ID: 1166535458

View in Genome Browser
Species Human (GRCh38)
Location 19:43571264-43571286
Sequence TAGGGAAAAGACTCTGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 270}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166535458_1166535463 24 Left 1166535458 19:43571264-43571286 CCAGCTTCAGAGTCTTTTCCCTA 0: 1
1: 0
2: 0
3: 26
4: 270
Right 1166535463 19:43571311-43571333 CAAATGTCCCCTTTTCAGGGAGG 0: 1
1: 2
2: 28
3: 169
4: 709
1166535458_1166535461 20 Left 1166535458 19:43571264-43571286 CCAGCTTCAGAGTCTTTTCCCTA 0: 1
1: 0
2: 0
3: 26
4: 270
Right 1166535461 19:43571307-43571329 TGCTCAAATGTCCCCTTTTCAGG 0: 1
1: 1
2: 14
3: 73
4: 420
1166535458_1166535462 21 Left 1166535458 19:43571264-43571286 CCAGCTTCAGAGTCTTTTCCCTA 0: 1
1: 0
2: 0
3: 26
4: 270
Right 1166535462 19:43571308-43571330 GCTCAAATGTCCCCTTTTCAGGG 0: 1
1: 3
2: 13
3: 112
4: 470

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166535458 Original CRISPR TAGGGAAAAGACTCTGAAGC TGG (reversed) Intronic
901260393 1:7866490-7866512 TGAGGACATGACTCTGAAGCTGG - Intergenic
902447055 1:16474205-16474227 CAGGGAAAAGGCCCTGAGGCGGG + Intergenic
903432737 1:23319995-23320017 TTGTGATAAGACACTGAAGCAGG - Intronic
903635040 1:24807482-24807504 TAGGGGAAAGACACAGCAGCAGG - Intronic
903728563 1:25471644-25471666 CAGGGAAAATACTAGGAAGCAGG + Intronic
907144061 1:52217186-52217208 TAGGGAAAAGATACAGAAACAGG - Intronic
908504456 1:64782352-64782374 TAGGGTAAAAACTGTGAAGAAGG - Intronic
909122711 1:71624631-71624653 AAGTAAAAAGACTCTGAAGTAGG - Intronic
910628667 1:89335441-89335463 AAGGAAAAAGACACTGAAGAGGG + Intergenic
911552459 1:99300272-99300294 TAGTGAAGAGACTCTGAAAAGGG - Intronic
915250573 1:154585386-154585408 CAGGAATAAGATTCTGAAGCAGG + Intronic
915272453 1:154764329-154764351 TAGGGAAAAGGCTCTCAGGCTGG + Intronic
917277196 1:173343408-173343430 AAGTGCAAAGACTCTGAGGCAGG + Intergenic
919413476 1:197276670-197276692 AAGTGCAAAGACCCTGAAGCAGG + Intronic
921219720 1:212964707-212964729 TAGCGCATAGACTCTGTAGCAGG - Intronic
921752407 1:218811184-218811206 AAGGGAAAAAGCTCAGAAGCAGG - Intergenic
921816861 1:219574178-219574200 TAGTGCAAAGACCCTGAGGCAGG + Intergenic
922571540 1:226637416-226637438 AATGGACAAGACTCTGGAGCTGG + Intronic
922810009 1:228410021-228410043 GAGGGAAAAGCCCCTGCAGCTGG - Intronic
923330135 1:232916028-232916050 TAAGGAAAAGACCCTAACGCAGG + Intergenic
924879710 1:248146882-248146904 TATGGAAAACACTGTGAAGATGG - Intergenic
1065357122 10:24853189-24853211 TAGCTAAAAGAATATGAAGCCGG + Intronic
1066093123 10:32045853-32045875 TAGGTAAGAGGCTCTGAAGTTGG + Intronic
1067146379 10:43697082-43697104 TATGGAATGGACTCAGAAGCAGG + Intergenic
1068219292 10:54023178-54023200 TAGGCAACAGACCCTGATGCTGG - Exonic
