ID: 1166539244

View in Genome Browser
Species Human (GRCh38)
Location 19:43594710-43594732
Sequence TCCCTCCCCCAGTGAGTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 218}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166539244_1166539255 28 Left 1166539244 19:43594710-43594732 CCCCAAACTCACTGGGGGAGGGA 0: 1
1: 0
2: 1
3: 16
4: 218
Right 1166539255 19:43594761-43594783 GTGCCTAGGGTCTCGACTAACGG 0: 1
1: 0
2: 0
3: 0
4: 31
1166539244_1166539248 -5 Left 1166539244 19:43594710-43594732 CCCCAAACTCACTGGGGGAGGGA 0: 1
1: 0
2: 1
3: 16
4: 218
Right 1166539248 19:43594728-43594750 AGGGATCTCATGGACCTCCATGG 0: 1
1: 0
2: 1
3: 15
4: 168
1166539244_1166539253 15 Left 1166539244 19:43594710-43594732 CCCCAAACTCACTGGGGGAGGGA 0: 1
1: 0
2: 1
3: 16
4: 218
Right 1166539253 19:43594748-43594770 TGGTCGCACCTAGGTGCCTAGGG 0: 1
1: 0
2: 0
3: 1
4: 51
1166539244_1166539252 14 Left 1166539244 19:43594710-43594732 CCCCAAACTCACTGGGGGAGGGA 0: 1
1: 0
2: 1
3: 16
4: 218
Right 1166539252 19:43594747-43594769 ATGGTCGCACCTAGGTGCCTAGG 0: 1
1: 0
2: 0
3: 8
4: 65
1166539244_1166539249 6 Left 1166539244 19:43594710-43594732 CCCCAAACTCACTGGGGGAGGGA 0: 1
1: 0
2: 1
3: 16
4: 218
Right 1166539249 19:43594739-43594761 GGACCTCCATGGTCGCACCTAGG 0: 1
1: 0
2: 0
3: 10
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166539244 Original CRISPR TCCCTCCCCCAGTGAGTTTG GGG (reversed) Intronic
900033697 1:389570-389592 TCCCTGTCACAGTCAGTTTGGGG - Intergenic
900054531 1:619460-619482 TCCCTGTCACAGTCAGTTTGGGG - Intergenic
900214835 1:1475838-1475860 TCCTACCCCCAGTGACTCTGGGG - Intronic
900222048 1:1514192-1514214 TCCTACCCCCAGTGACTCTGGGG - Intronic
901316719 1:8314838-8314860 TCCTTCCCACAGTGAGGCTGAGG + Intergenic
901895907 1:12311694-12311716 TCTTTCTCCAAGTGAGTTTGAGG - Intronic
904063353 1:27728382-27728404 TCTCTCTCCCAGTCAGGTTGGGG + Intronic
904905690 1:33895768-33895790 TCCCAGCCCCCATGAGTTTGTGG + Intronic
906726236 1:48046593-48046615 TCCCTACCCCAGAGAGCTTACGG - Intergenic
912933177 1:113982104-113982126 TCCCTCCCCAAGTCACTCTGAGG - Exonic
915430797 1:155865268-155865290 TCCCTCATCCAGTGAGGTTCGGG + Intronic
916521112 1:165564122-165564144 TCCCTCCAGCACTTAGTTTGGGG - Intergenic
917549986 1:176016576-176016598 TCCCTCCCTCTCTGAGTTAGGGG + Intronic
918065046 1:181094911-181094933 TCCCTCCCGCAGTGGGAATGGGG + Intergenic
918970865 1:191417564-191417586 TCCCCCTCCCACTGAGTGTGAGG - Intergenic
920022276 1:202965458-202965480 TCCCTCCCTCAGGAAATTTGGGG + Exonic
920288098 1:204896185-204896207 TCCCCCTCCCACTGATTTTGCGG - Intronic
