ID: 1166539240

View in Genome Browser
Species Human (GRCh38)
Location 19:43594705-43594727
Sequence CCCCCAGTGAGTTTGGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 232}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166539240_1166539247 -10 Left 1166539240 19:43594705-43594727 CCTTGCCCCAAACTCACTGGGGG 0: 1
1: 0
2: 3
3: 22
4: 232
Right 1166539247 19:43594718-43594740 TCACTGGGGGAGGGATCTCATGG 0: 1
1: 0
2: 1
3: 22
4: 184
1166539240_1166539252 19 Left 1166539240 19:43594705-43594727 CCTTGCCCCAAACTCACTGGGGG 0: 1
1: 0
2: 3
3: 22
4: 232
Right 1166539252 19:43594747-43594769 ATGGTCGCACCTAGGTGCCTAGG 0: 1
1: 0
2: 0
3: 8
4: 65
1166539240_1166539248 0 Left 1166539240 19:43594705-43594727 CCTTGCCCCAAACTCACTGGGGG 0: 1
1: 0
2: 3
3: 22
4: 232
Right 1166539248 19:43594728-43594750 AGGGATCTCATGGACCTCCATGG 0: 1
1: 0
2: 1
3: 15
4: 168
1166539240_1166539253 20 Left 1166539240 19:43594705-43594727 CCTTGCCCCAAACTCACTGGGGG 0: 1
1: 0
2: 3
3: 22
4: 232
Right 1166539253 19:43594748-43594770 TGGTCGCACCTAGGTGCCTAGGG 0: 1
1: 0
2: 0
3: 1
4: 51
1166539240_1166539249 11 Left 1166539240 19:43594705-43594727 CCTTGCCCCAAACTCACTGGGGG 0: 1
1: 0
2: 3
3: 22
4: 232
Right 1166539249 19:43594739-43594761 GGACCTCCATGGTCGCACCTAGG 0: 1
1: 0
2: 0
3: 10
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166539240 Original CRISPR CCCCCAGTGAGTTTGGGGCA AGG (reversed) Intronic
900142179 1:1143323-1143345 CCCCCAGGCAGTGTGGGGCTGGG - Intergenic
900409759 1:2507283-2507305 CCACCAGTGAGGGTGGGGCCAGG + Intergenic
900413070 1:2521861-2521883 CACCCAGAGAGTGTGGGGCATGG - Intronic
900638854 1:3678786-3678808 CCCACAGTGGGGCTGGGGCAGGG - Intronic
900857916 1:5200821-5200843 TTCCCAGTTAGTTTAGGGCATGG + Intergenic
901064559 1:6488751-6488773 TCCCCAGGGAGTTGGGGGCCAGG - Intronic
901320713 1:8338364-8338386 TCCCCAGGGAGGTGGGGGCAGGG + Intronic
901671759 1:10860249-10860271 TCCCCAGTGATTTGGGGGGAAGG + Intergenic
903306987 1:22419862-22419884 GGCCCAGGGAGTTTGGGGAAGGG + Intergenic
903442367 1:23397729-23397751 CCCTCAGTGAGATTGGGAAAAGG + Intronic
904396038 1:30223197-30223219 CCTGGAGTGAGTTTGGGGCAGGG - Intergenic
904462448 1:30688145-30688167 CTCCCAGAGATTTAGGGGCAGGG + Intergenic
905461912 1:38127688-38127710 CACCCAGTGACTCTGGGGCTTGG + Intergenic
908079195 1:60557069-60557091 CCCCCAATGTGATTGGGGCTTGG + Intergenic
908432694 1:64074229-64074251 AGTCCAGTGACTTTGGGGCACGG - Intronic
909304846 1:74060902-74060924 CCCCCAGTGACTTCTGGGGAAGG + Intronic
912449057 1:109758507-109758529 AGCACAGTAAGTTTGGGGCATGG - Exonic
912556616 1:110520808-110520830 CCATCAGTGAGCTTTGGGCAAGG + Intergenic
914689977 1:150017236-150017258 CCTCCAGTGATTTTAGGGCCTGG - Intergenic
915225707 1:154409857-154409879 CCCCATGTGTGTTTGTGGCAGGG + Intronic