1069633623 10:69912497-69912519 TAGGGAAAAGACCCTGGTCCAGG + Intronic
1070010469 10:72468786-72468808 TTGGTAAAAGATTCTGAAGAAGG + Intronic
1070559851 10:77558151-77558173 TAAGGAAAAGACTCAGAAAGTGG + Intronic
1070825916 10:79390663-79390685 GACGGAAAACACTCTGCAGCTGG + Intronic
1071200023 10:83211521-83211543 AAGAGAAAAGACTCAGAGGCAGG + Intergenic
1071766397 10:88670580-88670602 AAGTGAGAAGAATCTGAAGCTGG + Intronic
1073247178 10:102099347-102099369 TAGGAAACACACTCTGATGCTGG - Intergenic
1073638115 10:105220210-105220232 TAGGGCAAAGATTCTGAGCCAGG - Intronic
1076220192 10:128727642-128727664 TAGAGAAAAGACTCAGAAATTGG - Intergenic
1076571298 10:131434815-131434837 TAGAGGAAGGGCTCTGAAGCCGG + Intergenic
1078094534 11:8288728-8288750 AAGGAAAAAGACCCTGAGGCAGG + Intergenic
1078401252 11:11029301-11029323 CAGGGAAGAGGCTCTGAAGAGGG + Intergenic
1078896268 11:15600040-15600062 TAAGAAATGGACTCTGAAGCTGG - Intergenic
1079099255 11:17530750-17530772 AAGAGCATAGACTCTGAAGCAGG - Intronic
1082571056 11:54740985-54741007 TAGGGAAGAGAACCTGGAGCTGG + Intergenic
1083463584 11:62831450-62831472 TTGGAAGAAGAGTCTGAAGCGGG - Intronic
1085012970 11:73154137-73154159 AAAGGAGAATACTCTGAAGCTGG - Intergenic
1085461931 11:76699360-76699382 TAGTGCACAGACTCTGGAGCTGG - Intergenic
1086319916 11:85634834-85634856 TGGGGAAAAGATACTTAAGCAGG - Intronic
1087640509 11:100750311-100750333 TAGGGGAAAGACACAGCAGCAGG - Intronic
1088265895 11:107987347-107987369 AAAGGAAAAGGCTCTGAAGCAGG - Intergenic
1090109205 11:123886710-123886732 CTGGGAAAAGGCTCTGAGGCAGG + Intergenic
1091813966 12:3422044-3422066 TAGGGAAAAGGCTCTGATCTGGG + Intronic
1091949518 12:4581227-4581249 TAGGGACAAGACACTGAAGTGGG + Intronic
1092040429 12:5379360-5379382 TATGAAAAAGACTCTGAATTTGG + Intergenic
1095347758 12:41171696-41171718 TTTGTGAAAGACTCTGAAGCAGG - Intergenic
1096214622 12:49792403-49792425 AAGGGAAAGGACTCGGGAGCAGG - Intronic
1096817675 12:54211562-54211584 GAGGAGAAAGATTCTGAAGCTGG + Intergenic
1096850253 12:54430900-54430922 TAGGGGAAAGGCTCTGTAGGGGG + Intergenic
1096987626 12:55771612-55771634 TAGGGAAAAGACTTTTGAGGGGG - Intronic
1097406038 12:59191483-59191505 TCAGGAAAAGGCTGTGAAGCTGG + Intergenic
1099220941 12:79913248-79913270 TAGGGAAAAGATTTTTAAACAGG - Intronic
1099387854 12:82038988-82039010 TAGGTAAAAGGCTTTGAAGAAGG + Intergenic
1099470710 12:83044341-83044363 GAGTGAAAAGACTCTGAACCAGG + Intronic
1101387677 12:104272249-104272271 TAGGGGAAAGACACAGCAGCAGG - Intronic
1102448722 12:113024417-113024439 ACGGGCATAGACTCTGAAGCAGG + Intergenic
1104002864 12:124871505-124871527 CAGGGCAACGACTCTGAGGCAGG + Intronic
1104271264 12:127284467-127284489 AATGGATGAGACTCTGAAGCTGG + Intergenic
1105569069 13:21582793-21582815 TAGGGGAAAGACACAGCAGCAGG + Intronic
