ID: 1166539249

View in Genome Browser
Species Human (GRCh38)
Location 19:43594739-43594761
Sequence GGACCTCCATGGTCGCACCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 54}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166539246_1166539249 4 Left 1166539246 19:43594712-43594734 CCAAACTCACTGGGGGAGGGATC 0: 1
1: 0
2: 2
3: 7
4: 107
Right 1166539249 19:43594739-43594761 GGACCTCCATGGTCGCACCTAGG 0: 1
1: 0
2: 0
3: 10
4: 54
1166539245_1166539249 5 Left 1166539245 19:43594711-43594733 CCCAAACTCACTGGGGGAGGGAT 0: 1
1: 0
2: 1
3: 14
4: 117
Right 1166539249 19:43594739-43594761 GGACCTCCATGGTCGCACCTAGG 0: 1
1: 0
2: 0
3: 10
4: 54
1166539244_1166539249 6 Left 1166539244 19:43594710-43594732 CCCCAAACTCACTGGGGGAGGGA 0: 1
1: 0
2: 1
3: 16
4: 218
Right 1166539249 19:43594739-43594761 GGACCTCCATGGTCGCACCTAGG 0: 1
1: 0
2: 0
3: 10
4: 54
1166539240_1166539249 11 Left 1166539240 19:43594705-43594727 CCTTGCCCCAAACTCACTGGGGG 0: 1
1: 0
2: 3
3: 22
4: 232
Right 1166539249 19:43594739-43594761 GGACCTCCATGGTCGCACCTAGG 0: 1
1: 0
2: 0
3: 10
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166539249 Original CRISPR GGACCTCCATGGTCGCACCT AGG Intronic
902188186 1:14741066-14741088 GGACCTCCATGGTAGCACAAGGG - Intronic
903178353 1:21593461-21593483 GGACCTCCATGGCCAACCCTGGG - Intergenic
904541736 1:31238399-31238421 GGACCTCCATCGCCGAACCCAGG - Intronic
915291830 1:154889452-154889474 GGACCGCCATGGTAGGAACTTGG + Intergenic
920301015 1:204989004-204989026 GGACCACTGTGGTCACACCTGGG + Intronic
923034869 1:230278821-230278843 GCACCTCCATGCTCCCACTTAGG - Intronic
1063370173 10:5516084-5516106 AGACCTCCATGCTGGCCCCTGGG - Intergenic
1065628640 10:27655325-27655347 GGACCTCCATGGGCCGGCCTGGG - Intergenic
1067222127 10:44351956-44351978 GGAACCCCATGCTCTCACCTGGG - Intergenic
1077231430 11:1459672-1459694 GGGCCTCCATCGACACACCTGGG + Intronic
1080635273 11:34118255-34118277 GGGCCTCCATGGTGGCAACGTGG - Exonic
1084331451 11:68432898-68432920 TGGCCTCCATGGTCACACGTAGG + Intronic
1087386416 11:97474656-97474678 TGTCCTCCATGGGCACACCTAGG + Intergenic
1088812719 11:113402291-113402313 GAACCTCCAGGGTAGGACCTTGG + Intergenic
1089325015 11:117651035-117651057 TGACCTCCAAGGTCCCACCCAGG - Intronic
1091391621 12:129564-129586 GGACCTGCATGCTCACTCCTTGG - Intronic
1092282945 12:7110848-7110870 GGCCCACCTTGGTCTCACCTAGG + Intergenic
1102460537 12:113097070-113097092 GGACCTGCCTGGTGGCAGCTGGG + Exonic
1102863148 12:116353840-116353862 GGACCTCAATGCTAGCAACTAGG + Intergenic
1104994079 12:132643191-132643213 GGCCCTCCATGGCAGCACATTGG - Intronic
1113583530 13:111447138-111447160 GGACCACCAAGGTGGCACCCTGG + Intergenic
1202848383 14_GL000225v1_random:843-865 GGAGCTCCATGGTGGCAGCTGGG + Intergenic
1202848778 14_GL000225v1_random:2379-2401 GGCACTCCATGGTGGCAGCTGGG - Intergenic
1202855057 14_GL000225v1_random:44587-44609 GGCCCTCCATGGTGGCAGCTGGG - Intergenic