917210657 1:172628821-172628843 CCCCCACTGAGTTGGGGGTTGGG + Intergenic
919883402 1:201915646-201915668 GCCCAAGTGATTTTGGGGGAAGG + Intronic
919933910 1:202239007-202239029 CCCCAAGTGAGGACGGGGCAGGG + Intronic
919986098 1:202676253-202676275 CCTCCAGGGAGTTGGGGACAAGG + Intronic
920288985 1:204903307-204903329 CTCCCAGTGTGTTTGTGGCTGGG + Intronic
920798158 1:209160676-209160698 TCCTCAGAGAGTTTGGGGCTAGG - Intergenic
922190479 1:223314439-223314461 CCCCCAGTCTGTGTGGGTCATGG - Intronic
922950533 1:229555213-229555235 ACCTGAGTGAGTTAGGGGCAGGG - Intronic
923441968 1:234029111-234029133 TGCCCAGTGAGCTTGGGGCTGGG + Intronic
923554458 1:234989891-234989913 TCCCCACCGAGCTTGGGGCAGGG + Intergenic
1063241803 10:4177422-4177444 CCCCCACTTAGTCTGGGACAGGG + Intergenic
1064162069 10:12955445-12955467 CCCACAGTTATTATGGGGCAAGG + Intronic
1065734152 10:28736225-28736247 TCCCCAAGGAGTTTGGGGCTAGG + Intergenic
1067767387 10:49097269-49097291 CCCCCGGTGGGCATGGGGCAGGG - Intronic
1068025307 10:51635499-51635521 CCACAAGTGAGTTTTGGCCACGG - Intronic
1069250632 10:66261927-66261949 TCCCCAGGTAGTTTGGGGCTGGG - Intronic
1070420946 10:76236589-76236611 TCCCCAAGGAGTTTGGGGCTAGG - Intronic
1072619019 10:97067720-97067742 ACCCCGGTGTGTCTGGGGCAAGG - Intronic
1072744727 10:97932103-97932125 GGCCCAGTGAGTCTGGGTCAAGG - Intronic
1073018612 10:100421983-100422005 CACTCACTGAGTTTGGGACATGG + Intergenic
1073193523 10:101669368-101669390 CTCCCAGGGAGTTTGTGTCAGGG - Intronic
1073201119 10:101736721-101736743 ACCCCTGTGAGTCTGTGGCATGG + Intergenic
1075280886 10:121137280-121137302 TCCACAGTGAGTCTGGAGCAGGG + Intergenic
1075340853 10:121645900-121645922 CTACCAGTGACCTTGGGGCAGGG + Intergenic
1076517115 10:131052405-131052427 TCCCCAAGGAGTTTGGGGCTAGG + Intergenic
1076797436 10:132805095-132805117 ACCCCAGTGAGTATGGGACGGGG + Intergenic
1077099995 11:818469-818491 CCCCCAGTAGGGCTGGGGCAGGG + Intergenic
1077477072 11:2795572-2795594 GCCCCAGTGGGTGTGGGGTAGGG - Intronic
1078898864 11:15622822-15622844 CCACCAGGGACTTTTGGGCATGG - Intergenic
1079103773 11:17557814-17557836 CTCCCAGTGAGATTGTTGCAAGG - Intronic
1079376209 11:19894400-19894422 CCCCAAATGAGTATAGGGCAAGG - Intronic
1081667260 11:44923821-44923843 CCCCTGGGGAGGTTGGGGCATGG - Intronic
1083641911 11:64150261-64150283 CCCCCAGTGACTCTGGGGCATGG - Intronic
1083899169 11:65635475-65635497 GCCCAAGGGGGTTTGGGGCAGGG - Intronic
1084375422 11:68773571-68773593 GCCCTAGTAAGTTAGGGGCATGG + Intronic
1085273539 11:75284058-75284080 CCCAAAGTAAGCTTGGGGCAGGG + Intronic
1085284157 11:75349392-75349414 CCACCAGTGAGTTTGAGGCAGGG + Intronic
1085457749 11:76674727-76674749 CCCCAAGGGAGTTGGGGGGATGG + Intergenic
1087048178 11:93861870-93861892 CCCAAAGTGAGGATGGGGCAGGG + Intergenic
