ID: 1166539245

View in Genome Browser
Species Human (GRCh38)
Location 19:43594711-43594733
Sequence ATCCCTCCCCCAGTGAGTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 117}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166539245_1166539252 13 Left 1166539245 19:43594711-43594733 CCCAAACTCACTGGGGGAGGGAT 0: 1
1: 0
2: 1
3: 14
4: 117
Right 1166539252 19:43594747-43594769 ATGGTCGCACCTAGGTGCCTAGG 0: 1
1: 0
2: 0
3: 8
4: 65
1166539245_1166539249 5 Left 1166539245 19:43594711-43594733 CCCAAACTCACTGGGGGAGGGAT 0: 1
1: 0
2: 1
3: 14
4: 117
Right 1166539249 19:43594739-43594761 GGACCTCCATGGTCGCACCTAGG 0: 1
1: 0
2: 0
3: 10
4: 54
1166539245_1166539255 27 Left 1166539245 19:43594711-43594733 CCCAAACTCACTGGGGGAGGGAT 0: 1
1: 0
2: 1
3: 14
4: 117
Right 1166539255 19:43594761-43594783 GTGCCTAGGGTCTCGACTAACGG 0: 1
1: 0
2: 0
3: 0
4: 31
1166539245_1166539248 -6 Left 1166539245 19:43594711-43594733 CCCAAACTCACTGGGGGAGGGAT 0: 1
1: 0
2: 1
3: 14
4: 117
Right 1166539248 19:43594728-43594750 AGGGATCTCATGGACCTCCATGG 0: 1
1: 0
2: 1
3: 15
4: 168
1166539245_1166539253 14 Left 1166539245 19:43594711-43594733 CCCAAACTCACTGGGGGAGGGAT 0: 1
1: 0
2: 1
3: 14
4: 117
Right 1166539253 19:43594748-43594770 TGGTCGCACCTAGGTGCCTAGGG 0: 1
1: 0
2: 0
3: 1
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166539245 Original CRISPR ATCCCTCCCCCAGTGAGTTT GGG (reversed) Intronic
902966985 1:20012499-20012521 ACCCCTGCCCCAGTGTGTCTTGG - Intergenic
904999218 1:34655178-34655200 ATCCCTCCCACCTTGAGCTTGGG - Intergenic
910549549 1:88460337-88460359 ATCCCACCCCCACTGAGATGTGG - Intergenic
911793893 1:102053284-102053306 AACCCTCCCCAAGTCAGTTCCGG - Intergenic
915430796 1:155865267-155865289 TTCCCTCATCCAGTGAGGTTCGG + Intronic
916521113 1:165564123-165564145 ATCCCTCCAGCACTTAGTTTGGG - Intergenic
916597132 1:166254641-166254663 ATCCCTTCCCCATTGACTTTGGG - Intergenic
916788684 1:168105474-168105496 AGCCCACCGCCAGTCAGTTTTGG + Intronic
919188465 1:194184874-194184896 ATCCTTCCCCCAGGGAATTATGG - Intergenic
1070673151 10:78392333-78392355 GTCCCTCCTCCAGTAAGATTTGG - Intergenic
1071934907 10:90518356-90518378 AACCTTCTCCCAATGAGTTTGGG - Intergenic
1072806157 10:98425088-98425110 ACCCCACCCCCAGTGAGCTTAGG - Intronic
1078420992 11:11212771-11212793 CTCCCACACCCACTGAGTTTAGG - Intergenic
1084597066 11:70123291-70123313 CGCCCTCCACCTGTGAGTTTGGG + Intronic
1101524054 12:105511571-105511593 TTCCCTCCCCAGGTGAGTCTGGG + Intergenic
1103324048 12:120108694-120108716 ATCTCTCCCCCAGGGGATTTGGG - Intronic
1104367171 12:128188334-128188356 ATCCCTTCCACAGAGACTTTGGG - Intergenic
1106982548 13:35305472-35305494 TCCCCTCCTCCAGTGAGATTGGG + Intronic
