ID: 1166538581

View in Genome Browser
Species Human (GRCh38)
Location 19:43591498-43591520
Sequence CCTTCTGTCCTGAAGGGAGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 438
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 417}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166538581_1166538594 30 Left 1166538581 19:43591498-43591520 CCAACTCCCTTCAGGACAGAAGG 0: 1
1: 0
2: 1
3: 19
4: 417
Right 1166538594 19:43591551-43591573 GGTATCAGGATTCCTGGCCAGGG 0: 1
1: 0
2: 0
3: 10
4: 171
1166538581_1166538593 29 Left 1166538581 19:43591498-43591520 CCAACTCCCTTCAGGACAGAAGG 0: 1
1: 0
2: 1
3: 19
4: 417
Right 1166538593 19:43591550-43591572 AGGTATCAGGATTCCTGGCCAGG 0: 1
1: 0
2: 1
3: 14
4: 174
1166538581_1166538589 16 Left 1166538581 19:43591498-43591520 CCAACTCCCTTCAGGACAGAAGG 0: 1
1: 0
2: 1
3: 19
4: 417
Right 1166538589 19:43591537-43591559 CCATGGTTCCCAAAGGTATCAGG 0: 1
1: 0
2: 1
3: 11
4: 88
1166538581_1166538591 24 Left 1166538581 19:43591498-43591520 CCAACTCCCTTCAGGACAGAAGG 0: 1
1: 0
2: 1
3: 19
4: 417
Right 1166538591 19:43591545-43591567 CCCAAAGGTATCAGGATTCCTGG 0: 1
1: 0
2: 1
3: 9
4: 217
1166538581_1166538586 -1 Left 1166538581 19:43591498-43591520 CCAACTCCCTTCAGGACAGAAGG 0: 1
1: 0
2: 1
3: 19
4: 417
Right 1166538586 19:43591520-43591542 GGTCTAGATGTCATTCACCATGG 0: 1
1: 0
2: 0
3: 10
4: 82
1166538581_1166538587 9 Left 1166538581 19:43591498-43591520 CCAACTCCCTTCAGGACAGAAGG 0: 1
1: 0
2: 1
3: 19
4: 417
Right 1166538587 19:43591530-43591552 TCATTCACCATGGTTCCCAAAGG 0: 1
1: 0
2: 1
3: 14
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166538581 Original CRISPR CCTTCTGTCCTGAAGGGAGT TGG (reversed) Exonic
901474120 1:9477372-9477394 CCTTCTGTACTTAAGTTAGTTGG + Intergenic
902730411 1:18365290-18365312 CCTGCTGTCCTGTAGGGGGCCGG - Exonic
904219118 1:28950566-28950588 GCTACTGTTCTGAAGGGAGCAGG + Intronic
905354343 1:37370694-37370716 CCTTCATTCCTGAAGGGTCTGGG - Intergenic
906050746 1:42869320-42869342 CCTTCATTCCTGAAGGGTCTGGG - Intergenic
906879921 1:49578366-49578388 CCTTCATTCCTGAAGGGTCTGGG - Intronic
907853455 1:58278856-58278878 CCTTCTGGCCTGAAGTGGTTAGG - Intronic
908001295 1:59682984-59683006 CCATCTGTGGTGAAAGGAGTTGG - Intronic
908024528 1:59936611-59936633 CCTAATGTCCTGGAGGAAGTAGG - Intergenic
908074383 1:60498082-60498104 CTTGCAGTCCAGAAGGGAGTGGG + Intergenic
909577185 1:77187744-77187766 CCTTCATTCCTGAAGGGTCTGGG - Intronic
909811194 1:79933248-79933270 CCTTCATTCCTGAAGGGTCTGGG - Intergenic
910266141 1:85339868-85339890 CCTTCGGTCTTGAAGGGATTAGG - Intronic
910791546 1:91056237-91056259 CCTTCATTCCTGAAGGGTCTGGG + Intergenic
911507739 1:98774406-98774428 CCTTCATTCCTGAAGGGTCTGGG - Intergenic
912050443 1:105523030-105523052 CCTTCATTCCTGAAGGGTCTGGG + Intergenic
912251770 1:108019569-108019591 CCTTCATTCCTGAAGGGTCTGGG + Intergenic
912415718 1:109507306-109507328 CCTCCTGACCTCAAGGGAATTGG - Exonic
914830347 1:151166457-151166479 TCTTCTTTTCTGCAGGGAGTAGG - Exonic
914905400 1:151739682-151739704 GCTTCAGTCCTGATGGGGGTGGG - Intergenic
915709914 1:157885550-157885572 CCTTCATTCCTGAAGGGTCTGGG - Intronic
915908889 1:159900049-159900071 CCTTGTGTCCTGAATTGGGTGGG - Intronic
916017082 1:160759735-160759757 CCTTCATTCCTGAAGGGCCTGGG + Intergenic
918815303 1:189173105-189173127 CCTTCATTCCTGAAGGGTCTGGG - Intergenic
918958497 1:191239846-191239868 CCTTCATTCCTGAAGGGTCTGGG - Intergenic
919000479 1:191825966-191825988 CCTTCATTCCTGAAGGGTGTGGG + Intergenic
919318227 1:196001257-196001279 CCTTCATTCCTGAAGGGTCTGGG - Intergenic
920068706 1:203287436-203287458 CCCTCTGTCCCCAGGGGAGTGGG + Intergenic
921417691 1:214909807-214909829 CTTTCTGTAATTAAGGGAGTTGG - Intergenic
922780792 1:228250698-228250720 CCTTCATTCCTGAAGGGTCTAGG + Intronic
1063384809 10:5609493-5609515 CCTTAAGTCCTGGAGGTAGTGGG - Intergenic
1063958897 10:11290182-11290204 CCTTCAGTCCTTCAGGGACTTGG + Intronic
1064074391 10:12257302-12257324 CCTTCTGTCCTGATGACACTGGG + Intergenic
1064517325 10:16165872-16165894 CCTTCATTCCTGAAGGGTCTGGG + Intergenic