1090646032 11:128767255-128767277 TCCACAGTGAGCTTGGGGCCAGG + Intronic
1091852965 12:3715173-3715195 CTCCCAGTGGGTTGGGGGAAAGG + Intronic
1091979590 12:4854309-4854331 CCCACAGTGAGGTAGTGGCAGGG - Intergenic
1092023904 12:5224879-5224901 GCCCCAGTGATTTGGAGGCAAGG - Intergenic
1092173934 12:6390335-6390357 CCCACGGTGAGCCTGGGGCAGGG + Exonic
1092282460 12:7108476-7108498 CCACCTGTGAGTTGGGGGGAGGG + Exonic
1092782097 12:11996655-11996677 CCCTCCCTGAGGTTGGGGCATGG + Intergenic
1095215133 12:39538940-39538962 CCCCAAGTGAGTATGGGACAGGG - Intergenic
1096519271 12:52174965-52174987 CACCGAGTGAGTTGGTGGCAGGG + Intronic
1096519653 12:52177459-52177481 TCCCAAGTGTGTTTGGGGCCTGG - Intronic
1096672132 12:53206374-53206396 CACCCAGTGAACTAGGGGCAGGG + Intronic
1096788148 12:54029493-54029515 CCCCCAGTGGGGGTGGGGCAAGG + Intronic
1097906027 12:64920415-64920437 GACCCAGTGGGTTTGGGGTAGGG + Intergenic
1099861139 12:88227532-88227554 CCCCAAGTGAGGACGGGGCATGG - Intergenic
1100299025 12:93290320-93290342 CACCAAGTGAGGATGGGGCAGGG + Intergenic
1100335451 12:93624755-93624777 CTCCCATTAAGTTGGGGGCAGGG + Intergenic
1100774086 12:97955472-97955494 CCCCCACTGAATTAGGGGAAAGG + Intergenic
1101195002 12:102372721-102372743 CCCCCAGTGATTTTAATGCATGG + Intergenic
1101806012 12:108064333-108064355 CCCCGGGGGGGTTTGGGGCAGGG + Intergenic
1102353949 12:112216660-112216682 CTTCAAGTGAGTTTGGGGAAAGG - Intronic
1103005160 12:117414991-117415013 GACTCAGTGAGTCTGGGGCAGGG + Intronic
1105000133 12:132685604-132685626 CCATCACTGAGCTTGGGGCAGGG + Intronic
1105009884 12:132748561-132748583 CCCCCAGTGAGATTGTGGCCGGG - Intronic
1106483881 13:30156148-30156170 CCCAGAGTGGGGTTGGGGCAGGG - Intergenic
1106856112 13:33854777-33854799 CCCACAGTGATTTTGGGGACTGG + Intronic
1115001932 14:28432529-28432551 CCTGTAGTGAGTTGGGGGCATGG + Intergenic
1115363221 14:32527122-32527144 CTCCCAGACCGTTTGGGGCAAGG - Intronic
1119804755 14:77475464-77475486 CCCCCAGTGAGGTTGGTCCGAGG - Exonic
1121033869 14:90682852-90682874 CACCCAGTGAGTTGGTGGCATGG - Intronic
1121331495 14:93052562-93052584 CCCCCAGTGGGGTAGGGGGACGG + Intronic
1121560750 14:94873634-94873656 CACGCAGTGAGGCTGGGGCAGGG + Intergenic
1121694437 14:95901355-95901377 TCCCCAGAGAGTTGGGGGCCAGG + Intergenic
1127844492 15:62857328-62857350 GATTCAGTGAGTTTGGGGCACGG + Intergenic
1128551944 15:68603553-68603575 CCCCCAGTGTGTTTGGAGACAGG + Intronic
1130028073 15:80286745-80286767 CCCACAGAGAGTTTGGGAGAAGG + Intergenic
1130938053 15:88486786-88486808 TCCCCAGTGAGTTTGGGGCTAGG + Intergenic
1138422608 16:56909430-56909452 TTCCCTGTGAGTTTGGGGGATGG - Intronic
1138451092 16:57093656-57093678 CCCCCAGTACATATGGGGCAGGG - Intronic
1139282995 16:65785783-65785805 TCCCCAAGGAGTTTGGGGCTAGG + Intergenic
1140986423 16:80162009-80162031 CACACAGTGAGTATGTGGCAAGG + Intergenic