920868063 1:209769656-209769678 CGCCTCCCTCAGTGAGTTTCAGG - Intronic
921888607 1:220331272-220331294 TCCTTCCCCCAAAGAGTTTGCGG - Intergenic
922256054 1:223893725-223893747 TCCCTGTCACAGTCAGTTTGGGG - Intergenic
922526165 1:226305851-226305873 TCCCTCTCGCTGTGTGTTTGTGG + Intronic
924337256 1:242996592-242996614 TCCCTGTCACAGTCAGTTTGGGG - Intergenic
1065935346 10:30515973-30515995 TCCTTCAGCCAGTGAGTTTTTGG - Intergenic
1067031007 10:42878887-42878909 TCACTCCCCCAGAGAGACTGGGG + Intergenic
1067276500 10:44839591-44839613 TCCGTCCTCCTGGGAGTTTGTGG - Intergenic
1069020691 10:63484960-63484982 TCACTCCTCCAGTGAATTAGGGG - Intergenic
1069719161 10:70539028-70539050 TGGGTCCCCCAGTGGGTTTGGGG + Intronic
1070673150 10:78392332-78392354 TCCCTCCTCCAGTAAGATTTGGG - Intergenic
1072806155 10:98425087-98425109 CCCCACCCCCAGTGAGCTTAGGG - Intronic
1075970124 10:126644828-126644850 TGCATCCCACAGGGAGTTTGGGG - Intronic
1076290414 10:129341338-129341360 TCCCTTCCAGAGTGAGTTGGAGG - Intergenic
1077333411 11:1993208-1993230 TCCCTTCCCCAGCGGGTGTGAGG + Intergenic
1078096061 11:8298052-8298074 TCACACCCCCAGAGACTTTGTGG - Intergenic
1081283056 11:41234741-41234763 TCCTTCCCTCACTGAGTTTTTGG - Intronic
1081814094 11:45929016-45929038 TCTCTGCCCCAGCCAGTTTGGGG + Exonic
1081902343 11:46639640-46639662 TCCGCCTCCCAGGGAGTTTGTGG + Intronic
1082005404 11:47416199-47416221 TTCCTTCCCCATTGAGGTTGGGG + Exonic
1082998540 11:59271763-59271785 TCCCTCCCCCAGGGTGTTCATGG - Intergenic
1083267195 11:61552110-61552132 TCCCTCCCCCTGCTAGTGTGAGG - Intronic
1083573244 11:63771081-63771103 CCCTTCCCCCAGTGGGGTTGGGG - Intergenic
1087138216 11:94740930-94740952 TCCCCCAGACAGTGAGTTTGTGG + Intronic
1087974270 11:104525262-104525284 TCCCTCTCTCTGTGACTTTGGGG + Intergenic
1088910299 11:114186003-114186025 TCCCTCCTCCAGGGAGCTTACGG + Intronic
1090973066 11:131659398-131659420 TCCCTCACCCAGTGTGATGGAGG - Intronic
1202816389 11_KI270721v1_random:48389-48411 TCCCTTCCCCAGCGGGTGTGAGG + Intergenic
1091694362 12:2617998-2618020 TCCCTCCTCCAGCCAGCTTGGGG + Intronic
1093604720 12:21075927-21075949 TCCCTCCCCCAGAGATGTTCAGG - Intronic
1094581740 12:31739761-31739783 TCCATCCCCCAGTGATTCTATGG + Intergenic
1099989426 12:89708111-89708133 CCCCTCCCGCAGTGCGTCTGGGG + Intronic
1104775043 12:131385936-131385958 CCCCTCCCCGAGGGAGCTTGAGG + Intergenic
1105064121 12:133181881-133181903 ACCCTCCCCCTCTGGGTTTGGGG + Intronic
1105214747 13:18277703-18277725 TCCCTCCCCCAGTGGCCTGGGGG + Intergenic
1106513316 13:30430416-30430438 TCACTCCCCCTGTTAGTCTGAGG + Intergenic
