543849 CAGGAGAAAGAAAGAGAGGTGGG - Intergenic
963686922 3:148447300-148447322 TGGTAGAAGCTAAAAAAGGTTGG - Intergenic
964072392 3:152650572-152650594 TGGGGGAAAGAAAAAGAATTAGG + Intergenic
964798024 3:160521168-160521190 AGGAAGAAAAAAAAAGAAGTAGG + Intronic
965073630 3:163948388-163948410 TTGGAGCAACAAAATGAAGTAGG + Intergenic
965428095 3:168552358-168552380 TGTGGGAAACAAAAATATGTTGG - Intergenic
965690289 3:171349023-171349045 TTGGAAAAAAAAAAAGAGGTTGG + Intronic
965767941 3:172151462-172151484 TGTAGGAAAAAAAAAGAGGTTGG - Intronic
966176027 3:177138590-177138612 TGGGAGAAAAAAAAAGGGAGAGG + Intronic
966241636 3:177760796-177760818 TTGGAGAAGGAAAAAGTGGTTGG + Intergenic
966743975 3:183258311-183258333 TGGGAGAAAGAAAAGGAGAAGGG - Intronic
966763803 3:183440754-183440776 AGGGAGCAAGAAAAAGAGGAAGG + Intergenic
967305252 3:188052806-188052828 TGGGGGAAACAGGAAGAGCTAGG - Intergenic
967483022 3:189996466-189996488 AGGGAGAGACAGGAAGAGGTTGG + Intronic
967938743 3:194749868-194749890 TGGGACCAACAAAACAAGGTCGG - Intergenic
968210837 3:196847387-196847409 TGGAAGAAACAAAAAGGGATGGG + Intergenic
968463769 4:739486-739508 TGGAATAAACAAAAACAGGCTGG - Intronic
968601992 4:1513800-1513822 TGGGACCAGCAAAGAGAGGTAGG - Intergenic
969352548 4:6606149-6606171 GGGGAGACAGAAAAAGAGGAGGG + Intronic
969923309 4:10560896-10560918 TCTCAGAAAAAAAAAGAGGTGGG - Intronic
970243826 4:14037722-14037744 TGGAAGAACCAAAAAGATGGTGG + Intergenic
970274619 4:14385141-14385163 TGGGAGAAGAAAAAGGAGGAGGG - Intergenic
970401780 4:15724203-15724225 TAAGAGAAACACAAAGAGGAAGG - Intronic
970564733 4:17320686-17320708 TTGGAGAACCAAAAAGAAGAAGG - Intergenic
971566445 4:28148802-28148824 TCAGAAAAACAAAAAGAGTTGGG - Intergenic
972047761 4:34690306-34690328 TGGGAGAAGAAAAAAGATTTGGG + Intergenic
972100317 4:35407466-35407488 TAGGAGAAACAAAAATGGTTTGG + Intergenic
972792207 4:42384015-42384037 GGGGAGAAAAGAAAAGAGGTTGG - Intergenic
972849576 4:43032442-43032464 TGGGTGAAAAAGATAGAGGTTGG + Intergenic
972877377 4:43379993-43380015 TGCTAGAAACTGAAAGAGGTAGG - Intergenic
973209949 4:47604672-47604694 AGGGAGAAACAGTAAGATGTGGG - Intronic
973270117 4:48254233-48254255 AGGGAGAATGACAAAGAGGTTGG + Intronic
973757155 4:54086599-54086621 TGGGAGAAAAAAATAGAGCATGG + Intronic
974089013 4:57291248-57291270 TGGGAGACAGAAAGAGAGCTTGG + Intergenic
974295373 4:59992411-59992433 TGGGAGAGATAAAAAGTGTTTGG - Intergenic
974434631 4:61840931-61840953 TGGAATAGAGAAAAAGAGGTGGG - Intronic
975067758 4:70089358-70089380 TGGAAGGAAAAAAAAGAGGGAGG + Intergenic