1142125409 16:88407779-88407801 CCTTCTGTGAGTTGGGGGCATGG + Intergenic
1142220931 16:88854576-88854598 CCCCCAGTGTGCTTGGCGCAGGG + Intronic
1142418123 16:89954161-89954183 ACCCCAGTGTGGTTGGGGAAAGG + Intronic
1144270595 17:13611764-13611786 CCCCAAGTCAATTTGGAGCAGGG - Intergenic
1144465227 17:15491776-15491798 CCCACAGTGACTCTGGTGCATGG + Intronic
1144571023 17:16399091-16399113 GCCCCAGTGAGCTCAGGGCATGG - Intergenic
1144950141 17:18989510-18989532 CACACAGTGAGTTTGAGGCAGGG - Intronic
1144957214 17:19024834-19024856 CCCCAAGGGACTCTGGGGCATGG - Intronic
1145006634 17:19342279-19342301 CGCACAGTGAGTTGGGGGGAGGG + Intronic
1145363142 17:22228697-22228719 GCCCCAGTGAGCTCAGGGCACGG - Intergenic
1148686208 17:49502571-49502593 TCCCCGGTGTGTTTGGGGGAAGG + Intronic
1148852807 17:50562898-50562920 CCGCCAGGGAGCTTGGGGCCAGG - Intronic
1148896945 17:50844360-50844382 CCCCCAGGGCCTCTGGGGCAGGG + Intergenic
1150069856 17:62141129-62141151 CTCCAAGTGAGTCCGGGGCAGGG - Intergenic
1152185978 17:78856515-78856537 CTCCCAGTGAGTCTGGGACCAGG - Intronic
1152545711 17:80999201-80999223 CCCACAGAGAGTTTGGGTCACGG + Exonic
1153802642 18:8684776-8684798 TCCCCAAGGAGTTTGGGGCCAGG + Intergenic
1155804224 18:30145486-30145508 CCCCAAATGAGGATGGGGCAGGG - Intergenic
1156391137 18:36651692-36651714 CCCCCAGTGATCTTGGCTCACGG - Intronic
1156469677 18:37369333-37369355 GCCACAGTGAATTGGGGGCAAGG - Intronic
1161031547 19:2060004-2060026 CCCCAAGGAAGTGTGGGGCAGGG + Intergenic
1161217433 19:3101404-3101426 CCCCCAGGGACTGTGGGGCCGGG + Intronic
1162138548 19:8571280-8571302 GCCCCACTGAGCTGGGGGCAAGG - Intronic
1162209041 19:9077251-9077273 CCCCAAGTGAGGACGGGGCAGGG + Intergenic
1162880571 19:13655892-13655914 TCCCCAAGGAGTTTGGGGCTAGG + Intergenic
1162937592 19:13989131-13989153 CTCCCAGAGGGTCTGGGGCAGGG + Intronic
1163575844 19:18110361-18110383 CCTCGAGTGAGTGTTGGGCAGGG + Intronic
1165926099 19:39327250-39327272 CCTCCAGAGAATTTAGGGCAGGG + Intergenic
1166215294 19:41330937-41330959 CCCCAGGTGGGCTTGGGGCACGG + Exonic
1166539240 19:43594705-43594727 CCCCCAGTGAGTTTGGGGCAAGG - Intronic
1166650672 19:44572050-44572072 CACACTGAGAGTTTGGGGCAGGG + Intergenic
1167594984 19:50422812-50422834 CCCACAGGGAGTCTGGGGGAAGG - Exonic
1167995594 19:53399385-53399407 TCCCCAGTGAGTTTGGAAGAAGG - Intronic
1168013085 19:53549429-53549451 CTCCCAGGGAGTTTGGAGCTAGG + Intronic
1168128985 19:54305394-54305416 CCCACAGACTGTTTGGGGCAGGG + Intergenic
925180591 2:1814613-1814635 CCCCCAGTGAGGTGGAGGCTGGG - Intronic
925540167 2:4958286-4958308 CACCCAGGAAGTTTGGGACATGG + Intergenic
925583983 2:5444312-5444334 CCTCCAGTGAGCGCGGGGCATGG + Intergenic
925859871 2:8163761-8163783 ACCCCTGTGAGATTGGGGAAGGG - Intergenic
926413093 2:12625412-12625434 TCCCCAGGGAGTCTGGGGAAGGG + Intergenic