1065962888 10:30748592-30748614 CTTTCTGTATTGAAGGGGGTGGG - Intergenic
1066217011 10:33297775-33297797 CCCTCTGTCCTGACGGCAGAGGG + Intronic
1067053543 10:43038634-43038656 CCTTCTGCCCTGGATGCAGTGGG + Intergenic
1067125236 10:43510328-43510350 CCTTCATTCCTGAAGGGTCTGGG + Intergenic
1067453966 10:46400985-46401007 CCTTCTGTACTGATGAGAATGGG - Intergenic
1067633235 10:47983642-47983664 CCTTCTGTACTGATGAGAATGGG + Intergenic
1067682870 10:48451308-48451330 CCTGCTGTCCTGCCTGGAGTTGG - Intronic
1067817718 10:49495169-49495191 CCTTCAGTCTTGCTGGGAGTTGG + Intronic
1068007399 10:51407680-51407702 CCTTCATTCCTGAAGGGTCTGGG + Intronic
1068223844 10:54080821-54080843 CCTTCTGTACTGTAGGAAGCTGG - Intronic
1070852029 10:79572174-79572196 CCTTCAAGCCAGAAGGGAGTGGG + Intergenic
1071499696 10:86194703-86194725 CCTTGTGTTCTAAGGGGAGTGGG - Intronic
1071937941 10:90551162-90551184 CCTTCATTCCTGAAGGGTCTGGG - Intergenic
1071942519 10:90605871-90605893 CCTTCATTCCTGAAGGGTCTGGG + Intergenic
1071946858 10:90655793-90655815 CCTTCATTCCTGAAAGGTGTGGG + Intergenic
1073557620 10:104467804-104467826 CCTTCAATCCTGAAGGGTCTGGG - Intergenic
1076428364 10:130383430-130383452 CCTCATGTCCTGCTGGGAGTGGG + Intergenic
1076542176 10:131221140-131221162 CCCTGTGGCCTGCAGGGAGTTGG - Intronic
1076797002 10:132803244-132803266 CCTTCTGTCCTGAGGGTTGTGGG + Intergenic
1077265987 11:1650519-1650541 CGTCCTGTCCTGAAGGGATGGGG + Intergenic
1077296452 11:1828528-1828550 CTTTCTGTCCTCAGGGGACTGGG + Intronic
1077864131 11:6209257-6209279 AATTTTGTCCTGAAGGCAGTGGG - Intronic
1078820662 11:14877768-14877790 CCTTCTGTCCTGGGGGGCCTTGG - Exonic
1081378547 11:42387792-42387814 CCTTCATTCCTGAAGGGTCTGGG - Intergenic
1081609328 11:44549774-44549796 CCTTCATTCCTGAAGGGCCTGGG - Intergenic
1082836077 11:57650969-57650991 CCTTCATTCCTGAAGGGTCTGGG - Intronic
1082944703 11:58745830-58745852 CCTTCTGTTATCAATGGAGTAGG + Intergenic
1083613455 11:64015220-64015242 CCTTCTGTCTTGGTGGGGGTGGG - Intronic
1084003773 11:66312887-66312909 TCTTCTGTTCTGCAGCGAGTAGG + Intergenic
1085237011 11:75023089-75023111 GCTTGTGGCCTGCAGGGAGTTGG - Intergenic
1085878805 11:80441039-80441061 TCCTCTGTCCTGCAGTGAGTTGG - Intergenic
1085937874 11:81171803-81171825 CCTTCATTCCTGAAGGGTCTGGG + Intergenic
1088097460 11:106117045-106117067 CCTTCATTCCTGAAGGGTCTGGG - Intergenic
1088157801 11:106829883-106829905 CCTTCAGTCCTGAAGGATCTGGG - Intronic
1088449599 11:109967194-109967216 CCTTCATTCCTGAAGGGTCTGGG - Intergenic
1088836915 11:113585266-113585288 CCTTCATTCCTGAAAGGTGTGGG - Intergenic
1089903876 11:122015501-122015523 CCTTCACTCCTGAAGGGTCTGGG - Intergenic
1090209223 11:124906170-124906192 CCTTCATTCCTGAAGGGTCTGGG + Intergenic
1090221355 11:125029748-125029770 CCTTCACTCCTGAAGGGGCTGGG + Intronic
1091052005 11:132380625-132380647 CCTTCATTCCTGAAGGGTCTGGG - Intergenic
1092272637 12:7035566-7035588 CCTTCATTCCTGCAGGGACTGGG - Intronic
1092283248 12:7113484-7113506 CCTTCTGTCCTGAAAGGGGAAGG + Intergenic
1092381883 12:8003288-8003310 CCTTCATTCCTGAAGGGTCTGGG - Intergenic
1093031548 12:14293730-14293752 CCTTCATTCCTGAAGGGTCTGGG + Intergenic
1093036605 12:14337565-14337587 CCTTCATTCCTGAAGGGTCTGGG - Intergenic
1093948070 12:25133534-25133556 TCTTCTGTGCTGAAGGGGGAAGG - Intronic
1093968067 12:25347821-25347843 AATTCTGCCTTGAAGGGAGTTGG + Intergenic
1094102790 12:26781147-26781169 CCTTCATTCCTGAAGGGTCTGGG - Intronic
1095089164 12:38088002-38088024 CCATCTGGCATGCAGGGAGTAGG - Intergenic
1095155167 12:38843831-38843853 CCTTCTGTCCTGCAAGGAGCTGG + Intronic
1095751862 12:45721410-45721432 CCTTCAGTTCAGTAGGGAGTGGG + Intergenic
1095844137 12:46728097-46728119 CCTTCATTCCTGAAGGGTCTGGG + Intergenic
1096864798 12:54556162-54556184 GCTGCTATCCTGAAGAGAGTTGG - Intronic
1097564397 12:61250546-61250568 CCTTCATTCCTGAAGGGTCTGGG + Intergenic
1097614727 12:61870498-61870520 CCTTCTGTTCTGAACAGAGAAGG - Intronic
1097821088 12:64130030-64130052 CCTTCATTCCTGAAGGGTCTGGG + Intronic
1098736363 12:74110882-74110904 CCTTCATTCCTGAAGGGCCTGGG + Intergenic