975615482 4:76242321-76242343 TGGGAGCAAGAGAAAGAGGGAGG - Intronic
975771926 4:77734585-77734607 TGGAAGGAATAAAAAGAGGGAGG - Intronic
976071496 4:81245227-81245249 CGGTAGAAGCAAAAAAAGGTAGG + Intergenic
976725062 4:88207838-88207860 TGAAAAAAACAAAATGAGGTTGG - Intronic
977272747 4:94938234-94938256 TGGGAGAAATAAGAAGTGCTTGG + Intronic
977362821 4:96028520-96028542 GGGAAGAAACAAATAGAGTTTGG + Intergenic
978558445 4:110006042-110006064 TGGGGGAAAAAAATAGAGGCTGG + Intronic
978852298 4:113353749-113353771 AAGCAGAAACAAAAAGAGGAAGG + Exonic
978946939 4:114510939-114510961 TGGGAGTAAACCAAAGAGGTGGG - Intergenic
979541280 4:121886097-121886119 TGGGAGAAGAAATAAGATGTGGG + Intronic
979846461 4:125519083-125519105 GGAGAGAAAGAAAAAGAGGAAGG - Intergenic
979871580 4:125829366-125829388 AGGAGGAAAGAAAAAGAGGTGGG + Intergenic
980152477 4:129063813-129063835 TGGGTGAGTCAAAAAGAGGTGGG + Intronic
981003249 4:139848980-139849002 GGAAAGAAACAAAAAGATGTAGG - Intronic
981673187 4:147311156-147311178 GGAGAGAAACAGAAAGAGGAGGG + Intergenic
982568400 4:157016870-157016892 TGGGAAAAAAAAAAAAAGTTGGG - Intergenic
982634654 4:157879115-157879137 TGGAAAAAAAAAAAAGAGGGGGG - Intergenic
982909378 4:161119494-161119516 TGGGAAAAATAAACAGATGTGGG + Intergenic
983169811 4:164522674-164522696 TGGTAGAAATAAAAGGATGTTGG + Intergenic
983796416 4:171869477-171869499 TGGGAGAAAAACAAAAAGGTTGG - Intronic
984207695 4:176805883-176805905 TAAGAGAAAGAAAAAGAGGAAGG + Intergenic
984367906 4:178821977-178821999 TGGAAGAATCAAAAAGGGATGGG - Intergenic
984681175 4:182610675-182610697 TGGGAGAAAAAAATAGAGAGAGG - Intronic
985006579 4:185540488-185540510 AGGAAGAAAGAAAAGGAGGTAGG - Intergenic
985181587 4:187270870-187270892 AGGGAGAAACAAAAACAAGTTGG - Intergenic
985414551 4:189722627-189722649 AGTTAGAAACAAAAACAGGTGGG + Intergenic
986525756 5:8673275-8673297 TGGCAGGAAAAAAAAGAAGTAGG + Intergenic
986793267 5:11183912-11183934 TGAGAGAAAGAGAAAGAGGGAGG - Intronic
986927547 5:12775378-12775400 TGGGAGAAATAGAGAGATGTTGG + Intergenic
989023411 5:37037860-37037882 TGGGAGCAACAAACAGAAATTGG - Intronic
989203835 5:38792223-38792245 GGGGAAAAAGAAAAAGAGATGGG - Intergenic
989384151 5:40837834-40837856 TTGTAGAAATAAAAAGAGGCAGG - Intergenic
989956403 5:50366035-50366057 TGGAACAAAGAAAAAGGGGTGGG + Intergenic
990433649 5:55765064-55765086 TAGGAGAAAAAAAGAGAAGTAGG - Intronic
991997041 5:72398227-72398249 AGGAAGAAAAAAAAAGAAGTCGG - Intergenic
992388173 5:76305882-76305904 TAAGGGACACAAAAAGAGGTGGG + Intronic
992787539 5:80184368-80184390 TGGAGGAAGAAAAAAGAGGTAGG - Intronic