929578155 2:43065766-43065788 CCCCCAGTTAGTGAGGGGCAGGG + Intergenic
929698166 2:44138049-44138071 TCCCCAGGGAGTTTGGAGCTAGG + Intergenic
932715790 2:74100179-74100201 CCCCCAGTGGGGCTGGGGCTGGG + Intronic
935200900 2:100855757-100855779 AGCCCTGTGAGTTTGGGGAATGG - Intronic
935530809 2:104230493-104230515 CGGCCTGTGAGGTTGGGGCATGG + Intergenic
936415798 2:112309784-112309806 CCCCCAGCAAGTTTGGAGAAAGG - Intronic
937246430 2:120496950-120496972 GCCCCAGTGGGCTGGGGGCAAGG + Intergenic
938804078 2:134789681-134789703 CCCCCAGAGGGGTGGGGGCAGGG + Intergenic
942706401 2:178777481-178777503 CACCCAGTGATTCTGGGGAATGG - Exonic
945830356 2:214777301-214777323 CCCAGAGGTAGTTTGGGGCAAGG + Intronic
947331272 2:229032102-229032124 CCCCCTGTGTATTTGGGCCATGG + Intronic
947564597 2:231185874-231185896 CCTCCAGCGAGGTGGGGGCATGG - Intergenic
948231546 2:236352446-236352468 CCCCCAGTGTCTGTGGTGCAAGG - Intronic
1169339842 20:4787943-4787965 CCTCCAAGGAGTTTGAGGCATGG - Intronic
1170566699 20:17611800-17611822 GCCCCGGTGAGTGTGGGGAACGG - Intergenic
1172004607 20:31810373-31810395 CCCACAGTGCCTTTGGGGCATGG - Intergenic
1172153553 20:32807910-32807932 ACCCCAGTGGGCTTGGGGCCTGG - Exonic
1173868306 20:46326975-46326997 TACACAGTGAGTTTGGGGCCAGG + Intergenic
1174195050 20:48767056-48767078 CCCACAGCGAGTCTGTGGCAGGG - Intronic
1174197171 20:48781682-48781704 TCCACAGTGAGTTTGTGGCAGGG - Intronic
1175442625 20:59002167-59002189 CCCCCAGTGCCTTCGGGGCTGGG - Intronic
1175759259 20:61550156-61550178 AGGCCAGTGAGGTTGGGGCAGGG - Intronic
1175759301 20:61550290-61550312 AGGCCAGTGAGGTTGGGGCAGGG - Intronic
1179666565 21:42916868-42916890 CCCCAAGTGAGGATGGGGCAGGG + Intergenic
1179667994 21:42925630-42925652 CCCCAAGTGAGGAGGGGGCAGGG + Intergenic
1182011663 22:27006332-27006354 CCCCCAGGGAGTTGGGAGCTGGG + Intergenic
1183805985 22:40211518-40211540 GCCACAGTAAGTTTGTGGCAAGG - Intronic
1184652925 22:45927303-45927325 CCCCCAGGGAGCTTGGGGAAGGG + Intronic
1184676664 22:46046695-46046717 CCCCCAGAGGGTTTGGGGATGGG - Intergenic
949419796 3:3853591-3853613 CCCCCAGTGATTATGTGGAATGG - Intronic
950410621 3:12834077-12834099 CCCCCAGTGAGATGGTGGAAGGG - Exonic
950441811 3:13014930-13014952 GCCCCAGCGAGCCTGGGGCAGGG + Intronic
950733896 3:14989214-14989236 CCCTCAGTGGCTTTGGGGAAGGG + Intronic
953901924 3:46848434-46848456 GCCCCAGGGAGATTGGGGCAGGG + Intergenic
953926604 3:46985772-46985794 GACCCAGTTAGGTTGGGGCAAGG + Intronic
954558059 3:51533808-51533830 CCCCAAGTGAGGATGGGGCAGGG + Intergenic
955402692 3:58604495-58604517 CGCACAGTGAGTTAGTGGCAGGG + Intronic
959104635 3:102051874-102051896 CCCACACAGAGTCTGGGGCATGG + Intergenic
961458488 3:127035968-127035990 CCCTCAGTGGGCTGGGGGCAGGG - Exonic
961705251 3:128779924-128779946 TCCCTAGGGAGTTTGGGGCTGGG + Intronic