1106795236 13:33198369-33198391 TAGGGCCAAGGCTCTGATGCTGG - Intronic
1107149880 13:37098808-37098830 AAGGGCAAAGGCTCTGAAACAGG - Intergenic
1107750544 13:43561135-43561157 TAGGGTAATCACTGTGAAGCAGG - Intronic
1108224063 13:48269614-48269636 AAGTGCAAAGGCTCTGAAGCAGG - Exonic
1109211826 13:59544292-59544314 TATGCAAAAGATCCTGAAGCAGG + Intergenic
1109404338 13:61877915-61877937 TATGGAAGAGACTTTGGAGCTGG + Intergenic
1110443902 13:75555138-75555160 AAGTGCAAAGACTCTGAAGCAGG - Intronic
1111456031 13:88485562-88485584 AAAGGCAAAGACTCTGAAGGAGG + Intergenic
1111834750 13:93374439-93374461 CAGGGTAAAGACTCTGTTGCAGG - Intronic
1112407287 13:99132461-99132483 AAGGGAGAGGAGTCTGAAGCAGG + Intergenic
1112497103 13:99913922-99913944 TAGGGAAAACACGCTGCAGAAGG - Intergenic
1113143068 13:107175936-107175958 GAGGGAAAAAAATCTGAAGCTGG - Intronic
1113481132 13:110622262-110622284 TATGGAAAATACTTTGCAGCTGG + Exonic
1114236509 14:20828431-20828453 TAGGGGAAAGACACAGCAGCAGG - Intergenic
1115190922 14:30746256-30746278 TAGTCAAAAGAAGCTGAAGCAGG + Intergenic
1115853626 14:37606639-37606661 TAGGGAAAAAAATTTGAAGGTGG - Intronic
1117211291 14:53503021-53503043 TAGGGAAAATGCCCTGAAGATGG - Intergenic
1117905848 14:60584720-60584742 TATGAAAAAGACTATGAAGCAGG - Intergenic
1118035068 14:61857703-61857725 AAGGGAAAAATCTCTGATGCAGG + Intergenic
1118604542 14:67493103-67493125 TAGTGAAGAGACCCTGAAGTAGG + Intronic
1119290833 14:73493540-73493562 TAAGGAAGAGACTCTCAGGCTGG + Intronic
1120686454 14:87543388-87543410 TGGGGGAAACACTCTGAAGGAGG + Intergenic
1121504186 14:94463763-94463785 TAGGGAAGAGATTCTTAACCTGG + Intronic
1121668220 14:95688571-95688593 TACCCACAAGACTCTGAAGCCGG + Intronic
1122165209 14:99818028-99818050 TCGGGAAAAGGCTTGGAAGCAGG + Intronic
1122423780 14:101593681-101593703 TTGGGAAAGGGCTCTGCAGCAGG + Intergenic
1122619946 14:103050389-103050411 TAGGGAAAATGCTCAGAACCTGG + Intronic
1123217549 14:106825787-106825809 TAGGGGAAAGCCTCTGAAACCGG + Intergenic
1124111037 15:26787749-26787771 TGGTGAAAAGAATCTTAAGCAGG - Intronic
1124924703 15:34059929-34059951 TATGGAACAGACTCTAATGCTGG - Intronic
1126792954 15:52237562-52237584 TGTGGAAAAGATTCAGAAGCTGG - Exonic
1129102840 15:73282105-73282127 AAGGGAAAGGACCCTGAGGCAGG - Intronic
1129164307 15:73767640-73767662 GAGGGAGAAGGGTCTGAAGCAGG + Intergenic
1129318245 15:74759223-74759245 TAGGGAAGAGACCCTGGAGGTGG - Intergenic
1134255052 16:12603579-12603601 TAGGGAGAAGGCACTGAGGCAGG + Intergenic
1137395099 16:48111459-48111481 GAAGGAAAAGAATCTGAAACAGG - Exonic
1139779702 16:69340191-69340213 TAGTGAGAAGATTATGAAGCTGG + Exonic
1139950896 16:70669107-70669129 TAGGCAAAAATCTCTCAAGCAGG + Intronic