1107877114 13:44800596-44800618 TCCCTTCCCCAAAGAGTTTCAGG + Intergenic
1108551430 13:51549439-51549461 TCCCTGCACCAGAGAGTATGAGG + Intergenic
1109341417 13:61065061-61065083 TCCCTTTCCCAGTGAGACTGTGG - Intergenic
1111538464 13:89636689-89636711 TCCCAACCCCAGTGAGTTCATGG + Intergenic
1111715885 13:91878025-91878047 TGCCTCCCCCTGTGATTCTGAGG + Intronic
1113565710 13:111318511-111318533 CCCCTCTCCCTGTGAGTCTGGGG + Intronic
1114126240 14:19729799-19729821 TCCCTCTCCCAGTGGGCTTTGGG + Intronic
1115718588 14:36134221-36134243 TCCTTCCCCCAGGGACCTTGCGG - Intergenic
1116163817 14:41307637-41307659 TGCCTGACACAGTGAGTTTGGGG - Intergenic
1119266104 14:73264077-73264099 TCCCACCCCAAGTGAGGCTGGGG - Intronic
1120997693 14:90428822-90428844 TCCCTGCCCCACTGACATTGAGG + Intergenic
1121337480 14:93086151-93086173 TCCCTCCCCCAGTGAGTCCAAGG - Intronic
1122417370 14:101556839-101556861 TCCATCCCTCTGGGAGTTTGAGG - Intergenic
1125402309 15:39317415-39317437 TACATTCCCCAGTCAGTTTGTGG - Intergenic
1126743743 15:51804129-51804151 TCCCTCCCCCAGTGCATCTTGGG - Intronic
1128525152 15:68407260-68407282 TCCTGTCCCCAGTGAGGTTGGGG - Intronic
1128646041 15:69379670-69379692 TCCCTCCCCCAGCTAGCTGGAGG + Intronic
1129139761 15:73586842-73586864 TCTGTCACACAGTGAGTTTGTGG - Intronic
1130192672 15:81751315-81751337 TGCGTTCTCCAGTGAGTTTGGGG + Intergenic
1131468790 15:92677298-92677320 TCTTTCCCCCATTGATTTTGTGG + Intronic
1131674298 15:94655307-94655329 TCTCTCCTCCACTGCGTTTGGGG + Intergenic
1132089062 15:98933089-98933111 TCCTTCCCACAGTCAGTGTGTGG + Intronic
1132411536 15:101581954-101581976 TCCCTCCACCAGTGAGTTGAGGG + Intergenic
1132648468 16:1009886-1009908 TCCCTCACACACTGAGTTTCAGG - Intergenic
1132834846 16:1947586-1947608 TCTGTCCCCCAGTGAGATGGTGG - Intronic
1135185469 16:20311751-20311773 CCCCTCCCCCAGTGATTTAGTGG + Intronic
1136522508 16:30805972-30805994 TCCTTCCCCCAGGGAGCTCGGGG - Intergenic
1136908068 16:34120362-34120384 TCTCTTCCCCAGTGAGGTGGTGG + Intergenic
1138048017 16:53746261-53746283 TCCCTGCCACAGTGACTTTGGGG + Intronic
1138798720 16:60000685-60000707 GCCTTTCCCCAGTGACTTTGAGG - Intergenic
1142890943 17:2942199-2942221 TCCCTCCCCGAGTACGTGTGAGG + Intronic
1144159879 17:12547581-12547603 TCCATTCCCCAGTGTGCTTGGGG + Intergenic
1144790188 17:17853703-17853725 TCCTGCCACCAGTGAGTGTGAGG - Intronic
1147179745 17:38676831-38676853 CCCTTCCCCATGTGAGTTTGGGG + Intergenic
1148104670 17:45112899-45112921 CACCTCCCCCAATGACTTTGTGG - Exonic
1148476223 17:47930473-47930495 TCCCTTCTCCAGTGAGATGGGGG + Intergenic
