ID: 1166539246

View in Genome Browser
Species Human (GRCh38)
Location 19:43594712-43594734
Sequence GATCCCTCCCCCAGTGAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 107}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166539246_1166539252 12 Left 1166539246 19:43594712-43594734 CCAAACTCACTGGGGGAGGGATC 0: 1
1: 0
2: 2
3: 7
4: 107
Right 1166539252 19:43594747-43594769 ATGGTCGCACCTAGGTGCCTAGG 0: 1
1: 0
2: 0
3: 8
4: 65
1166539246_1166539253 13 Left 1166539246 19:43594712-43594734 CCAAACTCACTGGGGGAGGGATC 0: 1
1: 0
2: 2
3: 7
4: 107
Right 1166539253 19:43594748-43594770 TGGTCGCACCTAGGTGCCTAGGG 0: 1
1: 0
2: 0
3: 1
4: 51
1166539246_1166539255 26 Left 1166539246 19:43594712-43594734 CCAAACTCACTGGGGGAGGGATC 0: 1
1: 0
2: 2
3: 7
4: 107
Right 1166539255 19:43594761-43594783 GTGCCTAGGGTCTCGACTAACGG 0: 1
1: 0
2: 0
3: 0
4: 31
1166539246_1166539248 -7 Left 1166539246 19:43594712-43594734 CCAAACTCACTGGGGGAGGGATC 0: 1
1: 0
2: 2
3: 7
4: 107
Right 1166539248 19:43594728-43594750 AGGGATCTCATGGACCTCCATGG 0: 1
1: 0
2: 1
3: 15
4: 168
1166539246_1166539249 4 Left 1166539246 19:43594712-43594734 CCAAACTCACTGGGGGAGGGATC 0: 1
1: 0
2: 2
3: 7
4: 107
Right 1166539249 19:43594739-43594761 GGACCTCCATGGTCGCACCTAGG 0: 1
1: 0
2: 0
3: 10
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166539246 Original CRISPR GATCCCTCCCCCAGTGAGTT TGG (reversed) Intronic
903681151 1:25098114-25098136 GATCCCTCCCCATTTGAGTTGGG - Intergenic
903936926 1:26902109-26902131 CATCCTTCCCCAAGTGAGTTAGG + Intronic
904156913 1:28491492-28491514 GGTCCCACCCCCAGTGATTATGG - Intronic
908772555 1:67609897-67609919 GATCCGTCCCCAAGTGCCTTGGG + Intergenic
910654042 1:89601857-89601879 GATCACAGCCCCAGTGATTTAGG + Intergenic
916597133 1:166254642-166254664 CATCCCTTCCCCATTGACTTTGG - Intergenic
918551689 1:185749626-185749648 GATCCCTCCACAAGTTATTTTGG + Intronic
924212642 1:241786661-241786683 GATCCCTCCTCCCTTAAGTTTGG + Intronic
1065207990 10:23375258-23375280 GATTCCTCCCAAAGTTAGTTTGG + Intergenic
1065699600 10:28411893-28411915 AATGCCCCACCCAGTGAGTTGGG + Intergenic
1068681710 10:59827068-59827090 CGTCCCTCCTCCAGTCAGTTAGG - Intronic
1073260556 10:102186902-102186924 TTTCCCTCCCTCAGTCAGTTGGG - Intergenic
1075001001 10:118797669-118797691 GATCCTTTCCCCAGTGAAATGGG + Intergenic
1078147716 11:8733174-8733196 GCTCCCTACCCCAGGGAGTGCGG - Intronic
1080166454 11:29242936-29242958 AATCCCTATCCCAGTGAGTGTGG + Intergenic
1082193367 11:49273473-49273495 GGTCCCTCCCCCAGCCAGTGGGG - Intergenic
1083262435 11:61530546-61530568 GATCCCTCTGCCAGTGGGTCAGG - Intronic
1084602194 11:70152499-70152521 GGTCCCTCTCCCAGGGAGATAGG - Intronic
1084772064 11:71349731-71349753 GTTCACTCCCACAGTGAGTCAGG + Intergenic
1089559818 11:119338155-119338177 GAGCCCTCCCCCACTGTGCTGGG - Intergenic
1091646617 12:2276870-2276892 GGTCCCTGCCCCAGTGATTCAGG - Intronic
1094493044 12:30973089-30973111 CATCCCTCCCCCATTTAGTGGGG + Intronic
1097600018 12:61679728-61679750 GAAACCTCCCCCATTGAGTGTGG - Intergenic
1100128532 12:91460676-91460698 GATTCTACCCCCAGTGATTTAGG - Intergenic
1104367172 12:128188335-128188357 GATCCCTTCCACAGAGACTTTGG - Intergenic
1104723651 12:131061201-131061223 GTTCCCACCCCCAGTGACTCAGG + Intronic