992969951 5:82046169-82046191 TTGGAGAAGCAGGAAGAGGTAGG - Intronic
993078378 5:83264724-83264746 TGGAAGAAAAAAAAAGTTGTGGG - Intronic
994295991 5:98089231-98089253 TGGGATCAAGAAAAAGAGTTGGG - Intergenic
994513740 5:100742866-100742888 TGGGAGCAAGAGAAAGAGGGAGG + Intergenic
995245086 5:109926011-109926033 TGGAAGAATAAAAAAGAGGGAGG - Intergenic
995570508 5:113475447-113475469 TGGGAGAAAAAAAGATGGGTAGG - Intronic
997054316 5:130422670-130422692 TGGGAGGAACAGAAGTAGGTAGG - Intergenic
997251720 5:132393733-132393755 TGGGAGAAACAAGGTGAGGATGG - Exonic
997329166 5:133046729-133046751 GGGGAAAAAAAAAAAGAGGAAGG - Intergenic
997329212 5:133047057-133047079 TGGAAGAAAGAAAGAGAAGTAGG - Intergenic
997339124 5:133128765-133128787 TGAGCAAAACAAAAAGAGTTAGG - Intergenic
998060391 5:139114414-139114436 TGGGAGAGAAAAAAAGATGGTGG - Intronic
998386177 5:141758335-141758357 TGATAGAAAGAAAGAGAGGTGGG + Intergenic
998859597 5:146429296-146429318 AGGGAGAGAAAGAAAGAGGTTGG - Intergenic
998982786 5:147722858-147722880 AGGGATAAAAAAAAAGAGGATGG - Intronic
999069192 5:148725672-148725694 TGGTGGAAAGAAAAAGGGGTGGG + Intergenic
999187617 5:149724401-149724423 TGGGAGCAACAAAATTAGATAGG - Intergenic
999363061 5:151002449-151002471 TAGGATAAAGAAAAAGAGGCTGG + Intergenic
1001621819 5:173093133-173093155 AGGGTGAAACAAAGAGAGGATGG + Intronic
1001981057 5:176037296-176037318 CGGGAGAAAGATAAAGAGGGTGG + Intergenic
1002236404 5:177806770-177806792 CGGGAGAAAGATAAAGAGGGTGG - Intergenic
1002995369 6:2278118-2278140 TTGGAGAAACATGAAGACGTTGG - Intergenic
1003477933 6:6501995-6502017 AGGGAGGGAGAAAAAGAGGTAGG + Intergenic
1003925006 6:10869555-10869577 TGGAAGAAACAAAAAGGGACGGG - Intronic
1004506786 6:16253462-16253484 TGGGAGAGAGAAAGAGAGGGTGG + Intronic
1004552841 6:16666115-16666137 AGGGAGGAATAAAGAGAGGTTGG - Intronic
1004566477 6:16802718-16802740 TGGGTGAAACTGAAAGTGGTGGG + Intergenic
1004802732 6:19168565-19168587 TAGCAGAAATAAAAAGAGTTGGG - Intergenic
1004912085 6:20296011-20296033 GGAGAGAAAAAAAGAGAGGTTGG - Intergenic
1004989975 6:21125885-21125907 GGGGAGACACACAATGAGGTCGG - Intronic
1005162589 6:22881399-22881421 TGGAAAAAATGAAAAGAGGTAGG - Intergenic
1005168923 6:22958691-22958713 TGGGGGAAACAAATGGAGGAAGG - Intergenic
1005312482 6:24571627-24571649 GGAGAGAGAGAAAAAGAGGTAGG - Intronic
1006697391 6:35942613-35942635 TTGTAAATACAAAAAGAGGTAGG - Intergenic
1007315099 6:40981283-40981305 TGGGGGGAATGAAAAGAGGTTGG + Intergenic
1007847137 6:44768653-44768675 TGAGAGAAACACCAAGCGGTTGG + Intergenic