1153018359 18:604915-604937 GCCCTCCCCCAGTGCGTATGTGG + Intronic
1153958351 18:10118194-10118216 CCCCTCCCCCAGTGACTTTATGG + Intergenic
1154171553 18:12056574-12056596 TCCCTGCCCCAGTGCTTCTGGGG + Intergenic
1156245679 18:35295570-35295592 TGCCTTCACCAGTGTGTTTGAGG + Intergenic
1157138946 18:45086268-45086290 GCCCTCCCCCAGTGAGTTTCAGG + Intergenic
1159371234 18:67530081-67530103 TCCCACCGTCAGTGAGTTTGTGG + Intergenic
1159618330 18:70608283-70608305 TCCCTGCCCTAGGGACTTTGCGG + Intergenic
1160153839 18:76416864-76416886 TCCCTCCCCCCTTTAATTTGAGG - Intronic
1160507840 18:79437203-79437225 TCCCGCCCCCTGTGCGTGTGAGG + Intronic
1161217282 19:3100813-3100835 TCCCTCCCCCTGTAGGATTGTGG + Intronic
1161258157 19:3321108-3321130 TCCCTTCCCCAGTGACTTCCAGG - Intergenic
1161310209 19:3589824-3589846 CCCCCAGCCCAGTGAGTTTGAGG + Exonic
1163633945 19:18429885-18429907 TCCCTCCCCCTGTGGGGCTGCGG - Intronic
1163833942 19:19562240-19562262 TCCCTCCTCCACTGAGCTGGAGG - Intronic
1166539244 19:43594710-43594732 TCCCTCCCCCAGTGAGTTTGGGG - Intronic
1167758474 19:51427894-51427916 CCATTCCCCCAGTGCGTTTGTGG - Intergenic
927308734 2:21604047-21604069 TCACTACCCCACTGAGTCTGGGG - Intergenic
929044547 2:37777037-37777059 TCCCTCCCTCAGAGAGGCTGGGG + Intergenic
931700179 2:64903042-64903064 TCCCTCCCCTGGTCAGCTTGGGG + Intergenic
932288527 2:70555523-70555545 TCCCTCCACCTCTGACTTTGGGG - Intergenic
932715785 2:74100174-74100196 TCCCACCCCCAGTGGGGCTGGGG + Intronic
933278240 2:80304692-80304714 TCCCTCCACCAGGCAGTGTGCGG + Exonic
933748855 2:85590415-85590437 GCCCTCCCTCTGGGAGTTTGTGG + Intronic
933850975 2:86366458-86366480 TCCCTCCCCCAGCAAGTCTCAGG - Intergenic
934011883 2:87829552-87829574 TCCCTTCCACTGTGATTTTGAGG - Intergenic
934112481 2:88756479-88756501 TCTCTGCCCCAGTGATATTGGGG - Intergenic
934299575 2:91769035-91769057 TCCCTCCCCCAGTGGCCTGGGGG - Intergenic
934686793 2:96327180-96327202 GCCCTGCACCTGTGAGTTTGTGG + Exonic
935573597 2:104687390-104687412 TCCATCCCTCAGTGCATTTGGGG + Intergenic
935614207 2:105059903-105059925 ACCTTCCCCCAGTGATTTTCTGG + Intronic
936117267 2:109712172-109712194 TCCCTTCCCCAGTGAGCTCAGGG + Intergenic
940256916 2:151740942-151740964 GCCCTCCCCCAGTGGGTATTGGG + Intergenic
940639466 2:156332076-156332098 TTCCTCTCCCTGTCAGTTTGTGG + Intronic
942059639 2:172216209-172216231 GGCCTCTCACAGTGAGTTTGAGG + Intergenic
944299579 2:198107894-198107916 TTTCTCCTCCATTGAGTTTGGGG + Intronic
945572440 2:211485696-211485718 CCCCCACCCCACTGAGTTTGGGG - Intronic
946508627 2:220329440-220329462 TCCTTTCCCCAGTGTGTTTTTGG + Intergenic