1141173596 16:81705435-81705457 TGGGGAAGTGACTCTGAGGCTGG - Intronic
1141209758 16:81966588-81966610 TAGGGAAAACACTCTAAAGAGGG + Intergenic
1141657017 16:85421859-85421881 TAGGAAAAAGGCCCTGAAGTCGG - Intergenic
1144663836 17:17088885-17088907 TGGGGAAAACTCTCTGAACCCGG + Intronic
1146179307 17:30687106-30687128 AAGGAAAAAGACTGTGAAGGAGG - Intergenic
1146242699 17:31244730-31244752 TAAGGAAGAGGCACTGAAGCGGG - Intronic
1146408275 17:32558788-32558810 TTGGGACAAGACACTGAGGCGGG + Intronic
1147212240 17:38878422-38878444 AAGGGAAGAGACTCTCAAGGTGG + Intronic
1148758923 17:49989437-49989459 CAGGGAAAAGGCTCTGAGTCAGG + Intergenic
1149401475 17:56300809-56300831 TAGGAGAAAGACTCTCAGGCTGG - Intronic
1149641506 17:58205903-58205925 TAGGGAGAAGACCCTGCAGAAGG + Exonic
1151093139 17:71465415-71465437 TAGGGGAAAACCTCTGAAGCTGG + Intergenic
1152939644 17:83161436-83161458 TCTGAAAAAGACGCTGAAGCTGG - Intergenic
1153586211 18:6623342-6623364 GAGGGAAAAGAGTTTGATGCTGG - Intergenic
1154168750 18:12035690-12035712 TGGGGAAAAGGATCTGGAGCAGG + Intergenic
1156214212 18:34979072-34979094 GAGAGAAAAGACGCTGAAACTGG + Intronic
1156505125 18:37585719-37585741 TAGGAAAAAGGCACTGGAGCGGG + Intergenic
1156675620 18:39524348-39524370 GAGAGAAAGGACACTGAAGCTGG + Intergenic
1156779683 18:40836489-40836511 TTGGCAAAAGGCTCTGATGCAGG + Intergenic
1157686667 18:49648289-49648311 AAGGGAAAAGACTCAGGAACCGG + Intergenic
1158099244 18:53811042-53811064 CAGAGAAAATTCTCTGAAGCTGG - Intergenic
1158311280 18:56161690-56161712 TAAGAAAAAGACTCTCAGGCAGG + Intergenic
1158670526 18:59469869-59469891 GAGAGAAAAGACTCTTAAGAGGG + Intronic
1159244254 18:65784376-65784398 AAGAGCACAGACTCTGAAGCAGG + Intronic
1159418072 18:68179653-68179675 TAGGCAAAAGCCACTGAACCTGG - Intergenic
1162979318 19:14228463-14228485 AAGGAAAAAGACTGTGAAGGAGG + Intergenic
1163929553 19:20375879-20375901 TAGGGGAAAGACACAGCAGCAGG + Intergenic
1164854036 19:31507003-31507025 TAGGGAGAAGACTGTGTAGATGG - Intergenic
1164854051 19:31507069-31507091 TAGGGAGAAGACTGTGTAGATGG - Intergenic
1164854066 19:31507135-31507157 TAGGGAGAAGACTGTGTAGATGG - Intergenic
1164854081 19:31507201-31507223 TAGGGAGAAGACTGTGTAGATGG - Intergenic
1164854096 19:31507267-31507289 TAGGGAGAAGACTGTGTAGATGG - Intergenic
1164854111 19:31507333-31507355 TAGGGAGAAGACTGTGTAGATGG - Intergenic
1164854126 19:31507399-31507421 TAGGGAGAAGACTGTGTAGATGG - Intergenic
1166327484 19:42060015-42060037 TAGGGAACAGACTCAGGGGCAGG - Intronic
1166511153 19:43409655-43409677 AAGGTAAAAGAGACTGAAGCAGG + Intronic
1166535458 19:43571264-43571286 TAGGGAAAAGACTCTGAAGCTGG - Intronic
1168091228 19:54085918-54085940 TAAAGAAAAGATTCTGAAGCTGG - Intergenic
927770587 2:25857552-25857574 TGGTGCAAAGATTCTGAAGCAGG - Intronic