1007917979 6:45578714-45578736 AAGGAGAAAGAAAAAGAGATGGG - Intronic
1007935870 6:45731386-45731408 TGGGAGAGACAAGAATAGGGAGG - Intergenic
1008094085 6:47321127-47321149 TGAGAAAAACAGAAAGAAGTTGG - Intergenic
1008561721 6:52730983-52731005 TGGAAGAAAGAAAAAGGGATGGG + Intergenic
1008703386 6:54128696-54128718 TGGGAAAACCAAAATGAGATGGG + Intronic
1009583584 6:65567963-65567985 TGGGAGATACATGGAGAGGTGGG - Intronic
1009657296 6:66563370-66563392 TGCAAGAAACAAAAAGGGATGGG - Intergenic
1010991941 6:82489545-82489567 CAGAAGAAACAAAAAGAGATGGG + Intergenic
1011028886 6:82899388-82899410 AGGTAGAAAGAAAAAAAGGTGGG + Intronic
1011088690 6:83571103-83571125 TGAAAAAAAAAAAAAGAGGTGGG - Intronic
1011144448 6:84197249-84197271 TGGAAAAAAAAAAAGGAGGTAGG + Intronic
1011449968 6:87482239-87482261 TGGGGGAAAAAAAAGGAGGGGGG - Intronic
1011511743 6:88108891-88108913 TGGGGCAGACCAAAAGAGGTGGG + Intergenic
1012296235 6:97528112-97528134 TTGAAGAAAGAAAAAAAGGTGGG - Intergenic
1012449203 6:99337253-99337275 TAGGAAAAAAAAAAAGAGGCAGG + Intronic
1013076161 6:106773533-106773555 TGGGGGAAACAAACAAAGCTGGG - Intergenic
1013095980 6:106945083-106945105 AGTGAGTATCAAAAAGAGGTGGG + Intergenic
1013595651 6:111658284-111658306 TGAAAGAAGTAAAAAGAGGTTGG + Intergenic
1014246491 6:119075900-119075922 TTGTAGAAACAGAAAGATGTTGG + Intronic
1014378734 6:120712490-120712512 TGGAAGAAAAAAAAAGAGAGAGG + Intergenic
1014743356 6:125171149-125171171 TGGTAGAAACAGAAATGGGTGGG - Intronic
1014761990 6:125366640-125366662 TGGGGGAAAGAGCAAGAGGTAGG - Intergenic
1015159279 6:130133987-130134009 TGGCAGAGTCAAAAAGAGATGGG + Intronic
1015855052 6:137615404-137615426 TGAGGGAGACAAAAAGAGTTTGG - Intergenic
1016852261 6:148632707-148632729 GGGAAGAAAGAAAAGGAGGTAGG + Intergenic
1016918492 6:149266970-149266992 GGGGAGCAAAAGAAAGAGGTTGG + Intronic
1018188248 6:161286693-161286715 TGGAAGAATGAAAAAGAGTTGGG + Intergenic
1018281690 6:162192978-162193000 AGGGAGACAGAAAAAGAAGTCGG - Intronic
1018570274 6:165202781-165202803 TTGGAGAAAAAAAAAGAGATAGG + Intergenic
1019718179 7:2551527-2551549 TGGGAAAAAAAAAAATAGCTGGG + Intronic
1019817309 7:3210732-3210754 TGGGAAAAACTGAAAGAAGTTGG + Intergenic
1020350303 7:7211802-7211824 TGGAAGAAAGAAAAAGGGATGGG - Intronic
1020364529 7:7366672-7366694 TGGTAGAAAGAAGAAGAGGAAGG + Intronic
1020636981 7:10708133-10708155 GGGGTGAGACAAAAAGAGGTGGG + Intergenic
1021141752 7:17033978-17034000 TGGGTAAAATAAAAAGAGGCAGG - Intergenic
1021613442 7:22479248-22479270 TGGAAGAAACAAAAGGAGATAGG + Intronic