1098891521 12:76014183-76014205 CCTCCTGCCCTGAAAGGAATAGG + Intergenic
1099400989 12:82203876-82203898 CCTTCATTCCTGAAGGGTCTGGG + Intergenic
1099632486 12:85168194-85168216 CCTTCATTCCTGAAGGGGCTGGG + Intronic
1100667642 12:96771828-96771850 CCTTCTGTCCTGCATGGAGAAGG - Intronic
1101264398 12:103068009-103068031 CCTTCATTCCTGAAGGGTCTGGG - Intergenic
1101534349 12:105603868-105603890 CCTTCATTCCTGAAGGGTCTGGG + Intergenic
1103989157 12:124786653-124786675 CCTTGTGTCCTGGAGGGAGGAGG - Intronic
1104003711 12:124877475-124877497 CCTTCTTTCTTGAAGGCAGAGGG + Intronic
1104148057 12:126054529-126054551 CCTTCATTCCTGAAGGGTCTAGG - Intergenic
1105846521 13:24298690-24298712 CCTGCTGTCCTCATGGCAGTGGG - Intronic
1106068234 13:26379905-26379927 ACTTCTGTCATTAAGGGAGAGGG + Intronic
1107604940 13:42048315-42048337 CCTGCTGTCCAGAAGTGAGAGGG + Intronic
1111123238 13:83880627-83880649 CCATTTGTCTTGAAAGGAGTTGG + Exonic
1111441125 13:88283605-88283627 CCTTCATTCCTGAAGGGTTTTGG - Intergenic
1112218021 13:97455987-97456009 CCCTCAGTCCCGAAGAGAGTGGG - Intronic
1112249680 13:97768450-97768472 CCTTCGTTCCTGAAGGGTTTGGG + Intergenic
1112875837 13:104037310-104037332 CCTTCATTCCTGAAGGGTCTGGG + Intergenic
1114628906 14:24147093-24147115 CGGTCTGTCCTGAAGGCAGAGGG - Exonic
1115015508 14:28607686-28607708 CCTTCTGGCCAGAAGAGGGTTGG - Intergenic
1115059957 14:29175768-29175790 CCTTCATTCCTGAAGGGGCTGGG - Intergenic
1115130939 14:30051147-30051169 CCTTCTTTCCCGAAGGGTCTGGG - Intronic
1116218766 14:42054411-42054433 CCTTCATTCCTGAAGGGTCTGGG - Intergenic
1116531212 14:45976355-45976377 CCTTCATTCCTGAAGGGTCTGGG + Intergenic
1117634388 14:57726263-57726285 CCTTCATTCCTGAAGGGTCTGGG - Intronic
1118346692 14:64946230-64946252 CCTTCTTTCCTGAGGGGGCTAGG + Exonic
1119788406 14:77329126-77329148 CTGTCTGTCCTGAAGCAAGTGGG + Exonic
1120555769 14:85928761-85928783 CCTTCATTCCTGAAGGGTCTGGG + Intergenic
1120594432 14:86416552-86416574 CCTTCCTTCCTGAAGGGTCTTGG + Intergenic
1121251166 14:92500398-92500420 GCGTCTGTCCTGAATGGACTTGG - Exonic
1122246654 14:100407921-100407943 ACTCCTATCCTGATGGGAGTGGG + Intronic
1123128381 14:105966091-105966113 CCTTCATTCCTGAAGGGTCTGGG - Intergenic
1123408905 15:20042248-20042270 CCTTCATTCCTGAAGGGTCTGGG - Intergenic
1123518236 15:21048958-21048980 CCTTCATTCCTGAAGGGTCTGGG - Intergenic
1125595987 15:40886385-40886407 CCTGCAGTCCTGAGGGCAGTGGG + Intergenic
1126283857 15:46988127-46988149 CCTTCATTCCTGAAGGGTCTAGG - Intergenic
1126841099 15:52718156-52718178 AGTTCTGCCCTGTAGGGAGTTGG - Intergenic
1130115180 15:81000533-81000555 GCTTCTGGGCTGAAGGGAGGAGG - Intergenic
1131967025 15:97855131-97855153 CCTTCATTCCTGAAGGGTCTGGG - Intergenic
1135804924 16:25534179-25534201 GCCTCTGTTCTGAAGGGAGGTGG + Intergenic
1136228840 16:28875561-28875583 CCTTGTGTCCTGTAGGGAGATGG + Intergenic
1136586057 16:31185569-31185591 CCATGTGTCCTCTAGGGAGTTGG + Intronic
1138163034 16:54774060-54774082 ACATGTGTCCTGAAGGGAGCAGG + Intergenic
1138614794 16:58156860-58156882 CCTGCTGTCCTACAGGCAGTGGG + Intergenic
1141345245 16:83238872-83238894 TCTTCTGTCCTGATGTTAGTTGG + Intronic
1142182713 16:88679019-88679041 CCTGTTGTCCTGATGGGAGGTGG - Intronic
1142434075 16:90046305-90046327 CCTTCTGGCTGGAAGGGAGGGGG + Intergenic
1142717060 17:1752950-1752972 CCCTCTGTCCTAGAGGAAGTTGG + Intronic
1143413543 17:6728050-6728072 CCTGCTGTCCAGAAGGCAGCAGG - Intergenic
1145795610 17:27653807-27653829 CCTGCTGTCCTCAGGGAAGTGGG + Intergenic
1146238288 17:31188109-31188131 CCTTCATTCCTGAAGGGTCTGGG - Intronic
1148635428 17:49145625-49145647 CCTTCATTCCTGAAGGGTCTGGG + Intronic
1149062976 17:52445953-52445975 CATTCTGTACTGTAGGCAGTTGG + Intergenic
1152148916 17:78586811-78586833 CGTGGTGACCTGAAGGGAGTTGG + Intergenic
1152477389 17:80526991-80527013 GCCTCTGTCCTGAGGGGAGAAGG - Intergenic
1153089982 18:1332042-1332064 CCTTCATTCCTGAAGGGTCTGGG - Intergenic
1153361242 18:4199202-4199224 CCTTCTGTCCTGGAGGAGGGTGG + Intronic
1153684972 18:7536677-7536699 CCTTCATTCCTGAAGGGTCTGGG + Intergenic
1154068717 18:11132937-11132959 CCTTCATTCCTGAAGGGTTTGGG - Intronic