931583179 2:63799532-63799554 TTGAGAAAAGACTCTGATGTTGG - Intronic
932733207 2:74235034-74235056 GAGGGGAAAGAATCTGCAGCTGG + Intronic
934780628 2:96967608-96967630 TAGGGAACAGGCCCTGGAGCAGG - Exonic
935092594 2:99910140-99910162 TAGCGAATAGTCTCTGAGGCAGG - Intronic
935787030 2:106558702-106558724 TAGGGAAAAAAGTCTGCAACTGG - Intergenic
937044833 2:118845707-118845729 TAGCGAAAAGAGTCTGACCCGGG - Intronic
938196326 2:129331968-129331990 TAGGGAAAAGATTAACAAGCTGG - Intergenic
939966847 2:148618738-148618760 GAGGGAAAAGATTATGAAACAGG - Intergenic
940303695 2:152202807-152202829 TAGGGGAACGACACAGAAGCAGG + Intergenic
940439084 2:153693106-153693128 GAAAGAAAAGACTCTGAAGCTGG + Intergenic
941876200 2:170435958-170435980 CAAGGAAAATCCTCTGAAGCAGG + Intronic
943649400 2:190441022-190441044 GAGGGAAGAAACTCTGCAGCCGG + Intronic
943791770 2:191941165-191941187 TAGAGAAAAGGCTTTGAAGGAGG - Intergenic
944525452 2:200614343-200614365 TAGGGAAATGAAGCTGAATCTGG - Intronic
945730164 2:213523474-213523496 TGTGGAAGTGACTCTGAAGCTGG + Intronic
946788773 2:223277007-223277029 TGGGGCAAAGACACTGAGGCAGG + Intergenic
947556357 2:231096753-231096775 TAGGGAAATGACACAGCAGCAGG - Intronic
947995053 2:234520335-234520357 TAGGAAAAACACACTGAAACAGG - Intergenic
1169314054 20:4573338-4573360 AAGGCAAGAGACTCTGAAACAGG - Intergenic
1170709951 20:18781637-18781659 TGGGGAGCAGTCTCTGAAGCAGG + Intergenic
1172025252 20:31943974-31943996 CAGAGAAACTACTCTGAAGCAGG - Exonic
1173460311 20:43237907-43237929 TGGGGAAAAGCCACTGCAGCTGG + Intergenic
1173877497 20:46383827-46383849 TAGGGTAAAGATTCTTAACCTGG + Intronic
1174122236 20:48274710-48274732 CAGGGAAAAGACCTTGAAGCAGG - Intergenic
1174275696 20:49402332-49402354 TAGGGGAAAGACACAGCAGCAGG + Intronic
1174683305 20:52429270-52429292 TAGGAGAAAGAATTTGAAGCAGG - Intergenic
1174922032 20:54713745-54713767 TGGGGAAAAAACTAGGAAGCTGG + Intergenic
1177224109 21:18231690-18231712 AGATGAAAAGACTCTGAAGCTGG - Intronic
1182077104 22:27502272-27502294 TAGTGAAAAATATCTGAAGCTGG + Intergenic
1182790463 22:32948291-32948313 TAGGGCATAGACACTGTAGCGGG + Intronic
1184059488 22:42073638-42073660 AAGGGCAAAGGCTCTGAGGCGGG + Intergenic
951176829 3:19611670-19611692 TATGAAAAAGCCTCTGAAACAGG - Intergenic
952284771 3:31957441-31957463 ATGAGAAAAGACTATGAAGCAGG + Intronic
952416097 3:33092760-33092782 CAGGCAAACCACTCTGAAGCAGG + Exonic
955507935 3:59650694-59650716 CAGTGCAAAGACCCTGAAGCAGG + Intergenic
956961597 3:74408735-74408757 TAGGGTAATTACTCTGAAGAAGG - Intronic
958933897 3:100237453-100237475 AGGGGATAAGACTCTGAATCAGG - Intergenic
961082826 3:124041162-124041184 GAGGGAAAAGTCTATGAAGGAGG + Intergenic
961930762 3:130530303-130530325 TAGGGTATGGACTCTGAAGCCGG + Intergenic
