ID: 1166539525

View in Genome Browser
Species Human (GRCh38)
Location 19:43595998-43596020
Sequence ACCGACTGCGCTCTCTCCCG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 44}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166539525_1166539530 14 Left 1166539525 19:43595998-43596020 CCACGGGAGAGAGCGCAGTCGGT 0: 1
1: 0
2: 0
3: 2
4: 44
Right 1166539530 19:43596035-43596057 AGCTGAGAAGCCCGGCCCCTGGG 0: 1
1: 0
2: 0
3: 13
4: 184
1166539525_1166539529 13 Left 1166539525 19:43595998-43596020 CCACGGGAGAGAGCGCAGTCGGT 0: 1
1: 0
2: 0
3: 2
4: 44
Right 1166539529 19:43596034-43596056 CAGCTGAGAAGCCCGGCCCCTGG 0: 1
1: 0
2: 2
3: 23
4: 281
1166539525_1166539528 6 Left 1166539525 19:43595998-43596020 CCACGGGAGAGAGCGCAGTCGGT 0: 1
1: 0
2: 0
3: 2
4: 44
Right 1166539528 19:43596027-43596049 AGGTCAGCAGCTGAGAAGCCCGG 0: 1
1: 0
2: 3
3: 23
4: 372
1166539525_1166539538 30 Left 1166539525 19:43595998-43596020 CCACGGGAGAGAGCGCAGTCGGT 0: 1
1: 0
2: 0
3: 2
4: 44
Right 1166539538 19:43596051-43596073 CCCTGGGCCGCGGCGGACGGAGG 0: 1
1: 0
2: 5
3: 28
4: 223
1166539525_1166539531 20 Left 1166539525 19:43595998-43596020 CCACGGGAGAGAGCGCAGTCGGT 0: 1
1: 0
2: 0
3: 2
4: 44
Right 1166539531 19:43596041-43596063 GAAGCCCGGCCCCTGGGCCGCGG 0: 1
1: 1
2: 1
3: 33
4: 294
1166539525_1166539535 27 Left 1166539525 19:43595998-43596020 CCACGGGAGAGAGCGCAGTCGGT 0: 1
1: 0
2: 0
3: 2
4: 44
Right 1166539535 19:43596048-43596070 GGCCCCTGGGCCGCGGCGGACGG 0: 1
1: 0
2: 2
3: 26
4: 295
1166539525_1166539532 23 Left 1166539525 19:43595998-43596020 CCACGGGAGAGAGCGCAGTCGGT 0: 1
1: 0
2: 0
3: 2
4: 44
Right 1166539532 19:43596044-43596066 GCCCGGCCCCTGGGCCGCGGCGG 0: 1
1: 0
2: 0
3: 49
4: 383

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166539525 Original CRISPR ACCGACTGCGCTCTCTCCCG TGG (reversed) Exonic
903476043 1:23619724-23619746 CCCCCCTGCCCTCTCTCCCGTGG + Intronic
913568762 1:120099666-120099688 ACCAACGGTGCTCTCTCCAGGGG + Intergenic
914289577 1:146260687-146260709 ACCAACGGTGCTCTCTCCAGGGG + Intergenic
914550613 1:148711440-148711462 ACCAACGGTGCTCTCTCCAGGGG + Intergenic
918769441 1:188535779-188535801 ACCAACTGTGCTCTCTGCCTGGG + Intergenic
1062899282 10:1130207-1130229 TCCGAATGGGCTCACTCCCGTGG + Exonic
1067102661 10:43344127-43344149 GGCCACTGCGCTGTCTCCCGGGG - Intergenic
1073177753 10:101566719-101566741 AGCGGCTGGGCTCCCTCCCGGGG - Intergenic
1073578442 10:104643033-104643055 CCCGACTTCCCTCCCTCCCGCGG + Intronic
1077121619 11:911287-911309 GCCCACTGCGCTGTCTCCAGCGG + Intronic