962753041 3:138448769-138448791 CCCTGAGTAAGTTTGGAGCAGGG - Intronic
963654098 3:148023863-148023885 TCCCCAGTGAGTGTGGGTTATGG + Intergenic
963919481 3:150892121-150892143 CTCCCAGTGACTTCTGGGCAAGG - Intronic
964486045 3:157186240-157186262 CCCCCAGTGACTCTTGGGGAAGG + Intergenic
966711846 3:182980220-182980242 GCCCCGGGGAGTTTGGGGCGCGG - Intronic
967382194 3:188871204-188871226 CTCCCACAGAGTTTGGGGAAAGG + Intronic
967414782 3:189204197-189204219 CTCCCAATGAGTTTGTTGCAGGG + Intronic
968700033 4:2051345-2051367 CTCCCAGTGACTTTGGGGATGGG - Intergenic
968868477 4:3228438-3228460 CCCACAGAGAGGGTGGGGCAGGG - Intronic
969049180 4:4360547-4360569 TCCCCAGGGAGTTTGGGGCTGGG - Intronic
969638622 4:8383593-8383615 CCCCAAGTCAGGATGGGGCAGGG - Intronic
971480584 4:27111039-27111061 CCCCAAGTGAGGACGGGGCAGGG + Intergenic
972826211 4:42762032-42762054 CCCCCATGGGATTTGGGGCATGG + Intergenic
973181424 4:47273470-47273492 CGCCTTGTGACTTTGGGGCATGG - Intronic
974950870 4:68582045-68582067 CCCCAAGTGAGGATGGGACAGGG - Intronic
974958411 4:68671997-68672019 CCCCAAGTGAGGATGGGACAGGG - Intergenic
975719005 4:77232408-77232430 CCATCAGTGAGTGAGGGGCAGGG - Intronic
981036523 4:140175207-140175229 GCCCCAGGGTCTTTGGGGCAGGG - Intergenic
981751656 4:148098045-148098067 CTCCCCAGGAGTTTGGGGCAGGG - Intronic
983083561 4:163415819-163415841 TCCCCAGGGAGTTTGGGGCTAGG + Intergenic
983888678 4:173008600-173008622 TCCCCAAGGAGTTTGGGGCTAGG + Intronic
984619210 4:181933008-181933030 CTCCCAGGGGGTTGGGGGCAAGG + Intergenic
984905394 4:184621349-184621371 TCCCCAAGGAGTTTGGGGCTCGG - Intergenic
985704349 5:1391906-1391928 CCCTCAGGCAGTTCGGGGCAGGG + Intergenic
986106110 5:4661214-4661236 CCTCCAGTGGGTTTGGGGTGGGG + Intergenic
986133082 5:4948679-4948701 ACCCCAGGGAGTCTGGGGCTTGG + Intergenic
987046664 5:14115388-14115410 CCCCCAAGCAGTTTGGGGCTAGG + Intergenic
987234590 5:15929863-15929885 ACCTCAGGGAGTTTGGGGGAGGG + Intronic
991271035 5:64781537-64781559 CATCCAGTGAGTAGGGGGCAGGG - Intronic
994084291 5:95741686-95741708 CGCCCAGTGGGTTTGGGGGGAGG + Intronic
995852343 5:116559468-116559490 CCCCAAGTGCGGATGGGGCAGGG - Intronic
997695120 5:135855552-135855574 CCACCAGTGAGAGTGAGGCATGG + Intronic
998882192 5:146655611-146655633 CTCACAGTGAGTCTGAGGCAGGG + Intronic
999672791 5:153972377-153972399 CCCCCAGTGACTCTGGTGCAAGG + Intergenic
1002195935 5:177501329-177501351 CACCCAGAGAGTCAGGGGCATGG - Intergenic
1008134377 6:47756965-47756987 CCCCCAGAAAGTTTGGGAGAAGG + Intergenic
1011260615 6:85466174-85466196 CCCGTAGTGAGTTGGGGGCTGGG - Intronic
1011558117 6:88589712-88589734 TACCCAGTGGGTTTGGGACAAGG - Intergenic
1013280717 6:108634414-108634436 TTCCCAGTGAATTTGGAGCAGGG - Intronic
1014019654 6:116572348-116572370 CCGCCAGCGAGTTAGCGGCAGGG + Intronic