1105702510 13:22943901-22943923 GATCCCTGCCACAGTGATTCAGG + Intergenic
1105855138 13:24365682-24365704 GATCCCTGCCACAGTGATTCAGG + Intergenic
1108722587 13:53147519-53147541 AATCCCACACCCAGTGTGTTCGG - Intergenic
1110151431 13:72259577-72259599 GATCCCTCCAGCAGTGAGAAAGG + Intergenic
1110184204 13:72654638-72654660 GATGCCTGCCCCACTGAGGTGGG - Intergenic
1111619844 13:90710417-90710439 TATCCTTCCCCCAGTGAGTTAGG - Intergenic
1120103615 14:80470828-80470850 GTTCCATCCCCCTGTGATTTGGG + Intergenic
1122285449 14:100649077-100649099 GATCCCCACCCCAGTGAGTCTGG + Intergenic
1124198968 15:27660243-27660265 GTTCCCTCCCCCGGTGATTCTGG - Intergenic
1128883098 15:71261345-71261367 GATCCTTCCTCCAGAGACTTTGG + Intronic
1129167611 15:73787641-73787663 GAAGCCTCCACCAGTGAGCTGGG - Intergenic
1131069002 15:89452618-89452640 GAACCCTCCCCCAGAGGGTGGGG - Intergenic
1133669139 16:8000359-8000381 CATCCCTCCCTGAGTGATTTTGG + Intergenic
1135341339 16:21650727-21650749 GTTCCCTCCCCCAACCAGTTAGG + Intronic
1136254561 16:29029477-29029499 GAGGCCTCCCCCAGGGAGGTGGG + Intergenic
1136522510 16:30805974-30805996 GGTCCTTCCCCCAGGGAGCTCGG - Intergenic
1136586408 16:31188548-31188570 GGTTCCACCCCCAGTGATTTAGG + Intronic
1136687205 16:32002618-32002640 GGTCCCTGCCCCAGTGAGCCCGG + Intergenic
1136787818 16:32946169-32946191 GGTCCCTGCCCCAGTGAGCCCGG + Intergenic
1138994095 16:62427337-62427359 TATTTCTCCCCCAGAGAGTTTGG - Intergenic
1139769083 16:69258512-69258534 GATTACTCCTCCAGTGAATTAGG - Intronic
1140242889 16:73219737-73219759 GCTGCCTCCCCCAGTCAGTAGGG + Intergenic
1141265413 16:82492379-82492401 CTTCCCTCCTCCAATGAGTTAGG - Intergenic
1141684707 16:85563645-85563667 GCTCCCTCCCACAGTGAGACAGG + Intergenic
1143376634 17:6471151-6471173 GGTGCCTCCCGCAGTGAGTGAGG - Exonic
1147148183 17:38498287-38498309 GGTCCCTGCCCCAGTGAGCCCGG + Intronic
1151513256 17:74575399-74575421 AATTCCTCCCACAGTTAGTTTGG + Intergenic
1156933601 18:42675641-42675663 GATCCTTCCCCTAGTGTGTGTGG + Intergenic
1158670329 18:59468503-59468525 GATCCCTGCCCCATTCACTTGGG + Intronic
1162377603 19:10314379-10314401 CATCTGTCCCCCAGTGAGATTGG - Intronic
1162852619 19:13442361-13442383 CATCCCTCAACCAGTGAGCTAGG - Intronic
1164719443 19:30421703-30421725 GATCTCTCACCCTGTGACTTAGG - Intronic
1166539246 19:43594712-43594734 GATCCCTCCCCCAGTGAGTTTGG - Intronic
927741154 2:25570709-25570731 GATCCTGCCTCCAGTGAGGTGGG - Intronic
929570486 2:43019742-43019764 GCTCCCTCCTCCACTGAGTATGG - Intergenic
931181728 2:59908425-59908447 TATCCCTCCCACACTGAGTTGGG - Intergenic
931676293 2:64699819-64699841 GGTCCCTCCCCCAGTGCATGGGG - Intronic
936113179 2:109681859-109681881 GATCAGTCCCACAGGGAGTTTGG - Intergenic
942882840 2:180883393-180883415 GATCACTCCTCCAGTGACTGAGG - Intergenic
943566136 2:189519233-189519255 GATCCCTCACACAGAGGGTTAGG - Intergenic
1170546434 20:17438950-17438972 GAGCCCTCCCTCAATGAGTCTGG + Intronic
1172971189 20:38874093-38874115 GTTCCCTCCCCCAGTGAACAGGG - Intronic
1173150405 20:40562155-40562177 GACCCCACCCCCAGAGAGTGAGG - Intergenic
1174068917 20:47886422-47886444 CATCCCTGCCCCACTGACTTTGG + Intergenic
1175209279 20:57339551-57339573 GATCCCACCCCTAGAGATTTTGG - Intronic
