ID: 1166539253

View in Genome Browser
Species Human (GRCh38)
Location 19:43594748-43594770
Sequence TGGTCGCACCTAGGTGCCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 51}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166539245_1166539253 14 Left 1166539245 19:43594711-43594733 CCCAAACTCACTGGGGGAGGGAT 0: 1
1: 0
2: 1
3: 14
4: 117
Right 1166539253 19:43594748-43594770 TGGTCGCACCTAGGTGCCTAGGG 0: 1
1: 0
2: 0
3: 1
4: 51
1166539244_1166539253 15 Left 1166539244 19:43594710-43594732 CCCCAAACTCACTGGGGGAGGGA 0: 1
1: 0
2: 1
3: 16
4: 218
Right 1166539253 19:43594748-43594770 TGGTCGCACCTAGGTGCCTAGGG 0: 1
1: 0
2: 0
3: 1
4: 51
1166539240_1166539253 20 Left 1166539240 19:43594705-43594727 CCTTGCCCCAAACTCACTGGGGG 0: 1
1: 0
2: 3
3: 22
4: 232
Right 1166539253 19:43594748-43594770 TGGTCGCACCTAGGTGCCTAGGG 0: 1
1: 0
2: 0
3: 1
4: 51
1166539246_1166539253 13 Left 1166539246 19:43594712-43594734 CCAAACTCACTGGGGGAGGGATC 0: 1
1: 0
2: 2
3: 7
4: 107
Right 1166539253 19:43594748-43594770 TGGTCGCACCTAGGTGCCTAGGG 0: 1
1: 0
2: 0
3: 1
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166539253 Original CRISPR TGGTCGCACCTAGGTGCCTA GGG Intronic
903341228 1:22655766-22655788 TGGTCTCACCTGGGTCCCTGTGG + Intronic
907543333 1:55236861-55236883 AGGTCGCACCTAAGAGACTAGGG + Intergenic
1067689214 10:48490632-48490654 TGGCCACAGCTAGGTGCCCAAGG + Intronic
1070292302 10:75125697-75125719 TGGAAGCACATAGGTGCCCAAGG - Intronic
1081473547 11:43400941-43400963 TGGTCACAGCTAAGTGCCAAAGG - Intronic
1082147874 11:48692901-48692923 TGGGAGCACCTAGAGGCCTATGG + Intergenic
1082308700 11:50617589-50617611 TGGCAGCACATTGGTGCCTATGG - Intergenic
1082312713 11:50673067-50673089 TGGCAGCACCTTGGGGCCTAAGG - Intergenic
1082577471 11:54826389-54826411 TGGGAGCACCTAGAGGCCTATGG + Intergenic
1082589124 11:54983502-54983524 TGGGAGCACCTAGAGGCCTATGG + Intergenic
1084009452 11:66339449-66339471 TGGTCTTACCCTGGTGCCTATGG - Intronic
1084965922 11:72744505-72744527 TGGTGGTTCCTAAGTGCCTAAGG - Intronic
1101921888 12:108939774-108939796 TGGTCCCACCTAGATGCAAAGGG - Intronic
1102593164 12:113972825-113972847 TGGTGGCATCTAGGTGCCCCTGG - Intergenic
1106193296 13:27472900-27472922 TGGTGGGACCTAAGTGCTTAAGG - Intergenic
1108464786 13:50704632-50704654 GGGTCTCTCCTAGGTTCCTATGG + Intronic
1110233891 13:73196368-73196390 GGGTCTCACCTTGTTGCCTAGGG + Intergenic
1113927635 13:113950457-113950479 TGGGAGCACCGAGGTGCCCAAGG - Intergenic
1115744926 14:36427018-36427040 TGGTCTCACTTAAGTGCCTGGGG + Intergenic
1121691829 14:95883692-95883714 TCCTCTCACCTGGGTGCCTAGGG + Intergenic
1123226406 15:17038076-17038098 TGGGAGCACCTTGGGGCCTATGG + Intergenic
1131970222 15:97884631-97884653 TGGTCGCACTCAGGCTCCTAGGG + Intergenic
1132669122 16:1095491-1095513 TGGTCCCACCTTGGTGCCGAGGG + Intronic
1139633521 16:68244833-68244855 TGGCCGCACCCAGGTGCCCTCGG + Intergenic
1141357522 16:83362440-83362462 TTGTGGCACCTAATTGCCTAGGG - Intronic
1148104554 17:45112452-45112474 TGGTCTCACCTGGGTGCTGAGGG - Exonic
1148800595 17:50222647-50222669 TGGTCTCACCCAGCTGCCTCAGG + Intergenic
1153130496 18:1850839-1850861 TGGTCGCAACAAGGTAACTAGGG - Intergenic
1165880986 19:39043352-39043374 TGGTCTCACCTAATTTCCTAAGG + Intergenic
1166539253 19:43594748-43594770 TGGTCGCACCTAGGTGCCTAGGG + Intronic
933598235 2:84303984-84304006 TGGCTACACCTAGATGCCTATGG + Intergenic
938619344 2:133032510-133032532 TGGACCCACCTAGGGGCCTGGGG + Intronic
942347477 2:175018303-175018325 GGGTCGGAGCTTGGTGCCTATGG - Intergenic
948201059 2:236130108-236130130 TGGTCTCACCTAGCAGCCTTAGG - Exonic
948556199 2:238813193-238813215 TGATCCCACCTAGGTGTCCATGG + Intergenic
1172102077 20:32490970-32490992 GGGTCGCACATGGGTGACTAGGG - Intronic
1184754381 22:46507965-46507987 TTATCCCACCTAGGAGCCTACGG - Intronic
949343879 3:3058668-3058690 TGGTCTCACCTCTGTGCCTTTGG + Intergenic
952948533 3:38498102-38498124 TGGTCACACATAGGTCCCCAAGG - Intronic
955109835 3:55937487-55937509 TGGTCACACATGGGTTCCTAAGG + Intronic
959448208 3:106466847-106466869 GGGACCCACCTAGGGGCCTAGGG - Intergenic
963062575 3:141236306-141236328 TGGTCACACCCAGGGGCATAAGG - Intronic
985509303 5:303164-303186 TGGTGGCACGTAGAGGCCTAAGG + Intronic
985738972 5:1603728-1603750 TGGTGGCACGTAGAGGCCTAAGG - Intergenic
1019537131 7:1535043-1535065 TGATGGCACATATGTGCCTATGG - Intronic
1023847893 7:44133192-44133214 TGGTGGCTCCTAGGTCCTTAAGG + Intergenic
1025535358 7:61940964-61940986 TGGCAGCACCTTGGGGCCTATGG + Intergenic
1048830246 8:138469395-138469417 TGATCAGACCTAGGTGCCTTAGG + Intronic
1053398081 9:37793016-37793038 TGGTCTCACTTTGTTGCCTAGGG - Intronic
1057230384 9:93318015-93318037 TGTTCGCTCCTAGGTTCCTGTGG + Exonic
1187463960 X:19512612-19512634 TGGTGGCACCCATGTGCCTGTGG - Intronic
1196707861 X:118731188-118731210 TGGTTGAAATTAGGTGCCTAAGG + Intronic
1197571291 X:128153906-128153928 TGGACCAACCTAAGTGCCTACGG + Intergenic