1202857480 14_GL000225v1_random:59877-59899 GGCCCTCCATGGTGGCAGCTGGG - Intergenic
1202857887 14_GL000225v1_random:63131-63153 GGCCCTCCATGGTGGCAGCTGGG + Intergenic
1202859202 14_GL000225v1_random:71420-71442 GGAGCTCCATGGTGGCAGCTGGG + Intergenic
1202864361 14_GL000225v1_random:105306-105328 GGAGCTCCATGGTGGCAGCTGGG - Intergenic
1124633858 15:31352871-31352893 GGACCTCCAGGGTGGCTACTTGG + Intronic
1133838714 16:9389118-9389140 GGTCCTGCATGGTCTGACCTTGG - Intergenic
1135983338 16:27165825-27165847 GCACCTCCTTGGTCTCACCCTGG - Intergenic
1135994206 16:27236080-27236102 GGACCTGGATGGTGGCCCCTGGG - Intronic
1140299167 16:73739546-73739568 GGAGCTCCATGGGCACACCTTGG + Intergenic
1141550776 16:84805369-84805391 GGACATTCATGGTTGCACTTAGG - Intergenic
1149657659 17:58318839-58318861 GGACCTGAATGGTCAGACCTAGG - Intronic
1162526148 19:11207902-11207924 GGACCTCCATTCTGTCACCTAGG - Intronic
1163321226 19:16576194-16576216 GGACCTCCCTGGTCTGACCCGGG - Exonic
1164304866 19:23997245-23997267 CAATCTCCCTGGTCGCACCTGGG - Intergenic
1165102490 19:33447144-33447166 TGACCTCCATGTCTGCACCTGGG - Intronic
1166539249 19:43594739-43594761 GGACCTCCATGGTCGCACCTAGG + Intronic
936673341 2:114684890-114684912 GGATCTCCATGGTCTCCCCTAGG - Intronic
946228468 2:218277348-218277370 GGCCCTCCATGCCCTCACCTTGG + Exonic
1175899501 20:62354463-62354485 GGGCCTCCATGCCTGCACCTGGG + Intronic
1181100619 22:20536597-20536619 GGACCTGCATTGTCCCACATAGG + Intronic
950234527 3:11307258-11307280 GGACATCCAGGCTCTCACCTGGG + Intronic
953045967 3:39294409-39294431 GGACCCCTAGGGTTGCACCTGGG - Intergenic
955538623 3:59951231-59951253 GGACCACCATGAACCCACCTGGG + Intronic
973229375 4:47824408-47824430 GGACCTGCAAGATCTCACCTGGG - Intronic
985711558 5:1432395-1432417 GGTCCCCCATGGTAGCCCCTTGG - Intronic
987227715 5:15861129-15861151 GTACTGCCATGGTCACACCTGGG - Intronic
1003195059 6:3906849-3906871 TGGCCTCCATGGTGGCACGTGGG - Intergenic
1008584573 6:52937084-52937106 GGACCTCCATGGCAGCAGCAGGG + Intergenic
1011175059 6:84551139-84551161 GGACCTGCATGGCATCACCTAGG - Intergenic
1023864554 7:44232615-44232637 GCACCTCCAGGGGCGCGCCTGGG + Intronic
1024285829 7:47756725-47756747 GGAGCTCCAGGGTCACATCTGGG - Intronic
1029724914 7:102396431-102396453 GGGCCTCGGTGGTCGCACCGAGG - Exonic
1044371594 8:91418665-91418687 GGACCTCCCTGGTGTAACCTAGG - Intergenic
1055818143 9:80231702-80231724 AAACCTCCAAGGTCCCACCTTGG + Intergenic
1062205204 9:135332678-135332700 GAACCTCCATGCTCACACCTAGG + Intergenic
1203739962 Un_GL000216v2:170711-170733 GGCACTCCATGGTGGCAGCTGGG + Intergenic
1185532106 X:830242-830264 GGACCTGCATGGTTTTACCTTGG + Intergenic
1191249534 X:58253852-58253874 GGTCGTCCATGGTAGCACCCAGG + Intergenic
1192694270 X:73398354-73398376 GGACCTTCATGGTCACACTCTGG + Intergenic
1193278528 X:79620683-79620705 GCAACTACATGGTCCCACCTGGG - Intergenic
1196040927 X:111203010-111203032 GGATCTCCTTGGTTGCACATTGG + Intronic