1177887458 21:26763332-26763354 AATTCCTCCCACAGTTAGTTTGG + Intergenic
1179897123 21:44369331-44369353 GATCCATCCCACGGTGAGTGCGG + Exonic
949511852 3:4773152-4773174 GAGCCCTACTCCAGTGAGATGGG - Intronic
954148425 3:48645737-48645759 GATGCCTCTCCCCGTGAGGTGGG - Exonic
959095991 3:101956438-101956460 GCTCCTTTCCCCAGTGAGGTTGG - Intergenic
972724219 4:41732116-41732138 GCTCCCTCCCCCTGTGCCTTTGG - Intergenic
973955045 4:56055207-56055229 AATCCCTCCCCAGGTGAGTGGGG - Intergenic
977039783 4:92001915-92001937 GCCCCCTCCCCCAGTAAATTTGG - Intergenic
979775397 4:124583187-124583209 CACCCCTCCCCCTGCGAGTTTGG - Intergenic
989777611 5:45227675-45227697 GATCCCTCTCCCAGAGATTCTGG - Intergenic
993039010 5:82790871-82790893 AATTCCTCCCAAAGTGAGTTTGG - Intergenic
995111048 5:108428872-108428894 CATCCCTCCTCCAAGGAGTTCGG + Intergenic
996388853 5:122938266-122938288 GACCCTCTCCCCAGTGAGTTTGG + Intronic
998515582 5:142750848-142750870 CATCCCTTCCCCAGTGACTCAGG + Intergenic
999100597 5:149022069-149022091 GATCCCTCATAGAGTGAGTTGGG - Intronic
999418427 5:151419888-151419910 GATACCTCCCCCAGTGGGCGTGG + Intergenic
1004351794 6:14896615-14896637 GATCCCTCCCACACTGACTCTGG + Intergenic
1006342116 6:33452636-33452658 CCCCCCTCCCCCAGTGTGTTGGG + Exonic
1018659195 6:166069541-166069563 GATCCCTCCCCCAACAAGTGGGG - Intergenic
1019014937 6:168873412-168873434 AATCCCTCTCCCTGTGAGCTTGG + Intergenic
1019661977 7:2229635-2229657 GCTCACTCCCCCAGGCAGTTTGG + Intronic
1019771074 7:2883821-2883843 GCTGCCTCCCTCAGTGACTTAGG + Intergenic
1024000819 7:45188340-45188362 AATGCCTCCCCCAGTGAGTAAGG - Intergenic
1024404815 7:48966496-48966518 GCTCCTACTCCCAGTGAGTTCGG + Intergenic
1028380565 7:90194622-90194644 GAACCGTCCCCCAGTGATTGAGG + Intronic
1036123048 8:6038602-6038624 GATGCCACCCCCAGGGAGTGTGG + Intergenic
1036631249 8:10517564-10517586 GCTGCCTCCCCCAGGGTGTTGGG + Intergenic
1038328696 8:26591073-26591095 GATCACCACCCCAGTGAGTCAGG - Intronic
1039155696 8:34554223-34554245 GATCACTGCCCCAGTGTGTCTGG + Intergenic
1039554214 8:38465562-38465584 TATCCTACCCCCAGTGGGTTAGG - Intronic
1042052852 8:64730848-64730870 GATCCCTCCCCTAGTATGTGGGG - Intronic
1049386886 8:142347338-142347360 GATCCCTCCCTCTGTGACTTGGG - Intronic
1052135722 9:24907495-24907517 GAAACCTCCACCAGTGTGTTAGG + Intergenic
1052680325 9:31683463-31683485 GTACCCCCCCTCAGTGAGTTAGG - Intergenic
1053177569 9:35939165-35939187 GCTCCCTTACCCAGTGAGTTTGG + Intergenic
1055538166 9:77270756-77270778 GATCCTTCCCCCACTTAGCTAGG - Intronic
1060881234 9:127119653-127119675 CCTCCATCCCCCAGTGATTTAGG - Intronic
1186212950 X:7269283-7269305 TATCTATGCCCCAGTGAGTTGGG - Intronic
1186412889 X:9359363-9359385 CCTCCCTCCTGCAGTGAGTTAGG - Intergenic
1187020479 X:15376156-15376178 TATCCCTCCCTCAGAGAGTCAGG - Intronic
1189976173 X:46462972-46462994 GTTACCACCCTCAGTGAGTTTGG + Intronic
1189982897 X:46528663-46528685 GTTACCACCCTCAGTGAGTTTGG - Intronic
1193018847 X:76768142-76768164 GATTTCTCCCCCAGTGAGTTTGG + Intergenic
1195147188 X:102029444-102029466 GAGCCCCCACCCAGTGAGTATGG - Intergenic
1195568759 X:106376095-106376117 GTTCCCTCCCCCAGTATGTGGGG + Intergenic
1197009188 X:121540209-121540231 GATCCCTCACCCCTTGAGTCAGG + Intergenic