1022525416 7:31033999-31034021 TGGGAGAGACAAAACCAGGCTGG - Intergenic
1023168525 7:37367272-37367294 TGGGAGAGAGAAAGAGAGGGAGG - Intronic
1023528414 7:41129271-41129293 AGAGAGAAAGAGAAAGAGGTTGG - Intergenic
1024103661 7:46059328-46059350 TGGGAAAGACACAAAGAAGTGGG + Intergenic
1024678873 7:51662415-51662437 TGGGAGAAGCAAACTGAGCTGGG + Intergenic
1025231631 7:57206758-57206780 AGGGAGAAAGAAAGAGAGGAAGG - Intergenic
1026638774 7:72106558-72106580 AGGGAGAGAGAAAAAGAGGAAGG + Intronic
1026685454 7:72505511-72505533 CTGGAGAAACAGAAAGAGGCTGG + Intergenic
1026935265 7:74251147-74251169 TTTGAGAAACAAAAAGAGTTTGG - Intronic
1027916329 7:84327417-84327439 TGGGAGAAAGAAAAGCAGGTAGG + Intronic
1027923568 7:84429833-84429855 TGGGAGGAAGAAAATGAGGCAGG + Intronic
1028187759 7:87808292-87808314 AGAAAGAAACAAAAAGAGATAGG - Intronic
1028352181 7:89862445-89862467 TGGAAGAACCAAAAAGGGATGGG + Intergenic
1029002809 7:97173428-97173450 TGGGAGAAAGAGAAATAAGTGGG - Intronic
1029331321 7:99858455-99858477 TGGGAGAAATATCAAGAGGGAGG + Intronic
1029410096 7:100403967-100403989 TGGGAGAAACAGAATGGGGAGGG - Intronic
1029494150 7:100888189-100888211 TGGGAGAAGAAAACAGAGGATGG + Intronic
1029619257 7:101679672-101679694 TGTGAAAAATAAAAAGAGCTAGG - Intergenic
1029747625 7:102525263-102525285 TGGGAGAAAGAACAGGAGGAAGG + Intergenic
1029765576 7:102624353-102624375 TGGGAGAAAGAACAGGAGGAAGG + Intronic
1030577834 7:111312182-111312204 TTAGAGAAAGAAGAAGAGGTTGG + Intronic
1030589492 7:111463654-111463676 TGGCAGAAGGAAAAAGAGGTGGG - Intronic
1030823625 7:114126818-114126840 TGGGAGAATCTAAAAGACATAGG - Intronic
1030897696 7:115082250-115082272 TAGGAGAAACAAAAAGAGAATGG + Intergenic
1032026450 7:128446317-128446339 TGGGAGAAGGAAAAAACGGTGGG + Intergenic
1032905076 7:136355377-136355399 TCAGAGAAACAAAAAGCTGTTGG + Intergenic
1032950707 7:136907884-136907906 TCATAGAAACAAAACGAGGTAGG - Intronic
1033010332 7:137615177-137615199 TGGGAGAAACACACAAAGGATGG - Intronic
1034036292 7:147826713-147826735 TGGGATAAAGAAAAAGGGCTTGG + Intronic
1034263015 7:149768796-149768818 TGGGAGAAATAAAGAGGGGGAGG + Intronic
1034487543 7:151375268-151375290 TTGGAGAAATATTAAGAGGTGGG + Intronic
1034882543 7:154773604-154773626 TGAGAGACTCAAAAAGAGGAGGG + Intronic
1036506393 8:9360315-9360337 TGGGAAAAAAAAAAAGAGTCTGG + Intergenic
1037857348 8:22381270-22381292 GGGGAGAAAAAAAAAGAGTAGGG - Intronic
1037866134 8:22443959-22443981 TGACAGAAACAAAAATAGCTGGG - Intronic
1038115228 8:24546429-24546451 TGGGAGATGCAAGAAGAGGCTGG + Intergenic
1038622381 8:29156305-29156327 TGGTTGAAACAAAAACAGGAAGG + Intronic