1154252304 18:12754874-12754896 CCTTCATTCCTGAAGGGTCTGGG + Intergenic
1156582647 18:38395145-38395167 CCTTCATTCCTGAAGGGCCTGGG - Intergenic
1157341467 18:46781865-46781887 CCTTCATTCCTGAAGGGTCTGGG - Intergenic
1159262061 18:66026904-66026926 CCTTCATTCCTGAAGGGTCTGGG + Intergenic
1159850010 18:73516086-73516108 CCTTCATTCCTGAAGGGTCTGGG - Intergenic
1160092701 18:75841899-75841921 CCTTCATTCCTGAAGGGTCTGGG - Intergenic
1161168202 19:2799885-2799907 GCTTCTGTGCTGAAGGGCGGCGG + Intronic
1161905094 19:7150547-7150569 CCCTCTGTCCTCAAAGGCGTTGG - Intronic
1162936674 19:13984751-13984773 CCTTCAGTCCTGCCGGGGGTCGG - Intronic
1163104848 19:15117280-15117302 CTCTCTGTCCTGAGGGCAGTGGG + Intronic
1164973083 19:32549148-32549170 CCTTCATTCCTGAAGGGTCTGGG - Intergenic
1165071720 19:33259665-33259687 CCTTGTGACCGGAAGGGAGATGG - Intergenic
1165798791 19:38535127-38535149 CTGTCTCTCCTGGAGGGAGTGGG - Exonic
1166538581 19:43591498-43591520 CCTTCTGTCCTGAAGGGAGTTGG - Exonic
1168539072 19:57195528-57195550 CCTTCATTCCTGAAGGGTCTGGG + Intronic
1168713213 19:58513300-58513322 CCCTCAGTCCTGTGGGGAGTAGG - Intergenic
925626088 2:5842927-5842949 CCTGCTCACCTGCAGGGAGTCGG - Intergenic
925704193 2:6668598-6668620 CCTTCTGTGATGGATGGAGTTGG - Intergenic
926810136 2:16748826-16748848 CCTTCATTCCTGAAGGGTCTGGG + Intergenic
927087424 2:19686001-19686023 CCTTCTGATCTGCAGGGTGTGGG + Intergenic
927196980 2:20554885-20554907 AGCTCTGTCCTGAAGGCAGTGGG - Intergenic
927503552 2:23598340-23598362 CACTCTGTCCTGAAGTCAGTGGG - Intronic
929245996 2:39704258-39704280 CCTTCTGTCCAGATGTGAGAGGG - Intronic
929448567 2:42020612-42020634 ATTTCTGTCCTGAGGGGTGTGGG - Intergenic
929559275 2:42945647-42945669 ACATCTGTGCTGAAGGGAGCTGG + Intergenic
930171503 2:48256117-48256139 TCTTCTCTCCTGTAGGGAGGAGG + Intergenic
930294947 2:49543507-49543529 CCTTCATTCCTGAAGGGTCTGGG + Intergenic
930480915 2:51947382-51947404 CCTTCATTCCTGAAGGGTCTGGG + Intergenic
932244715 2:70187139-70187161 CTTTCTGTCATTAAGGGAGGAGG + Intronic
932504528 2:72215927-72215949 CCTTGTGCCCTGAAGGCAATAGG - Intronic
933504530 2:83160905-83160927 CCTTCATTCCTGAAGGGTCTGGG + Intergenic
935235192 2:101132422-101132444 CATACTGTACTGAAGGGAGCAGG - Intronic
935424858 2:102909555-102909577 CCTTCATTCCTGAAGGGTCTGGG + Intergenic
936044258 2:109174098-109174120 CCTGCTGTCCTGAAGCCACTGGG - Intronic
936084034 2:109454346-109454368 CCTTCACTCCTGAAGGGTCTGGG + Intronic
936084716 2:109459429-109459451 CCTTCATTCCTGAAGGGACTGGG + Intronic
938135527 2:128753511-128753533 CCTTCCGTCTTGGAAGGAGTGGG + Intergenic
938297598 2:130188113-130188135 CCTTGTTTCCAGAAGGGACTGGG + Intronic
938459173 2:131486551-131486573 CCTTGTTTCCAGAAGGGACTGGG - Intronic
939377007 2:141381707-141381729 CTTCTTGGCCTGAAGGGAGTAGG + Intronic
939806494 2:146780342-146780364 CCTTCATTCCTGAAGGGTCTGGG - Intergenic
939940207 2:148340191-148340213 CCTTCTGGCATGAAGGTATTGGG - Intronic
940996920 2:160159542-160159564 CCTTCAATCTTGAAGGCAGTGGG - Intronic
941028861 2:160489268-160489290 CCTTATTTCCTTAAGTGAGTGGG - Intronic
941303819 2:163835706-163835728 CCTTCTTCCCTGAAGGTGGTCGG - Intergenic
941330408 2:164172682-164172704 CCTTCATTCCTGAAGGGTCTTGG + Intergenic
941668287 2:168262976-168262998 CCTTCATTCCTGAAGGGTCTGGG - Intergenic
942919895 2:181359742-181359764 ACTTCTTTTCTTAAGGGAGTGGG + Intergenic
943182535 2:184561526-184561548 CCTTCATTCCTGAAGGGTCTGGG - Intergenic
943317675 2:186410443-186410465 CCTTCATTCCTGAAGGGTCTGGG + Intergenic
943385642 2:187201365-187201387 CCTTCATTCCTGAAGGGTCTGGG + Intergenic
943509289 2:188803906-188803928 CCTTCATTCCTGAAGGGTCTGGG - Intergenic
945545097 2:211139998-211140020 CCTTCATTCCTGAAGGGTCTGGG - Intergenic
945717582 2:213378787-213378809 CCTTCATTCCTGAAGGGTCTGGG + Intronic
945725593 2:213469616-213469638 CCTTCATTCCTGAAGGGTCTGGG + Intronic
946533857 2:220606003-220606025 CCTTCATTCTTGAAGGGACTCGG + Intergenic
946703503 2:222435924-222435946 CCTTCATTCCTGAAGGGTCTGGG + Intronic
947174944 2:227356450-227356472 CCTTCAGGCCTGAAGGGTTTGGG + Intronic