962904255 3:139787733-139787755 TGGAGAAAAGACTAAGAAGCAGG - Intergenic
963043200 3:141083933-141083955 GAGGGGAAAGACTCTGAAGTTGG + Intronic
964058908 3:152496622-152496644 TACAGAAAAGAGCCTGAAGCTGG - Intergenic
965683668 3:171278422-171278444 TAGGCCAAAGACTCAGCAGCTGG + Intronic
966048065 3:175577510-175577532 TAGGGAGAAGATTTTGAAACAGG + Intronic
967217745 3:187224713-187224735 TAGGGATGAGACTCTGAAGTGGG + Intronic
968136115 3:196220655-196220677 GCGGGAAAAGAGTCTGAGGCAGG + Intronic
971552122 4:27970531-27970553 CAGAGCAAAGATTCTGAAGCAGG - Intergenic
971643270 4:29162794-29162816 TAGGGAAGAGACCCTGTAGATGG - Intergenic
971724430 4:30291491-30291513 TAGAGCAAAGATTCTGAAGCAGG - Intergenic
975204926 4:71634559-71634581 TAGGGGAAGGACACAGAAGCAGG - Intergenic
975902704 4:79171567-79171589 TATAGTAAAGACTCTGAAGGGGG + Intergenic
976106617 4:81625796-81625818 AAGGGCAAAGGCTCTGAGGCAGG - Intronic
976542039 4:86289180-86289202 TAGAGAAAAGGCCCTGAGGCAGG + Intronic
977113155 4:92986191-92986213 AAGGGAAAAGTATCTGAAGAAGG + Intronic
978026877 4:103887406-103887428 GAGTGAAATGACTCAGAAGCAGG - Intergenic
978192601 4:105932189-105932211 TAGGGAAAAAAATCTTAAGTTGG + Intronic
978420134 4:108523454-108523476 CAGGAAAGAGACTCGGAAGCAGG + Intergenic
981849936 4:149218436-149218458 TAGGGGGAAGACACAGAAGCTGG + Intergenic
982885969 4:160783265-160783287 TAGGGGAAAGACACAGCAGCAGG - Intergenic
983583404 4:169331103-169331125 TAGGGAAACGACACAGCAGCAGG + Intergenic
984372078 4:178881507-178881529 TGTGGAAAAGACTTTGAAACCGG + Intergenic
984607901 4:181805953-181805975 TAGGGGAGGGACTCTGAATCCGG - Intergenic
985880492 5:2635573-2635595 TGGGGAAATGACCCTGCAGCGGG - Intergenic
986603670 5:9499905-9499927 TGGGGAAAAAAGTCTGAAGCTGG + Intronic
987858288 5:23450074-23450096 TAGGGCAAAGACTTTGAAGTTGG + Intergenic
991510553 5:67371934-67371956 TATGGAATAGATTATGAAGCTGG + Intergenic
991973144 5:72160268-72160290 TTTGGAAAAGACTCTGAAAAAGG + Intronic
993795850 5:92267509-92267531 TAGAGGAAAGACACCGAAGCTGG + Intergenic
994010321 5:94894786-94894808 TAGGGAACAGACGCACAAGCTGG - Exonic
994888971 5:105604894-105604916 TAGGAAAAAGACCCTGAATTAGG + Intergenic
996965603 5:129304461-129304483 TAGGGAAAAGACACAGCAGTAGG - Intergenic
997762968 5:136468081-136468103 AAGTGCAAAGACCCTGAAGCAGG - Intergenic
999118586 5:149187884-149187906 TAGGGAAACGACACAGCAGCAGG + Intronic
1001367813 5:171161958-171161980 TAGGGCAAAGAAGCTGATGCTGG - Intronic
1001637639 5:173223483-173223505 CAGTGCAAAGACTCTGAGGCAGG + Intergenic
1003230133 6:4244272-4244294 TATGGAAAAGACTTTGGAACTGG - Intergenic
1003269898 6:4599140-4599162 TATGTTAAAGACTCTGAAACTGG + Intergenic
1004761488 6:18671539-18671561 AAGGGCAAGGACTCTGAGGCAGG - Intergenic