1039308426 8:36289727-36289749 TGGAAGAAACAAAAAGAATATGG - Intergenic
1039309140 8:36297019-36297041 TGGAAGAAACAGAAAGATGTGGG + Intergenic
1039335940 8:36589463-36589485 GGGGAGCAACTAAATGAGGTAGG - Intergenic
1039824762 8:41163716-41163738 TGGGAGAAACGAAAAGGCCTTGG - Intergenic
1040374194 8:46807153-46807175 CAGAAGAAACAAAAAGAGATGGG - Intergenic
1040960180 8:53023500-53023522 TGGGAGAGATAACAAGGGGTTGG + Intergenic
1041682070 8:60604136-60604158 CAGGAGAAAGAGAAAGAGGTGGG - Intronic
1041838568 8:62244360-62244382 TGGGAGAAACCAAAGGAGAAAGG - Intergenic
1041959292 8:63594220-63594242 TGGTAGGACCAGAAAGAGGTAGG + Intergenic
1042280437 8:67050295-67050317 TAGGAGAAAAAAAAAGAGGCCGG - Intronic
1043335462 8:79170996-79171018 AGGGAGAGATAAAGAGAGGTTGG - Intergenic
1044533356 8:93333004-93333026 AGGAAGAAACAAAATGAGGAAGG + Intergenic
1044822978 8:96170148-96170170 TGGGAGAAAGAAGAGGAGGCGGG - Intergenic
1045236338 8:100355826-100355848 TGGGAGAAAGAAAAAGTAGATGG - Intronic
1045371904 8:101532838-101532860 AGAGAGAAAGAGAAAGAGGTGGG + Intronic
1045718666 8:105079655-105079677 TGGAAGAAAGAGAAAGAGGGAGG + Intronic
1045857421 8:106780531-106780553 TGGGAGAAAAAAACTGAAGTGGG - Intergenic
1046784609 8:118252655-118252677 TGGGAGAAAGAGAAAGAGGAAGG - Intronic
1046787773 8:118286473-118286495 TGCTGGAAAGAAAAAGAGGTTGG - Intronic
1046951657 8:120025352-120025374 TGGCAGAAAAAAAAAATGGTGGG - Intronic
1047226115 8:122956609-122956631 GGTGAGAAACCAAAAGAGGTTGG + Intronic
1047393276 8:124471849-124471871 TGGGGGAAAAAAAAATAGCTGGG - Intergenic
1047823748 8:128550682-128550704 GGGGAAAAAGAAAAAGAGGATGG + Intergenic
1050204523 9:3182620-3182642 TGGGAGAAAGAAGAAGGTGTGGG - Intergenic
1050327270 9:4509574-4509596 TGGTAGAAAGAGACAGAGGTTGG - Intronic
1050616141 9:7403637-7403659 TGGCAGAAACAGATAGAGATCGG - Intergenic
1051442708 9:17103054-17103076 TAGGAGAAACAAGGAGATGTTGG - Intergenic
1051507727 9:17844277-17844299 AGGGAGAAACTAGGAGAGGTAGG - Intergenic
1051675091 9:19551105-19551127 AGGGAGAAATGAAGAGAGGTCGG - Intronic
1051990148 9:23143187-23143209 TGTGAGAAACAGACAGAGGCAGG + Intergenic
1052247587 9:26355331-26355353 TGGGAGAAATGGAAAGATGTTGG + Intergenic
1052497434 9:29245409-29245431 TGCTAGAAACAATGAGAGGTAGG - Intergenic
1053885715 9:42644076-42644098 TGGGAGAAAGATAAAGAGGGTGG - Intergenic
1054224733 9:62451525-62451547 TGGGAGAAAGATAAAGAGGGTGG - Intergenic
1055006094 9:71508730-71508752 TGGAAGAAAGAAAAAGGGATGGG - Intergenic
1055311287 9:74984293-74984315 TGGGGAAAACAAAAGGGGGTCGG - Intronic