1014642606 6:123931499-123931521 CCCTCAGTGAGTTTAGAGTAGGG - Intronic
1015163503 6:130178360-130178382 CCCACAGTGAGTGCGGGGAAGGG + Intronic
1018545457 6:164930570-164930592 CCACCAGTGTTTTTGGTGCAAGG + Intergenic
1019170598 6:170131262-170131284 CCCTCAGTGTGTTTGGGGTGAGG - Intergenic
1019612235 7:1942335-1942357 CCCCCAGCCACCTTGGGGCACGG - Intronic
1031340517 7:120594679-120594701 GTCTCAGTAAGTTTGGGGCAAGG - Intronic
1031837915 7:126701445-126701467 CTACCAGTGAGTATGGCGCATGG - Intronic
1031977318 7:128102377-128102399 CCTTCAGTAAGTATGGGGCAGGG + Intergenic
1033369663 7:140696837-140696859 CCGTCAGTGAGTGTGGGGCTGGG + Exonic
1034465687 7:151227146-151227168 GGCCCAGTGAGTTAGGGGAAGGG - Exonic
1034580326 7:152035839-152035861 CCCCAAGTGAGGATGGGGAAGGG + Intronic
1035182517 7:157099616-157099638 CCCCTGGCGAGTTTGGGGCTAGG - Intergenic
1039138219 8:34351945-34351967 ACACCAGAGAGTTTGTGGCAAGG + Intergenic
1040821124 8:51558948-51558970 CCCCCAATGAGTTCTGGGCTGGG + Intronic
1041011328 8:53546952-53546974 CACCCAGTGAGACTGGGGCCTGG - Intergenic
1041760398 8:61360056-61360078 CCCGCAGGGAGTTTGGGAAAGGG + Intronic
1042157676 8:65863473-65863495 CCCCAAATGAGGATGGGGCAGGG - Intergenic
1042158711 8:65870322-65870344 CCCCAAATGAGGATGGGGCAGGG - Intergenic
1043506694 8:80909836-80909858 CCCCAAATGAGGATGGGGCAGGG + Intergenic
1043856754 8:85273711-85273733 CCCCAAGTGAGGATGGGGCAGGG - Intronic
1044762727 8:95538815-95538837 CCCCCACAGAGTGGGGGGCAGGG - Intergenic
1044801966 8:95966498-95966520 CTCTCAGTGTGATTGGGGCATGG - Intergenic
1045947187 8:107809649-107809671 ACCCTAGTGAGTGAGGGGCATGG + Intergenic
1049354400 8:142180368-142180390 CCCCCAGAGAGTACGGGGCTTGG - Intergenic
1051358676 9:16262994-16263016 CCCCCTGTCAGCCTGGGGCAGGG + Intronic
1057262231 9:93591524-93591546 TGCACAGTGAGTTAGGGGCAGGG + Intronic
1058792557 9:108465279-108465301 CCCCCAGCTAGTTTGTGGCAGGG - Intergenic
1061101033 9:128492578-128492600 CCCCCAGTCTGATGGGGGCAGGG - Intronic
1062063664 9:134514409-134514431 CCATCAATGAGTTTGGAGCAAGG - Intergenic
1062166980 9:135112811-135112833 CGCCAAGTGAGATTGGGACAAGG + Intronic
1062464860 9:136676446-136676468 CTCCCACTGAGTTGGGGACAGGG - Intronic
1187826388 X:23335689-23335711 CCCCCGGAGTGTTTGGGGAACGG + Intronic
1189140047 X:38594367-38594389 CACCCAGTGTGTTTGGGGGAAGG - Intronic
1193593425 X:83418741-83418763 CCCCCAATGACTTGGGGGAATGG + Intergenic
1195889882 X:109681528-109681550 CTCCCAGGGAGTTTGAAGCAAGG - Intronic
1196245981 X:113401040-113401062 TCCCCAAGGAGTTTGGGGCTAGG + Intergenic
1196806017 X:119586920-119586942 CCCCAAATGATTTTGAGGCAGGG - Intergenic
1198531360 X:137551677-137551699 TGCCTAGTGTGTTTGGGGCAGGG + Intergenic
1200819366 Y:7566520-7566542 CCCCAAGTGAGTGCTGGGCATGG - Intergenic