1108722586 13:53147518-53147540 ATCCCACACCCAGTGTGTTCGGG - Intergenic
1111619843 13:90710416-90710438 ATCCTTCCCCCAGTGAGTTAGGG - Intergenic
1112092110 13:96092043-96092065 ATCCCTCCCTAAGTGGCTTTTGG + Intronic
1113565708 13:111318510-111318532 ACCCCTCTCCCTGTGAGTCTGGG + Intronic
1113644993 13:111988400-111988422 ATCCCTGCCCCAGTGTGCTTAGG + Intergenic
1114126239 14:19729798-19729820 CTCCCTCTCCCAGTGGGCTTTGG + Intronic
1114710727 14:24775313-24775335 ATGCCTCCGCTGGTGAGTTTGGG - Intergenic
1120128015 14:80770121-80770143 ATCAATCCCTCAGTGAGTTAAGG + Intronic
1122044694 14:99015143-99015165 ATCCCTCCCCCAGGCACTCTTGG + Intergenic
1126743744 15:51804130-51804152 TTCCCTCCCCCAGTGCATCTTGG - Intronic
1128525153 15:68407261-68407283 ATCCTGTCCCCAGTGAGGTTGGG - Intronic
1130039964 15:80398093-80398115 ATCCCTGCCCTTCTGAGTTTTGG + Intronic
1130192671 15:81751314-81751336 ATGCGTTCTCCAGTGAGTTTGGG + Intergenic
1131300930 15:91199265-91199287 ATCCTTCCCCCAGAGAGTGACGG - Intronic
1132411535 15:101581953-101581975 GTCCCTCCACCAGTGAGTTGAGG + Intergenic
1133669140 16:8000360-8000382 ATCCCTCCCTGAGTGATTTTGGG + Intergenic
1138048016 16:53746260-53746282 TTCCCTGCCACAGTGACTTTGGG + Intronic
1151180430 17:72323384-72323406 TTCCCTGCCCCTTTGAGTTTAGG - Intergenic
1151513257 17:74575400-74575422 ATTCCTCCCACAGTTAGTTTGGG + Intergenic
1152124700 17:78439303-78439325 ATGCCTCCCTCATTTAGTTTCGG + Intronic
1153963780 18:10161879-10161901 GTCCCTCCCCTAGTGAGGCTTGG - Intergenic
1156338321 18:36188477-36188499 ATCCCTCTGCCAGGGACTTTGGG + Intronic
1157480853 18:48052680-48052702 ATTCCTCCCCCAGAGGGTTTTGG - Intronic
1158217884 18:55119247-55119269 ATCTGGCCCTCAGTGAGTTTAGG + Intergenic
1162852618 19:13442360-13442382 ATCCCTCAACCAGTGAGCTAGGG - Intronic
1163657915 19:18558341-18558363 CTGCCTCTCCCTGTGAGTTTCGG + Intronic
1166539245 19:43594711-43594733 ATCCCTCCCCCAGTGAGTTTGGG - Intronic
1167709487 19:51101405-51101427 TTCCCTCCCCCAGAGACATTTGG + Intronic
927308735 2:21604048-21604070 ATCACTACCCCACTGAGTCTGGG - Intergenic
927346974 2:22056370-22056392 ATCTGTACCCCATTGAGTTTTGG - Intergenic
928229876 2:29488916-29488938 TTCCCTCCCCCAGTGATTACTGG - Intronic
929044546 2:37777036-37777058 ATCCCTCCCTCAGAGAGGCTGGG + Intergenic
929570485 2:43019741-43019763 CTCCCTCCTCCACTGAGTATGGG - Intergenic
930267442 2:49216374-49216396 ATCCCTCTCCTATTGAGTGTGGG - Intergenic
931181727 2:59908424-59908446 ATCCCTCCCACACTGAGTTGGGG - Intergenic
932670887 2:73737303-73737325 ATCCGGCCCCCAGTGCGTCTCGG + Exonic
933319777 2:80758793-80758815 CTCTCTCCCCCATTCAGTTTGGG + Intergenic
933638954 2:84739305-84739327 ATCCATCCCCAAGTGTGTCTTGG + Intronic