1055433906 9:76272881-76272903 TTGGAGAAGCAAGAAGAGGCAGG - Intronic
1056261596 9:84854319-84854341 GAAGTGAAACAAAAAGAGGTAGG - Intronic
1056308166 9:85311983-85312005 TGGGAGAAACAAATGGATGGTGG - Intergenic
1056344165 9:85673641-85673663 TTGGAGATACAAAAAGTGGCAGG + Intronic
1056490976 9:87106856-87106878 AGGGAGGAAGAAAAAGAGGGAGG + Intergenic
1056877120 9:90344232-90344254 TGGGAGAAATCAGAAGATGTAGG - Intergenic
1057997904 9:99836544-99836566 TGGGGGAAACAGAAATATGTAGG + Intronic
1058032186 9:100212594-100212616 TGGGAGAAAAAAATAGGGTTAGG - Intronic
1058146921 9:101422620-101422642 TAGGGGAAATGAAAAGAGGTTGG + Intronic
1059072036 9:111147907-111147929 TTGCATAAACAAAAAGAGGATGG + Intergenic
1059475240 9:114541216-114541238 TGGGAGAAAGAGAGCGAGGTGGG - Intergenic
1060434137 9:123579071-123579093 ATGGAGAAACAAAAACAGGGGGG + Intronic
1203638380 Un_KI270750v1:135633-135655 AGTCAGAAACAAAAACAGGTGGG - Intergenic
1185812028 X:3119368-3119390 TAGAAGAAACAAAAATAGGCTGG - Intergenic
1185999255 X:4989537-4989559 AGGGAGAAGAAAAAAGAAGTAGG - Intergenic
1186353897 X:8769617-8769639 TGGAAGAAACAAAAAGGGATGGG - Intergenic
1186716624 X:12258944-12258966 AGGGAGAAATGAAGAGAGGTTGG - Intronic
1187469517 X:19556285-19556307 TTGGAAAAAAAAAAAAAGGTAGG - Intronic
1187724333 X:22186900-22186922 TGGGAAGAACAAAAAGAGAAGGG + Intronic
1187882673 X:23861315-23861337 TGCGAGCAAGAGAAAGAGGTGGG - Intronic
1189222780 X:39386579-39386601 TGGGAAAAGTATAAAGAGGTTGG - Intergenic
1189597402 X:42584078-42584100 TGGGAGAAACAAATACATGGTGG - Intergenic
1189850792 X:45174168-45174190 AGGGAGACACAAAAAGAATTTGG + Intronic
1189876034 X:45436833-45436855 AGGGAGAAAGGAATAGAGGTAGG + Intergenic
1190440576 X:50470995-50471017 GGGGAGAGACAAAAAGGGGAGGG + Intergenic
1190739461 X:53279849-53279871 AGGGAGAAAGGAAAAGAGGAAGG + Intronic
1190774776 X:53543970-53543992 TGGGAGAAAGAGAAAGAGGAAGG + Intronic
1190900778 X:54671077-54671099 TGGCAGAAAAAAAAAGATCTGGG + Intergenic
1191675276 X:63786082-63786104 TGGGGGAATCATAAAGAGGTGGG - Intergenic
1192190735 X:68989860-68989882 TGGGTGCAGGAAAAAGAGGTGGG + Intergenic
1192208486 X:69111411-69111433 AGGAAGAAACAAAAGGATGTGGG + Intergenic
1192258447 X:69486667-69486689 TGGGGGAAACTAGAAGAGGCTGG - Intergenic
1192322838 X:70105946-70105968 TGGGGGCAACAAGAAGAGGATGG - Intergenic
1192765573 X:74136670-74136692 TGGAAGAAACAAAAAGGGATGGG + Intergenic
1192946296 X:75967977-75967999 TGGGAGAGAGAAAAAGGGCTGGG + Intergenic
1192971482 X:76235594-76235616 TGGTAGAAACAAAAATATCTTGG - Intergenic