1168961116 20:1870649-1870671 CCTTCTTTCCTGAGGAGAGCTGG + Intergenic
1169536810 20:6553303-6553325 CCTTTTGTACAAAAGGGAGTGGG + Intergenic
1169807400 20:9573703-9573725 CCTTCTGTTCTGAGGGCAGGGGG + Intronic
1170982418 20:21226981-21227003 CCTTCCTTCCTGAAGAGTGTGGG - Intronic
1172764084 20:37341821-37341843 GCTTCTGTCCTGGAGGTGGTGGG - Intergenic
1173117657 20:40261317-40261339 CTTTCTGTCCTGAATAGTGTAGG - Intergenic
1173212784 20:41049775-41049797 TCTTCTGTCCTTAAGGAAGTTGG - Intronic
1175445719 20:59018178-59018200 CCTTCTGTCCTCCAGGCGGTGGG + Intergenic
1175576358 20:60063601-60063623 CCTTCTGCAGTGAAGGGAATAGG + Intronic
1176271826 20:64239413-64239435 CCCTCTGTCCTGAGGGGATGGGG - Intronic
1177109121 21:17002752-17002774 CTTTAAGTCTTGAAGGGAGTTGG + Intergenic
1179414877 21:41190651-41190673 CCTTCATTCCTGAAGGGTCTGGG + Intronic
1182686883 22:32128071-32128093 CCTTCTGTGCTGAATGTGGTGGG - Intergenic
1182965940 22:34520961-34520983 CCTTCATTCCTGAAGGGTCTGGG - Intergenic
1183329703 22:37212617-37212639 CCTTGGCTCCTGCAGGGAGTTGG + Intergenic
1184603292 22:45556479-45556501 CCTTCATTCCTGAAGGGTCTGGG + Intronic
1185089175 22:48756320-48756342 CCTTCTGGGGTGAAGGGAGGGGG + Intronic
1185140531 22:49098464-49098486 CCTTCATTCCTGAAGGGTCTGGG - Intergenic
949445873 3:4132944-4132966 CCTTCATTCCTGAAGGGTGTGGG - Intronic
949639162 3:6015405-6015427 CCTTCTTTCCTGAAAGGTCTGGG - Intergenic
950116386 3:10452803-10452825 CCTTCTGTCCAGAAGGAACTTGG + Intronic
951586762 3:24222632-24222654 CCTTCTGCCCTCAAGGAATTTGG + Intronic
952030844 3:29141077-29141099 CACTCTGCCTTGAAGGGAGTAGG + Intergenic
953124119 3:40075417-40075439 CCACCTGTCCTGATGGGAGAAGG + Intronic
953228196 3:41040226-41040248 CCTTCAGTCCTGATAGGATTGGG + Intergenic
956360350 3:68440647-68440669 CCTTCATTCCTGAAGGGTCTGGG + Intronic
956509930 3:69982235-69982257 CCTTCATTCCTGAAGGGTCTGGG - Intergenic
958170154 3:89929082-89929104 AGTTCTCTCCTGAAGGGAGATGG + Intergenic
958487435 3:94730589-94730611 CCTTCATTCCTGAAGGGTCTGGG + Intergenic
958949529 3:100401309-100401331 CCTTCTTTCCTGAAGGTAGAGGG - Exonic
959108456 3:102093467-102093489 CCTTCTGCCTTGAAGCCAGTAGG + Intergenic
959289185 3:104450711-104450733 CCTTCATTCCTGAAGGGTCTGGG + Intergenic
959377221 3:105601996-105602018 CCTTCATTCCTGAAGGGTCTGGG + Intergenic
959998130 3:112700175-112700197 CCTTCATTCCTGAAGGGTCTGGG - Intergenic
961153793 3:124661954-124661976 CCTATTGTCCTGGAGAGAGTGGG - Intronic
963661671 3:148134323-148134345 CCTTCACTCCTGAAGGGTCTGGG - Intergenic
964146763 3:153473220-153473242 CCTTCATTCCTGAAGGGTCTGGG - Intergenic
965811634 3:172596944-172596966 CATTCTGACCTAAAGAGAGTAGG + Intergenic
965995963 3:174883789-174883811 CCTTCATTCCTGAAGGGTCTGGG + Intronic
966044077 3:175529028-175529050 CCTTCATTCCTGAAGGGTCTGGG + Intronic
966275809 3:178166897-178166919 CTTTTTATCCTGAAGGGTGTTGG - Intergenic
968441058 4:624803-624825 CCTGCTGGCCTGCAGGGAGCTGG + Intergenic
968509840 4:990794-990816 CCTTCTGTCCTAGGTGGAGTGGG - Intronic
969302087 4:6303066-6303088 CCTCCTGTCCAGCAGGTAGTGGG + Exonic
970526535 4:16938195-16938217 CCTTCTAGCCTGCAGGTAGTAGG - Intergenic
970644818 4:18108088-18108110 CCTTCATTCCTGAAGGGTTTGGG + Intergenic
971100761 4:23464539-23464561 CCTTCATTCCTGAAGGGTCTGGG + Intergenic
971529488 4:27667200-27667222 CCAAATGTCCTGAAGGGGGTGGG + Intergenic
972085467 4:35208968-35208990 CCTTCATTCCTGAAGGGTCTGGG - Intergenic
972095748 4:35344682-35344704 CCTTCACTCCTGAAGTGTGTGGG - Intergenic
972556065 4:40182355-40182377 CCTTTTGTCCTGTAGGCAGTAGG + Intergenic
973120760 4:46519033-46519055 CCTTCATTCCTGAAGGGTCTGGG + Intergenic
973339925 4:48993501-48993523 CCTTCTGTCCTGTAGAGGGCTGG + Intronic
973807502 4:54540142-54540164 CTTTCCCTCCTCAAGGGAGTAGG - Intergenic
974644371 4:64672905-64672927 CCTTCATTCCTGAAGGGTCTGGG + Intergenic
974746724 4:66087407-66087429 CCTTCATTCCTGAAGGGTCTGGG + Intergenic
976392675 4:84521981-84522003 CCATCTGTCCACAAGGCAGTAGG + Intergenic
977031938 4:91894044-91894066 CCTTCATTCCTGAAGGGTCTAGG - Intergenic