934085587 2:88506449-88506471 ATCCTTCCACCATTGAATTTGGG - Intergenic
936117266 2:109712171-109712193 ATCCCTTCCCCAGTGAGCTCAGG + Intergenic
936134357 2:109876747-109876769 ATCCCTTCTCCGGTGGGTTTGGG - Intergenic
936210340 2:110494738-110494760 ATCCCTTCTCCGGTGGGTTTGGG + Intergenic
936434927 2:112496131-112496153 ATCCCTTCTCCTGTGGGTTTGGG + Intronic
940256915 2:151740941-151740963 AGCCCTCCCCCAGTGGGTATTGG + Intergenic
940513461 2:154649284-154649306 AGCCCTCATCCAGTGATTTTTGG + Intergenic
941395587 2:164969088-164969110 GTCCCTCCCCCTGTGCATTTAGG + Intergenic
946963477 2:225010307-225010329 TGCCCTCCCACACTGAGTTTAGG - Intronic
1169769268 20:9183313-9183335 CTCCCTCCCTCAGTTAGTTCTGG + Intronic
1170017483 20:11797965-11797987 ATCTATCCCCCAGAGATTTTAGG + Intergenic
1170546435 20:17438951-17438973 AGCCCTCCCTCAATGAGTCTGGG + Intronic
1172251440 20:33482276-33482298 ATCTCTCCCTCTGGGAGTTTTGG + Intergenic
1173066135 20:39713873-39713895 ATCTCTGCCCCAGTGCCTTTGGG - Intergenic
1174068918 20:47886423-47886445 ATCCCTGCCCCACTGACTTTGGG + Intergenic
1176120073 20:63450348-63450370 CTCCCTCCCCAAGTGGCTTTAGG + Intronic
1178288992 21:31350358-31350380 CTCCCTGCCCCAGTATGTTTTGG - Intronic
1181782753 22:25205042-25205064 GTCCCTCCTACAGTGAATTTGGG + Intronic
950334683 3:12183884-12183906 TTCCCTCCACCAGTGTGCTTGGG + Intronic
953484189 3:43279338-43279360 ATCCCTACCCCTCTGAGTCTGGG - Intergenic
955747090 3:62150618-62150640 AGCCCTGCCCCAGTGATCTTAGG + Intronic
955832088 3:63015520-63015542 ATCCCTCCCCCTGGGAGCTCAGG + Intergenic
962669152 3:137687243-137687265 AGCCCTCTCCCAGTGAGAATAGG - Intergenic
962891905 3:139679313-139679335 ACCCCTACCGCACTGAGTTTTGG + Intergenic
963057100 3:141194547-141194569 CTCCTTCCCCCAGTCAGCTTGGG - Intergenic
963635186 3:147785742-147785764 GTCCTTTCCCCAGTGAGTGTTGG - Intergenic
966719487 3:183047183-183047205 TCTCCTCCCCCAGTGAGGTTAGG - Intronic
967175320 3:186857551-186857573 AACCCTGCCCCAGAGAGTTTAGG - Exonic
970071475 4:12164462-12164484 ATCCCTACCCAAGGGAGTTTTGG - Intergenic
970338052 4:15073354-15073376 ATCCCGGCTCCAGTGAGTGTAGG - Intergenic
974747707 4:66097949-66097971 CTCCCTGCCTCAGTCAGTTTGGG + Intergenic
974817720 4:67026847-67026869 GTCACTTCCCCAGTGAGTATTGG - Intergenic
975077926 4:70236145-70236167 TTCCCCCACCCAGTGAATTTGGG + Intergenic
977021845 4:91769672-91769694 ATCCCTAGGCCAGTGAGTATAGG + Intergenic
977050190 4:92119733-92119755 ATGCCTACCCCATTGGGTTTTGG + Intergenic
977518587 4:98052937-98052959 TTCCCTTCCTCAGTGAGGTTAGG - Intronic
984299278 4:177894205-177894227 ATCCCTCTCCCCTTGAATTTGGG - Intronic
987035798 5:14017197-14017219 ACCCCTCCTCCAGTAAGGTTGGG - Intergenic
995745347 5:115396239-115396261 TTCCCTCCCACAGTGAGGTTAGG - Intergenic