1193484411 X:82069088-82069110 TGGAATAAAAACAAAGAGGTTGG + Intergenic
1193580151 X:83254007-83254029 AGGGAGAAAAAAAAAAAGTTTGG + Intergenic
1193791332 X:85818860-85818882 TGGGAGAAACAAAAAAGGGATGG + Intergenic
1193977212 X:88136268-88136290 TGGTAGGAGGAAAAAGAGGTAGG + Intergenic
1194142568 X:90223044-90223066 AGGAAGAAAGAAAAAGAGGACGG + Intergenic
1194638915 X:96378514-96378536 AAGGAGAAACAAAAGGAGGGTGG + Intergenic
1194899950 X:99497778-99497800 TGGGAGAGAAACAAAGAGCTTGG + Intergenic
1195027560 X:100893176-100893198 TGGGAGAAATAGAAAGATGTTGG + Intergenic
1195130480 X:101845955-101845977 TGGAATAAATAAATAGAGGTTGG - Intronic
1195134167 X:101887096-101887118 TGGGGCAAACAAAAAGAGGCTGG - Intronic
1195459081 X:105103365-105103387 TGTGAGCAAGAAAAACAGGTAGG + Intronic
1195682669 X:107560592-107560614 TGGGAGAAAGAAAAAGGGACAGG - Intronic
1197854724 X:130902782-130902804 TGGGAAAAAAAAAAAGGGGCGGG + Intronic
1198620151 X:138499079-138499101 GGAGAGAAAGAGAAAGAGGTGGG + Intergenic
1199551779 X:149068903-149068925 TTTGAGGAACAAAAAGAGGTCGG - Intergenic
1199827046 X:151510534-151510556 AGGGAGAAACGGAGAGAGGTAGG + Intergenic
1200136734 X:153878897-153878919 TGGGAGACCAAAAAAGAAGTTGG - Intronic
1200409522 Y:2847487-2847509 TGGGAGAAAAAGAAAGAGTTTGG + Intronic
1200488322 Y:3792145-3792167 AGGAAGAAAGAAAAAGAGGACGG + Intergenic
1200686071 Y:6261103-6261125 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1200991607 Y:9352350-9352372 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1200994263 Y:9372626-9372648 TTGGAGAAACAGAAAAAGGTTGG - Intronic
1200996927 Y:9392966-9392988 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1200999442 Y:9461518-9461540 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1201002097 Y:9481824-9481846 TTGGAGAAACAGAAAAAGGTTGG - Intronic
1201004762 Y:9502110-9502132 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1201007415 Y:9522436-9522458 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1201010023 Y:9542288-9542310 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1201246025 Y:12004539-12004561 TGGGAAAAAAAAAAAAAAGTTGG + Intergenic
1201269277 Y:12238919-12238941 TAGAAGAAACAAAAATAGGCTGG + Intergenic
1201396538 Y:13554764-13554786 TGGGTCACACAAAAAGAGGAAGG + Intergenic
1202061620 Y:20895197-20895219 TGGAAGAAACAAAAAGGGTTGGG + Intergenic
1202130491 Y:21604568-21604590 TGGGAGAATCAAAAAAATGAAGG + Intergenic
1202385814 Y:24325500-24325522 TGGGAGAAAGGTAAAGAGATGGG - Intergenic
1202484972 Y:25344628-25344650 TGGGAGAAAGGTAAAGAGATGGG + Intergenic