1004995992 6:21193668-21193690 AAGGGAAAAAAGTCTGAAGAGGG - Intronic
1006452631 6:34113974-34113996 CAGTGCAAAGACCCTGAAGCAGG - Intronic
1007732650 6:43958072-43958094 GAAGGTAAAGACTCTAAAGCTGG + Intergenic
1007809463 6:44475946-44475968 TAAGGTAAAGCCTGTGAAGCAGG - Intergenic
1008147001 6:47903991-47904013 AAGGGCAAAGGCACTGAAGCAGG + Intronic
1009949213 6:70376192-70376214 TGGGGAAAAGAAACTGTAGCGGG + Intergenic
1010656973 6:78523045-78523067 TAGGGAAAAGATTCTAACCCAGG + Intergenic
1010685797 6:78854135-78854157 TTGGGAAAAGAAACTGAGGCAGG + Intergenic
1012563450 6:100616633-100616655 TGGGGGAAAAAATCTGAAGCAGG - Intronic
1012929284 6:105299666-105299688 TAGGAAAAAAACACTGAAACAGG - Intronic
1012992701 6:105942211-105942233 AAATCAAAAGACTCTGAAGCAGG - Intergenic
1013310104 6:108885819-108885841 TATGGAAGAGACTATAAAGCAGG + Intronic
1013412577 6:109894592-109894614 AAGGGAGAAGAATCTGAAGGGGG + Intergenic
1013771440 6:113632381-113632403 TAGGGGAAAGACTGAAAAGCTGG + Intergenic
1013981681 6:116137413-116137435 GAGTGAGAAGATTCTGAAGCTGG - Intronic
1014939339 6:127419831-127419853 TAGGCAAAAGAATCTGAGGTTGG + Intergenic
1015448685 6:133339184-133339206 TTGGGAAAAGGAACTGAAGCAGG + Intronic
1015457318 6:133441556-133441578 TAGGGGAAAGACACGGCAGCAGG - Intronic
1015756083 6:136608197-136608219 AAGGGAACAGACTCCGAATCAGG + Intronic
1016443937 6:144113339-144113361 AACGAAAAAGACTCTGAAGCAGG - Intergenic
1019173246 6:170146633-170146655 TAGGAAACAAACTCTGAAGCAGG + Intergenic
1019830725 7:3326510-3326532 TAGGGTAAATACTTTGAAGTAGG + Intronic
1024167431 7:46748779-46748801 GAGGGCAAAGACCCTGAAGCAGG - Intronic
1028081483 7:86583345-86583367 AAGTGAAAACACTCTGAATCAGG - Intergenic
1028901246 7:96102637-96102659 ATGGGAAAAGACTTTGCAGCAGG + Intronic
1031458144 7:122010343-122010365 GAGGGAAAAGACATTGAAGAAGG + Exonic
1031541453 7:122999773-122999795 TAGGGAAGGGACTCTGAATCTGG + Intergenic
1031632514 7:124061764-124061786 AAGGTAAAGGACTCTGAAGTGGG - Intergenic
1031986762 7:128168510-128168532 CAGGGAAGAGACCCTGGAGCAGG - Intergenic
1032459716 7:132101683-132101705 AAGGAAAATGGCTCTGAAGCTGG - Intergenic
1035296559 7:157870676-157870698 TATGGAAGAGATTCTGAAGAAGG - Intronic
1035411282 7:158644659-158644681 CAGGGGAAGGACTCTGAAACAGG - Intronic
1035473954 7:159129175-159129197 GAGGGAACAGAGTGTGAAGCTGG - Intronic
1035473966 7:159129231-159129253 GAGGGAACAGAGTGTGAAGCTGG - Intronic
1035473988 7:159129301-159129323 GAGGGAACAGAGTGTGAAGCTGG - Intronic
1035474013 7:159129413-159129435 GAGGGAACAGAGTGTGAAGCTGG - Intronic
1035474026 7:159129469-159129491 GAGGGAACAGAGTGTGAAGCTGG - Intronic
1035474038 7:159129525-159129547 GAGGGAACAGAGTGTGAAGCTGG - Intronic
1035474065 7:159129637-159129659 GAGGGAACAGAGTGTGAAGCTGG - Intronic