947740162 2:232481261-232481283 TCCCTTGCCCAGAGAGTTTGAGG + Intronic
948674254 2:239587784-239587806 ACCCTCACCCCGTGAGTCTGGGG - Intergenic
1169769269 20:9183314-9183336 TCCCTCCCTCAGTTAGTTCTGGG + Intronic
1170546436 20:17438952-17438974 GCCCTCCCTCAATGAGTCTGGGG + Intronic
1171458607 20:25286001-25286023 TCCTTCCCCCAGTGCTTTTTAGG + Intronic
1172657548 20:36546303-36546325 TCCCTCCCCCAGGCAGTGTCTGG - Intronic
1176836933 21:13801807-13801829 TGTCTCCCCCAGTAAGTCTGTGG + Intergenic
1178052667 21:28765244-28765266 TCCTTCCCCAATTGAGTTTCAGG + Intergenic
1180962482 22:19768196-19768218 TGCCTGTCCCAGTGTGTTTGTGG + Intronic
1181085840 22:20438952-20438974 GCCCTCCCTCAGTGAGCCTGTGG - Intronic
1181782754 22:25205043-25205065 TCCCTCCTACAGTGAATTTGGGG + Intronic
1184285890 22:43471349-43471371 TCCCTGCTGCAGTGTGTTTGGGG + Intronic
950105768 3:10387388-10387410 TGCCTCCCCCACTGAGTTTTAGG - Intronic
950497541 3:13343039-13343061 TCCCTTCCCCTGTGAGCTTGCGG - Intronic
950576935 3:13837669-13837691 TCCCTGCCCCAGAGACTTTCCGG - Intronic
953129447 3:40124294-40124316 TCCCGGCCCAAGTGAGTCTGTGG - Intronic
954848182 3:53578056-53578078 TCCATCCCCCACAGACTTTGGGG - Intronic
955289890 3:57682056-57682078 TCTCTCTCCCATTGAGCTTGAGG + Intronic
956338608 3:68194182-68194204 TTCCTACCCCATTGACTTTGAGG - Intronic
956744006 3:72297258-72297280 CCCCACCCCCAGTCAGTCTGGGG - Intergenic
961060390 3:123823660-123823682 TCCCTCACACAGTCAGATTGCGG + Intronic
961701611 3:128748920-128748942 TCCCTGCCCCAGTGGATTTGTGG - Intronic
963348279 3:144122695-144122717 ACCCTCTCCCAGTGAGACTGTGG - Intergenic
967175319 3:186857550-186857572 ACCCTGCCCCAGAGAGTTTAGGG - Exonic
968387649 4:156067-156089 TACCTCCCACAATGATTTTGAGG + Intronic
968902500 4:3438249-3438271 TCCCTTCCTCAGTGAGCCTGGGG - Intronic
969082889 4:4633407-4633429 CCCCTTCCCCACTGAGCTTGGGG + Intergenic
969490782 4:7498173-7498195 TCCCTTAGCCAGTGAGGTTGAGG + Intronic
970606401 4:17686070-17686092 TCCCTGCCACAGTCACTTTGAGG + Intronic
973331661 4:48915495-48915517 TCCCTCCCACAGCTAGTCTGTGG + Intergenic
976230490 4:82837725-82837747 TCCTTCCCCCAGTGATTCTCTGG - Intronic
976785775 4:88818723-88818745 TCCCTCCCAGACTGTGTTTGTGG + Intronic
977518586 4:98052936-98052958 TCCCTTCCTCAGTGAGGTTAGGG - Intronic
979239872 4:118438715-118438737 TCCCTGTCACAGTCAGTTTGGGG + Intergenic
980952361 4:139394173-139394195 TCCCTTCCCCAGTGATTCTAAGG + Intronic
982184948 4:152786667-152786689 TTCCTCCCCCAGTGCTTTTATGG + Intronic
986066656 5:4240858-4240880 TCCCTCCCTCTGTGAGTGTGTGG + Intergenic