996131741 5:119789698-119789720 ATCCCTCACACTGGGAGTTTAGG + Intergenic
996640363 5:125744183-125744205 ACCCCTGCACCAGTGAGCTTAGG + Intergenic
998515583 5:142750849-142750871 ATCCCTTCCCCAGTGACTCAGGG + Intergenic
998671592 5:144359991-144360013 ATGTCTTCCCCAGTGATTTTTGG + Intronic
1000386244 5:160677192-160677214 CTCTCCCACCCAGTGAGTTTTGG + Intronic
1001402968 5:171456946-171456968 ACCCCTCCCCCCAAGAGTTTTGG - Exonic
1002639264 5:180622974-180622996 ATCCCTGGTCCTGTGAGTTTTGG - Intronic
1004351795 6:14896616-14896638 ATCCCTCCCACACTGACTCTGGG + Intergenic
1010259935 6:73804136-73804158 TTTCCTGCCCCAGTGAGGTTAGG - Intronic
1010887799 6:81265023-81265045 ATCCCTTCTCAAGTTAGTTTTGG + Intergenic
1011200982 6:84835722-84835744 AGCCCTCCCTCAGTGAGCTCTGG + Intergenic
1012445452 6:99302700-99302722 ATTCCTCTCCCTGTGAGTGTAGG - Intronic
1016633218 6:146256420-146256442 ACTCCTCCCCCAGTGTGTCTGGG + Intronic
1019661978 7:2229636-2229658 CTCACTCCCCCAGGCAGTTTGGG + Intronic
1020412331 7:7906943-7906965 ATAGCTCCCCCAGTGACTCTGGG - Intronic
1021048376 7:15951988-15952010 ATCTCTCCCCCAATTTGTTTTGG + Intergenic
1030626071 7:111847549-111847571 GTCCCTCCCACAGGGAGTTATGG - Intronic
1031432400 7:121688187-121688209 AACCTTCCCCCAAAGAGTTTTGG + Intergenic
1035375351 7:158403707-158403729 ACCCCTCCCCGAGTGGGTCTTGG - Intronic
1036123049 8:6038603-6038625 ATGCCACCCCCAGGGAGTGTGGG + Intergenic
1036975300 8:13404421-13404443 CCCCCTACCCCAGTGTGTTTCGG - Intronic
1039031222 8:33311720-33311742 GTGCCTCCCCCACTGACTTTTGG - Intergenic
1039380544 8:37080863-37080885 ATCACTTCTCCAATGAGTTTGGG - Intergenic
1044662543 8:94605745-94605767 TTCCCTCCCACATTGAGTCTGGG + Intergenic
1048503736 8:135002117-135002139 TTGCATCCGCCAGTGAGTTTTGG + Intergenic
1049041998 8:140119445-140119467 ACGCCTCACCCCGTGAGTTTTGG + Intronic
1050139872 9:2506462-2506484 ATTCCTCCCTCACTGAGTGTGGG + Intergenic
1052275780 9:26674932-26674954 ATTCCTCCCACAGAAAGTTTGGG + Intergenic
1056785775 9:89591690-89591712 AGCCCTCCCCCAGAGAGTGAAGG + Intergenic
1057454363 9:95194116-95194138 CTGCCTGGCCCAGTGAGTTTTGG - Intronic
1058764205 9:108165494-108165516 ATCAAGCCCCCAGTGAGTTGAGG - Intergenic
1059964009 9:119595654-119595676 TACCCTCCCCCTGGGAGTTTGGG + Intergenic
1186162670 X:6793979-6794001 CTCCCTCCACCAGTGAACTTGGG + Intergenic
1186815276 X:13231024-13231046 ATTCCTCTCCCATTGAGTGTGGG + Intergenic
1187628525 X:21142884-21142906 ATCCCTTCTCCAGTGACCTTGGG - Intergenic
1189976174 X:46462973-46462995 TTACCACCCTCAGTGAGTTTGGG + Intronic
1189982896 X:46528662-46528684 TTACCACCCTCAGTGAGTTTGGG - Intronic
1198404177 X:136296015-136296037 ATCGCTGCCCCACTGAGTCTTGG + Intergenic