1035474079 7:159129693-159129715 GAGGGAACAGAGTGTGAAGCTGG - Intronic
1035474092 7:159129749-159129771 GAGGGAACAGAGTGTGAAGCTGG - Intronic
1035474107 7:159129805-159129827 GAGGGAACAGAGTGTGAAGCTGG - Intronic
1035474119 7:159129861-159129883 GAGGGAACAGAGTGTGAAGCTGG - Intronic
1035474141 7:159129931-159129953 GAGGGAACAGAGTGTGAAGCTGG - Intronic
1036213190 8:6858947-6858969 ATGAGAAAAGACTCTGAAGATGG - Intergenic
1037419887 8:18690797-18690819 AAGGGAAGGGGCTCTGAAGCTGG - Intronic
1037520286 8:19674444-19674466 AAGGAAAAAGACCCTGAGGCAGG + Intronic
1038988064 8:32835082-32835104 AATGGAAAAGACTCAGATGCAGG - Intergenic
1040665050 8:49621669-49621691 TAGGGAAATGACACAGCAGCAGG + Intergenic
1044061084 8:87636520-87636542 TAGGGAAACGACACAGCAGCAGG + Intergenic
1044403978 8:91805822-91805844 TAGGATATAAACTCTGAAGCTGG - Intergenic
1045235517 8:100349819-100349841 TATGGAAAAGACTCCTAACCAGG + Intronic
1045469865 8:102502607-102502629 TGGGAATAAGACTCTGATGCGGG - Intergenic
1045748930 8:105458769-105458791 AAGAGCAAAGACTCTGAAGATGG - Intronic
1045784516 8:105904700-105904722 TACGGATAAGACTCTGAGCCAGG + Intergenic
1045899571 8:107261407-107261429 TAAGGAAAAGAACATGAAGCCGG + Intronic
1047668471 8:127118627-127118649 CAGGGCAAAGCCTCTGAAGCAGG - Intergenic
1048364224 8:133724287-133724309 TAGTGCAAAAACTCTGAGGCAGG - Intergenic
1049390597 8:142368017-142368039 TAGGGAAAAGTTTCCCAAGCAGG + Intronic
1050176241 9:2872097-2872119 TAGGGAAAAGACCTTGAACTGGG + Intergenic
1051121626 9:13758646-13758668 TATGAAATAGACTCTGAAACAGG - Intergenic
1052132987 9:24872929-24872951 TAGGGTAAATACTCAGAAGTGGG + Intergenic
1058153767 9:101489160-101489182 AAGAGAATGGACTCTGAAGCCGG - Exonic
1061041197 9:128141743-128141765 TAAGAAACAGACTCTGAGGCCGG - Intergenic
1061779178 9:132985545-132985567 TAGGGAACAGACTCTGGGCCAGG + Intronic
1187227493 X:17387674-17387696 AAGAGAGTAGACTCTGAAGCTGG + Intronic
1189029542 X:37436680-37436702 TGGGGAAAATATTCTGAATCTGG - Intronic
1189204605 X:39226944-39226966 AAGGGAAAAGGCACTGGAGCTGG + Intergenic
1190771834 X:53521231-53521253 TAGGGAAAAGACACAGCAGCAGG + Intergenic
1192334088 X:70203006-70203028 TAAAGCAAAGACTCTAAAGCAGG - Intronic
1194816375 X:98446788-98446810 TTGGGCAAAGAAACTGAAGCCGG - Intergenic
1195004286 X:100671083-100671105 TAGGGACAGGACTCTGAGGTGGG + Exonic
1195138961 X:101939543-101939565 GCAGGAAAAGACTCTAAAGCAGG + Intergenic
1195731527 X:107973175-107973197 TAGCGCAAAGTCTCTGAAGTAGG + Intergenic
1196064902 X:111453400-111453422 TAGTGAAAAGGCTCTGAGGCGGG + Intergenic
1196717190 X:118823456-118823478 TAGGGAAAAGACGGGGAAGAGGG - Intergenic
1198948518 X:142042083-142042105 TAGGGGAAAGACACAGCAGCAGG - Intergenic
1200802702 Y:7400859-7400881 TAGGGGAAGGACACAGAAGCAGG + Intergenic