977489838 4:97698191-97698213 CCTTCATTCCTGAAGGGTCTGGG + Intronic
977919265 4:102625588-102625610 CCTTCTGGGCTTCAGGGAGTTGG - Intergenic
977930146 4:102741937-102741959 CCTTCATTCCTGAAGGGTCTGGG + Intronic
978341315 4:107723667-107723689 CCTTCATTCCTGAAGGGTCTGGG + Intergenic
979138803 4:117146664-117146686 CCTTCATTCCTGAAGGGTCTGGG - Intergenic
979197096 4:117932963-117932985 CATTCTCTCCAGAAGGGGGTTGG - Intergenic
979381096 4:120007653-120007675 ACTTCTGAGCTGCAGGGAGTAGG + Intergenic
979898164 4:126187188-126187210 CCTTCATTCCTGAAGGGTCTGGG + Intergenic
980182114 4:129414149-129414171 TCTTCAGGCCTGAAGGGAGGAGG + Intergenic
980629768 4:135416150-135416172 CCTTCATTCCTGAAGGGTCTCGG - Intergenic
981312549 4:143311347-143311369 CCTTTCTTCCTGAAGGGAGGAGG + Intergenic
982787980 4:159558489-159558511 CCTTCATTCCTGAAGGGTCTGGG + Intergenic
982835796 4:160118502-160118524 CCTTCAATCCTGAAGGGTCTGGG - Intergenic
983027660 4:162757168-162757190 CCTTCATTCCTGAAGGGTCTGGG - Intergenic
983582951 4:169326731-169326753 CCTTCATTCCTGAAGGGTCTGGG - Intergenic
985028030 4:185758675-185758697 GCTTTTGCACTGAAGGGAGTAGG - Intronic
986789801 5:11148670-11148692 CCTTCTGTCCCCGTGGGAGTGGG + Intronic
986938083 5:12916869-12916891 CCTTCATTCCTGAAGGGTCTGGG + Intergenic
987290684 5:16505628-16505650 CCAGCTGTCCTGAAGGGAGAGGG - Intronic
987466354 5:18276370-18276392 CCTTCACTCCTGAAGGGTCTGGG - Intergenic
988189029 5:27903122-27903144 CCTTCGTTCCTGAAGGGTCTGGG - Intergenic
988229007 5:28450002-28450024 CCTTCATTCCTGAAGGGTCTGGG - Intergenic
988785275 5:34561073-34561095 CCTTCATTCCTGAAGGGTCTGGG + Intergenic
989486126 5:41994507-41994529 CCTTCATTCCTGAAGGGTCTGGG + Intergenic
992243217 5:74791738-74791760 CCTTCATTCCTGAAGGGTCTGGG - Intronic
992351692 5:75936153-75936175 CAATCTGGCCTCAAGGGAGTAGG + Intergenic
992568411 5:78025711-78025733 CTTACTGTCCTGAAGACAGTGGG + Intronic
992811085 5:80389408-80389430 CCGTCTGTCCTAAAGGGAAGTGG - Intergenic
993528624 5:88998556-88998578 CCTGCTGTCCTGGAAGAAGTAGG + Intergenic
993537550 5:89105381-89105403 CCTTCATTCCTGAAGGGTCTGGG + Intergenic
994604983 5:101955583-101955605 CCTTCACTCCTGAAGGGTTTAGG + Intergenic
995183884 5:109252344-109252366 CCTTCTGTTCTGCTGGGGGTGGG + Intergenic
996381480 5:122866549-122866571 CCTTCATTCCTGAAGGGTCTGGG + Intronic
996391961 5:122971906-122971928 CCTTCATTCCTGAAGGGTCTGGG + Intronic
996681624 5:126233726-126233748 CCTTCTGTTCTCAAGGTATTTGG - Intergenic
996908704 5:128632078-128632100 CCTTCATTCCTGAAGGGTCTGGG + Intronic
998885592 5:146690804-146690826 CCTTCTGTACTGAAGGTACAGGG - Intronic
999261358 5:150240873-150240895 CCTTCTTTCCAGCAGGGAGAGGG - Intronic
999629117 5:153551920-153551942 CCTTCTTTCTTGAAGGAATTAGG - Intronic
1000949584 5:167464292-167464314 CCCTCTCTCATAAAGGGAGTAGG + Intronic
1001173776 5:169445818-169445840 CCTTCATTCCTGAAGGGTCTGGG - Intergenic
1001218324 5:169876501-169876523 ACTTCTGTCCTGACTGTAGTGGG - Intronic
1001939271 5:175729236-175729258 GCCTCTGTCCTGAGGGCAGTGGG - Intergenic
1002261293 5:177995507-177995529 CCTTCTCTGATGAAGGGAGCTGG - Intronic
1002554477 5:180024795-180024817 CCCTCATTCGTGAAGGGAGTGGG - Intronic
1002998235 6:2306648-2306670 CCTTCATTCCTGAAGGGTCTGGG - Intergenic
1003038292 6:2664111-2664133 CCGTCTGTCCTAAAGGGAAGTGG - Exonic
1004198094 6:13523877-13523899 CCTTCTGTTCTGAGAGGTGTGGG + Intergenic
1004462350 6:15849525-15849547 CCTACTCTCCTGAAGGGCTTTGG - Intergenic
1005857504 6:29873670-29873692 CCTTCTGCCCTGATGGGTCTGGG - Intergenic
1005863299 6:29917776-29917798 CCTTCTGCCCTGATGGGTCTGGG - Intergenic
1005874840 6:30003026-30003048 CCTTCTGCCCTGACGGGTCTGGG - Intergenic
1006040206 6:31246209-31246231 CCTTCATTCCTGAAGGGCATGGG + Intergenic
1006048612 6:31321628-31321650 CCTTCATTCCTGAAGGGTATGGG + Intronic
1006639631 6:35483324-35483346 CCTCCTGTCCTGGTGGGATTTGG - Intronic
1006909102 6:37552509-37552531 CCATCTGGTCTGAAGGGATTTGG - Intergenic
1007805616 6:44443180-44443202 CTTTCAGGCCAGAAGGGAGTGGG - Intronic
1008820640 6:55627009-55627031 CCTTCATTCCTGAAGGGTCTGGG - Intergenic
