ID: 1166539255

View in Genome Browser
Species Human (GRCh38)
Location 19:43594761-43594783
Sequence GTGCCTAGGGTCTCGACTAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 32
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 31}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166539245_1166539255 27 Left 1166539245 19:43594711-43594733 CCCAAACTCACTGGGGGAGGGAT 0: 1
1: 0
2: 1
3: 14
4: 117
Right 1166539255 19:43594761-43594783 GTGCCTAGGGTCTCGACTAACGG 0: 1
1: 0
2: 0
3: 0
4: 31
1166539246_1166539255 26 Left 1166539246 19:43594712-43594734 CCAAACTCACTGGGGGAGGGATC 0: 1
1: 0
2: 2
3: 7
4: 107
Right 1166539255 19:43594761-43594783 GTGCCTAGGGTCTCGACTAACGG 0: 1
1: 0
2: 0
3: 0
4: 31
1166539250_1166539255 -4 Left 1166539250 19:43594742-43594764 CCTCCATGGTCGCACCTAGGTGC 0: 1
1: 0
2: 1
3: 3
4: 42
Right 1166539255 19:43594761-43594783 GTGCCTAGGGTCTCGACTAACGG 0: 1
1: 0
2: 0
3: 0
4: 31
1166539244_1166539255 28 Left 1166539244 19:43594710-43594732 CCCCAAACTCACTGGGGGAGGGA 0: 1
1: 0
2: 1
3: 16
4: 218
Right 1166539255 19:43594761-43594783 GTGCCTAGGGTCTCGACTAACGG 0: 1
1: 0
2: 0
3: 0
4: 31
1166539251_1166539255 -7 Left 1166539251 19:43594745-43594767 CCATGGTCGCACCTAGGTGCCTA 0: 1
1: 0
2: 0
3: 1
4: 37
Right 1166539255 19:43594761-43594783 GTGCCTAGGGTCTCGACTAACGG 0: 1
1: 0
2: 0
3: 0
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166539255 Original CRISPR GTGCCTAGGGTCTCGACTAA CGG Intronic
1066038257 10:31517113-31517135 CTGCCTAGGGTATCTAATAATGG + Intronic
1110455586 13:75686926-75686948 CTGTCTAGGGTCTCTTCTAAGGG + Intronic
1124642528 15:31404886-31404908 GAGCCTAGGGTCTTCACTCAGGG + Intronic
1127455806 15:59155084-59155106 CTGCCTAGGGTCCCAACAAAAGG + Intronic
1128923523 15:71633400-71633422 GTGCCTGTGGTCTCAGCTAATGG - Intronic
1134253341 16:12590450-12590472 GTGCCTAGGTTCTCTGCTCAAGG - Intergenic
1137224973 16:46494887-46494909 TTGCCTAGGTTTTCTACTAAGGG - Intergenic
1143504420 17:7355946-7355968 GAGCCTAGGGTCTTAACCAAAGG + Intronic
1147484580 17:40800208-40800230 ATGCCTAGGGTCTAGATGAAAGG - Intergenic
1148181579 17:45609564-45609586 GTGCCCAGGGGCTCAACTACTGG - Intergenic
1148267271 17:46236129-46236151 GTGCCCAGGGGCTCAACTACTGG + Intergenic
1155131323 18:22937603-22937625 GTGCCTATGGTCCCAACTACAGG - Intronic
1159074323 18:63663413-63663435 GTTTCCAGGGTCTCGAGTAAGGG - Intronic
1166539255 19:43594761-43594783 GTGCCTAGGGTCTCGACTAACGG + Intronic
928433168 2:31236752-31236774 TTGCCCAGGGTCTCGGCTATAGG + Intronic
934160068 2:89241049-89241071 CTGCCCTGGGTCTCCACTAAAGG - Intergenic
934207206 2:89941385-89941407 CTGCCCTGGGTCTCCACTAAAGG + Intergenic
944069227 2:195651299-195651321 GTGCCACAGGTCTCGAATAATGG + Intronic
1173250683 20:41362808-41362830 TTGCTTAGGATCTCGTCTAAGGG + Exonic
1178557701 21:33607872-33607894 ATGCCTAGGATCTAGCCTAAAGG + Intronic
1179526158 21:41977215-41977237 GTGCCAGGGGTCTCGACTGGAGG - Intergenic
983338887 4:166431961-166431983 GAGCCTAGGGTTTTGCCTAAAGG - Intergenic
999957628 5:156719777-156719799 GTGCTTAGGGCCTAGGCTAAAGG - Intronic
1011368877 6:86610919-86610941 GTGCCTAGAGTCTCATGTAATGG + Intergenic
1028180635 7:87718312-87718334 GTGCCTAGGGTTTCTATTAGGGG + Intronic
1034358341 7:150472068-150472090 GTTCCTGGGGTCTCGGCCAAAGG - Intronic
1035775964 8:2188552-2188574 GTCCCTAGGGTCTCAAGTGAGGG + Intergenic
1037809185 8:22076304-22076326 GTGCCTAGGGCTTCCATTAAAGG + Intronic
1043222348 8:77682842-77682864 GTTCCAAGGTTCTCAACTAAGGG - Intergenic
1048733667 8:137473093-137473115 GTGCCTAGGATCTCTGCTTAGGG + Intergenic
1057549180 9:96039587-96039609 GTGCCTAAGGCCTCAACTTACGG + Intergenic
1200276737 X:154740639-154740661 GTGCTTAGGATCACCACTAAGGG - Intronic