986513532 5:8535074-8535096 TCCCTCCCTCAGTGACTTCATGG + Intergenic
989620619 5:43380258-43380280 TGCCTCCCCCAGTCAGTTCTTGG - Exonic
989821233 5:45797382-45797404 TCCCTTCCCCATTGGGTTTTTGG - Intergenic
991138213 5:63208438-63208460 TCTCTCCCCCAGGAACTTTGAGG + Intergenic
993973661 5:94450352-94450374 TCTCTCACCCAGCAAGTTTGGGG + Intronic
994133090 5:96253381-96253403 TCCCACCCCCAGAGATTTTATGG - Intergenic
997885417 5:137625695-137625717 TCATTCCCCCAGTGTGTTGGAGG + Intronic
998398157 5:141832920-141832942 TCCCTCCCACTGTGACCTTGGGG - Intergenic
998515584 5:142750850-142750872 TCCCTTCCCCAGTGACTCAGGGG + Intergenic
998865376 5:146494836-146494858 TACCTCCCACAGTCAGTTTCTGG + Intronic
999706349 5:154275914-154275936 TCCATCTCTCAGTGAGCTTGTGG + Intronic
1000386245 5:160677193-160677215 TCTCCCACCCAGTGAGTTTTGGG + Intronic
1001494568 5:172178844-172178866 TCCCTCCCCCATGGAGCATGTGG + Intronic
1002100771 5:176856505-176856527 TCCTGCCCCCAGGGAGTTTATGG + Intronic
1002740123 5:181429298-181429320 TCCCTGTCACAGTCAGTTTGGGG + Intergenic
1002847670 6:962279-962301 TCCTTCCCACAGTGAATTTTAGG - Intergenic
1004982886 6:21046242-21046264 TCCTTCCCTCCGTGACTTTGGGG + Intronic
1006581247 6:35079034-35079056 CCCCTCCCCGAGTGGGCTTGAGG + Intronic
1006695910 6:35930840-35930862 TCCCTCCCCCAGTGAATCTCAGG - Intergenic
1007149071 6:39669978-39670000 ACCCTTTCCCAGTGACTTTGAGG - Intronic
1009690991 6:67031665-67031687 CCCCTCCCCCTGTGGGCTTGTGG - Intergenic
1013912459 6:115293598-115293620 TCCCTTTCCTAGTGAATTTGAGG + Intergenic
1016633219 6:146256421-146256443 CTCCTCCCCCAGTGTGTCTGGGG + Intronic
1016855982 6:148671195-148671217 TCCTTCCCCCAGGGAGATGGGGG + Intergenic
1019245236 6:170704898-170704920 TCCCTGTCACAGTCAGTTTGGGG + Intergenic
1020412330 7:7906942-7906964 TAGCTCCCCCAGTGACTCTGGGG - Intronic
1020979501 7:15050473-15050495 CCCCACCCCCTGTGATTTTGTGG - Intergenic
1022947998 7:35306846-35306868 TCTCTCCCCCAGTGACTGAGAGG - Intergenic
1023613250 7:41992812-41992834 TGCCAGCCCCAGTAAGTTTGGGG + Intronic
1023832941 7:44050673-44050695 TGCCTCTCCCAGTGAGGATGGGG - Intronic
1029191837 7:98777487-98777509 TCCCTCCCCCATGGGGTTGGGGG + Intergenic
1029441505 7:100589569-100589591 CCCCTCCCCCATGGAGTCTGGGG - Intronic
1030169503 7:106587234-106587256 TCCTTACCTCAGTGACTTTGTGG + Intergenic
1030626070 7:111847548-111847570 TCCCTCCCACAGGGAGTTATGGG - Intronic
1031171707 7:118299936-118299958 TCCCTCTCCCTGGGAATTTGAGG + Intergenic
1032192289 7:129771991-129772013 ACCCTCCTCCAGTGTGTATGTGG + Intergenic
1033595064 7:142853594-142853616 GCCCTCCACCACTGAGTTTCAGG + Intergenic