1009787070 6:68354099-68354121 CCTTCATTCCTGAAGGGTCTGGG + Intergenic
1009866188 6:69400390-69400412 TGTCCTGTCCTGAAGGGAGAAGG + Intergenic
1010291888 6:74147160-74147182 CCTTCATTCCTGAAGGGTCTGGG + Intergenic
1010580560 6:77592369-77592391 CCTTCATTCCTGAGGGGTGTGGG + Intergenic
1011039099 6:83011425-83011447 CCTTCATTCCTGAAGGGTCTGGG + Intronic
1012545989 6:100420085-100420107 TCTCCTGGCCTGAAGGAAGTAGG - Intronic
1012821038 6:104084646-104084668 CCTTCATTCCTGAAGGGTCTGGG - Intergenic
1013623734 6:111917063-111917085 CCTTCATTCCTGAAGGGTCTGGG + Intergenic
1013695827 6:112701481-112701503 CCTTCATTCCTGAAGGGAGATGG + Intergenic
1014052256 6:116968529-116968551 CCTTGTGTCCTGCAGGAAGAAGG + Intergenic
1014473287 6:121842315-121842337 GCTTTTATCCTGAAGGCAGTAGG - Intergenic
1014538615 6:122647896-122647918 CCTTCATTCCTGAAGGGACTGGG + Intronic
1015280431 6:131428093-131428115 GGTTCTGTCCTCAATGGAGTTGG - Intergenic
1016119689 6:140330801-140330823 CCTTCATTCCTGAAGGGTTTGGG + Intergenic
1016206603 6:141474519-141474541 CTTTTTTTTCTGAAGGGAGTTGG + Intergenic
1016419411 6:143869125-143869147 CCTTCATTCCTGAAGGGTCTGGG + Intronic
1017227553 6:152039212-152039234 CCTTCATTCCTGAAGGGTCTGGG + Intronic
1017919088 6:158855944-158855966 CCTTCTGTTCTGAAGTATGTTGG - Intergenic
1018904000 6:168064702-168064724 CCTTCTGTCCTGAAGGCCCAAGG - Intronic
1019042735 6:169119935-169119957 CCTTCAGTCCTGTAGAGAGAGGG - Intergenic
1019149171 6:169992958-169992980 CCTTCTGAGCTGCAGAGAGTGGG + Intergenic
1019577235 7:1743437-1743459 CCTTCCTTCCAGAAGGGAGGTGG + Intronic
1020016107 7:4833091-4833113 CCTGGTGTGCTGCAGGGAGTGGG + Intronic
1021401132 7:20210554-20210576 CATTATTTCCTGAAGGCAGTGGG - Intronic
1021624164 7:22576282-22576304 CCTTCTGTCTTGACAGGAATAGG - Intronic
1021989080 7:26124803-26124825 CCTTCATTCCTGAAGGGTCTAGG - Intergenic
1022844692 7:34198125-34198147 CCCACTCTCCAGAAGGGAGTGGG - Intergenic
1024158956 7:46654874-46654896 CCTTCATTCCTGAAGGGTCTGGG + Intergenic
1024866356 7:53908228-53908250 CCTTCATTCCTGAAGGGTGTGGG - Intergenic
1026046226 7:66907270-66907292 CCTTCATTCCTGAAGGGTCTGGG + Intergenic
1027149594 7:75723477-75723499 TCTTCTGTCCTGGAGGGCCTGGG + Intronic
1027686056 7:81279832-81279854 CCTTCATTCCTGAAGGGTCTGGG - Intergenic
1027756306 7:82217074-82217096 GCTTCTGTCGTTAATGGAGTTGG - Intronic
1028086714 7:86644990-86645012 CCTACAGTCCTGACTGGAGTGGG + Intronic
1029307189 7:99629176-99629198 CCTCCTGTCCTGTAGGCGGTGGG + Exonic
1030192657 7:106824889-106824911 CCTTCATTCCTGAAGGGTCTGGG - Intergenic
1030334200 7:108306778-108306800 CTGTCTGGCCTGAAAGGAGTGGG + Intronic
1030355674 7:108539408-108539430 CCTTCATTCCTGAAGGGTCTGGG - Intronic
1030369018 7:108675925-108675947 CCTTCATTCCTGAAGGGTCTGGG - Intergenic
1031833266 7:126651901-126651923 CCTTCATTCCTGAAGGGTCTTGG - Intronic
1032264514 7:130361735-130361757 CCTTGGGTCATGAAGGAAGTAGG + Intronic
1032435865 7:131899820-131899842 CCTTCACTCTTGAAGGGAGCTGG + Intergenic
1033392518 7:140941306-140941328 CCTTCATTCCTGAAGGGTCTGGG - Intergenic
1034170181 7:149056781-149056803 CCTTCATTCCTGAAGGGTCTGGG - Intergenic
1034432018 7:151045853-151045875 CCTTCTCCCATGGAGGGAGTGGG - Intronic
1034754984 7:153607807-153607829 TCTTCTGTCCTAAAGGGGATGGG + Intergenic
1037617906 8:20536271-20536293 CCATCTGTTCTGAAGGGGTTGGG - Intergenic
1038454193 8:27661775-27661797 CCTTCCCTCCTGAAGGGTCTGGG + Intronic
1039548030 8:38423723-38423745 GCTCCAGTCCTGGAGGGAGTGGG - Intronic
1039785545 8:40831526-40831548 GCTTCTCTCCTCAAGGGACTGGG - Intronic
1039819312 8:41122219-41122241 CCTGCTTTCCTGCAGGCAGTTGG + Intergenic
1040870805 8:52098686-52098708 CCACGTGTCCTGAAGGGAGGAGG + Intergenic
1043105469 8:76104544-76104566 CTTTCATTCCTGAAGGGTGTGGG + Intergenic
1043258268 8:78162050-78162072 CCTTCATTCCTGAAGGGTCTAGG - Intergenic
1044895814 8:96890439-96890461 CCTTCACTCCTGAAGGGTCTGGG + Intronic
1046500478 8:115070087-115070109 CCTTCAGTCCTGAAGGGTCTGGG - Intergenic
1047222283 8:122928163-122928185 CCTTCTGTCCTGGTGGGAGTGGG - Intronic
1047327223 8:123851435-123851457 CCTTCATTCCTGAAGGGTCTGGG + Intergenic
1049418931 8:142508314-142508336 GCTTCTGCCCTGGAGGGTGTAGG + Intronic
1052227839 9:26110261-26110283 ACTTCATTCCTGAAGGGTGTGGG - Intronic
1053523722 9:38807959-38807981 CCTTCATTCCTGAAGGGTCTAGG + Intergenic
1053826274 9:42028021-42028043 CCTTCTGTACTAAAGGAAGATGG + Intronic
1054195951 9:62032373-62032395 CCTTCATTCCTGAAGGGTCTAGG + Intergenic
1054604286 9:67159376-67159398 CCTTCTGTACTAAAGGAAGATGG - Intergenic
1054642454 9:67556316-67556338 CCTTCATTCCTGAAGGGTCTAGG - Intergenic
1055708143 9:79031159-79031181 CCTGCAGTCCTAAAGAGAGTAGG - Intergenic
1055903682 9:81269309-81269331 CCTTCATTCCTGAAGGGTCTGGG + Intergenic
1056254297 9:84782909-84782931 GCTTATGTCCTGAAGTGGGTGGG + Intronic
1056313984 9:85371053-85371075 CCTTCATTCCTGAAGGGCCTGGG + Intergenic
1058124827 9:101179247-101179269 CCTTCATTCCTGAAGGGTCTGGG - Intronic
1058259014 9:102807828-102807850 CCTTCATTCCTGAAGGGTCTAGG + Intergenic
1058543916 9:106040863-106040885 CCTTCATTCCTGAAGGGCCTGGG + Intergenic
1058676925 9:107407981-107408003 GCATCTGACCTGTAGGGAGTGGG - Intergenic
1059644748 9:116253766-116253788 CCTTCTTTACTGAATGGCGTTGG - Intronic
1060153884 9:121305723-121305745 GCTTCTGTCCTGAAAGGCGCTGG + Intronic
1060804864 9:126568858-126568880 CCTTCATTCCTGAAGGGTCTGGG + Intergenic
1061311708 9:129767865-129767887 CCTTCATTCCTGAAGGGTCTGGG + Intergenic
1062135790 9:134927228-134927250 CCTTCATTCCTGAAGGGTCTGGG - Intergenic
1062532343 9:137007446-137007468 CCTGCTCTCCTGCAGGGAGGTGG - Exonic
1203785193 EBV:123700-123722 CCTCCTGTGTTGCAGGGAGTAGG + Intergenic
1185473231 X:397644-397666 TCTTCAGTCCTGGAGGGTGTGGG - Intergenic
1186126595 X:6420899-6420921 CATTCTGTCTTGAATGCAGTAGG + Intergenic
1186194636 X:7098582-7098604 CCTACTGTCCTAAGGGGACTGGG + Intronic
1186279770 X:7978997-7979019 CCTTCATTCCTGAAGGGCCTGGG - Intergenic
1186469495 X:9810255-9810277 CCTTCATTCCTGAAGGGTCTGGG + Intronic
1190765947 X:53475792-53475814 CCTTCATTCCTGAAGGGTCTGGG - Intergenic
1191113271 X:56825075-56825097 CCTTCATTCCTGAAGGGTTTCGG + Intergenic
1191769254 X:64738213-64738235 CCTTCATTCCTGAAGGGTCTGGG + Intergenic
1191941013 X:66482010-66482032 CCTTCATTCCTGAAGGGTCTGGG + Intergenic
1192316349 X:70054687-70054709 CCATCTCTTCTGAAGGGAGGTGG + Intergenic
1192673005 X:73166526-73166548 CCTTCATTCCTGAAGGGTCTGGG + Intergenic
1192891224 X:75392967-75392989 CCTTCATTCCTGAAGGGTCTGGG + Intronic
1193468763 X:81875507-81875529 GCTTCTGGACAGAAGGGAGTGGG - Intergenic
1194082081 X:89481118-89481140 CCTTCATTCCTGAAGGGTCTGGG - Intergenic
1194210537 X:91064226-91064248 CCTTCATTCCTGAAGGGTCTGGG - Intergenic
1194593748 X:95833871-95833893 CCTTCTGTCTTGTAGGGTTTCGG + Intergenic
1194649668 X:96499893-96499915 CCTTCATTCCTGAAGGGTCTGGG - Intergenic
1194834193 X:98660674-98660696 CCTTCATTCCTGAAGGGTCTGGG - Intergenic
1195748652 X:108143365-108143387 CCTTCATTCCTGAAGGGTCTGGG + Intronic
1195782090 X:108478003-108478025 CCTTCCTTCCTGAAGGGTCTGGG + Intronic
1196275880 X:113764552-113764574 CCTTCATTCCTGAAGGGTCTAGG - Intergenic
1197002543 X:121454794-121454816 CCTTCATTCCTGAAGGGTCTGGG - Intergenic
1197182361 X:123549658-123549680 CCTTCATTCCTGAAGGGTCTGGG - Intergenic
1197405416 X:126042078-126042100 CCTTCATTCCTGAAGGGTCTGGG - Intergenic
1197522172 X:127512167-127512189 CCTTAATTCCTGAAGGGACTGGG - Intergenic
1197592126 X:128421269-128421291 CCTTCATTCCTGAAGGGTCTGGG - Intergenic
1198307171 X:135394642-135394664 CCTTCGTTCCTGAAGGGTCTGGG - Intergenic
1198701554 X:139402168-139402190 CCTTCATTCCTGAAGGGTCTGGG - Intergenic
1198782798 X:140255928-140255950 CCTTCATTCCTGAAGGTTGTGGG + Intergenic
1199116317 X:143997393-143997415 CCTTCATTCCTGAAGGGTCTGGG + Intergenic
1199383943 X:147202082-147202104 CCTACTAGCCAGAAGGGAGTGGG + Intergenic
1200434753 Y:3137308-3137330 CCTTCATTCCTGAAGGGTCTGGG - Intergenic
1200745721 Y:6902437-6902459 CCTTCATTCCTGAAGGGTCTGGG + Intergenic
1201782543 Y:17739483-17739505 CCTTCTGTCCCAGAGTGAGTAGG - Intergenic
1201819010 Y:18166505-18166527 CCTTCTGTCCCAGAGTGAGTAGG + Intergenic