1035433987 7:158844177-158844199 TCAGTTCCCAAGTGAGTTTGGGG + Intergenic
1035502890 8:103304-103326 TCCCTGTCACAGTCAGTTTGGGG - Intergenic
1036603605 8:10286465-10286487 TGCCTCCCACTGTGATTTTGAGG + Intronic
1036810802 8:11867002-11867024 TCACTTCTCCAGTGGGTTTGGGG + Intronic
1039031221 8:33311719-33311741 TGCCTCCCCCACTGACTTTTGGG - Intergenic
1039518975 8:38154714-38154736 TCCCTCCCCCATAGAATTAGAGG - Intergenic
1041675001 8:60529445-60529467 CCCCTCCCCGCGTGAATTTGGGG + Intronic
1041798481 8:61772378-61772400 TCCCTCTCCTAGTAGGTTTGGGG + Intergenic
1047747094 8:127853366-127853388 GCCCCCCACGAGTGAGTTTGAGG + Intergenic
1049302762 8:141880347-141880369 CCCCTCCCCCAGTGTGTGGGGGG + Intergenic
1049562447 8:143318483-143318505 TCCCTCCACCAGTCCCTTTGGGG + Intronic
1049656514 8:143801161-143801183 TCGCTTCCCCAGTGATTTGGGGG - Intronic
1054750888 9:68905160-68905182 TCCCTCCCCCAAATACTTTGTGG - Intronic
1055393858 9:75852253-75852275 TCCCTCCCCCAGTTCCTTAGAGG - Intergenic
1056808300 9:89745234-89745256 GCCCTCCCCCACTGAGAGTGGGG - Intergenic
1057259412 9:93575893-93575915 TCCGTTCCCCACTGAGTTTCTGG - Intergenic
1057516769 9:95728892-95728914 GCTCTCCACCAGTGGGTTTGTGG - Intergenic
1059653423 9:116335622-116335644 TCACTCCCTCAGTGCTTTTGAGG + Intronic
1062392432 9:136339310-136339332 CCCCTCACCCAGTGACTTGGAGG + Intronic
1203605432 Un_KI270748v1:54106-54128 TCCCTGTCACAGTCAGTTTGGGG + Intergenic
1186162671 X:6793980-6794002 TCCCTCCACCAGTGAACTTGGGG + Intergenic
1189076662 X:37922757-37922779 TTCCTCTCCCAGTAAGATTGAGG + Intronic
1199132601 X:144208997-144209019 TCCCTTCCACTGTGATTTTGAGG + Intergenic
1200056175 X:153462497-153462519 TTCCTCCCCTAGTGCCTTTGAGG - Intronic
1200987718 Y:9321521-9321543 TCATTTCCCCAGTGTGTTTGAGG - Intergenic
1201557133 Y:15274485-15274507 TCCCACCACCAGTGAACTTGGGG + Intergenic
1201941167 Y:19461835-19461857 ACCCTAGCCCAGTGAGGTTGAGG - Intergenic
1202108830 Y:21400272-21400294 TCATTTCCCCAGTGTGTTTGAGG - Intergenic
1202120308 Y:21514678-21514700 TCATTTCCCCAGTGTGTTTGAGG + Intronic
1202122759 Y:21538219-21538241 TCATTTCCCCAGTGTGTTTGAGG + Intronic
1202156246 Y:21891162-21891184 TCATTTCCCCAGTGTGTTTGAGG - Intronic
1202158694 Y:21914703-21914725 TCATTTCCCCAGTGTGTTTGAGG - Intronic
1202185146 Y:22179628-22179650 TCATTTCCCCAGTGTGTTTGAGG - Intronic
1202206214 Y:22406769-22406791 TCATTTCCCCAGTGTGTTTGAGG + Intronic
1202387617 Y:24340546-24340568 TCCCTGTCACAGTCAGTTTGGGG + Intergenic
1202483169 Y:25329582-25329604 TCCCTGTCACAGTCAGTTTGGGG - Intergenic