1087113184 11:94493824-94493846 ACGGACGCCGTTCTCTCCCGCGG - Exonic
1089606420 11:119644067-119644089 ACCGAGTGCGGGCTCTCCCAGGG - Intronic
1092810201 12:12266130-12266152 TCCAACTGCGCTCTCACCCAGGG + Intronic
1097040578 12:56153754-56153776 ACCGCCTGCCCTCACTCCCCTGG - Intronic
1114527752 14:23377088-23377110 AGCGCCTGCCTTCTCTCCCGGGG + Exonic
1121312806 14:92944281-92944303 ACACACTGAGCTATCTCCCGGGG + Intronic
1121760438 14:96440424-96440446 ACCCTCTGCTCTCTCTCCCTTGG + Intronic
1129221273 15:74133152-74133174 ACCGCCTGGGCTCTCTGCCCCGG + Exonic
1131839301 15:96418382-96418404 ACAGACTGAGCTATCTCCAGGGG - Intergenic
1135684328 16:24486105-24486127 AAGGACTGCGCTCTGTCCTGTGG + Intergenic
1147715867 17:42507896-42507918 ACTGACTGCTCTCTCACCTGAGG + Intronic
1156795698 18:41043597-41043619 ACTGACTGCTCTCTCTCACGTGG - Intergenic
1158931163 18:62325769-62325791 GCCCACGGCGCTGTCTCCCGCGG - Intronic
1164227843 19:23261544-23261566 ACCCACTGCAATCTCTCCTGTGG - Intergenic
1164829007 19:31306149-31306171 ACCGTGTGCGCTCATTCCCGGGG + Intronic
1166539525 19:43595998-43596020 ACCGACTGCGCTCTCTCCCGTGG - Exonic
1167313002 19:48748036-48748058 ACCTCCTGCTCTCTCACCCGTGG + Exonic
928186502 2:29115569-29115591 CCCGCCGGCGCTGTCTCCCGTGG - Exonic
928422773 2:31151993-31152015 ACCCACTTCGCTCTTTCCCCTGG + Intronic
947577467 2:231287218-231287240 ACTGCCTCCGCTCTCTCCAGAGG + Intronic
948141706 2:235678053-235678075 AGCGACTGCGCCCGCTCCTGAGG - Intronic
1172121029 20:32598805-32598827 CACGTCTGCGCTCTCTCTCGGGG + Intronic
1184748780 22:46472495-46472517 ACCTACTCCCCTGTCTCCCGGGG - Intronic
967994217 3:195154586-195154608 ACACACTGCGCTCCCTCCCAAGG + Intronic
984880014 4:184402357-184402379 ACAGACTGGCCTCTCTCCCCTGG + Intronic
1001035393 5:168292746-168292768 GCCGAGTGCCCTCTCTCCAGTGG - Intronic
1007784195 6:44270762-44270784 GCCGGCGGCGCTCTCTCCCGCGG - Exonic
1021521578 7:21543642-21543664 AGCGACTGGGCTGTCTCCCCTGG - Intronic
1027603220 7:80265970-80265992 ACCGACTGCCCTCTCCCTCTAGG + Intergenic
1034275432 7:149821894-149821916 TCCGACTGCCCTGTCTCCTGTGG + Intergenic
1035033790 7:155882192-155882214 CACGACAGCGCTCCCTCCCGAGG + Intergenic
1035231128 7:157466590-157466612 ACCTTCTGAGCTCTCTCCCTCGG - Intergenic
1049502628 8:142975486-142975508 CCCGCCTGCGCTCTCTCTCCTGG - Intergenic
1049538557 8:143194549-143194571 ACCACCTGTGTTCTCTCCCGCGG - Intergenic
1053489402 9:38487892-38487914 AGCGCCGGCGCTCTCTCGCGGGG + Intergenic
1057114081 9:92504018-92504040 ACTGACTTCTCTCTCTCCAGAGG - Intronic
1192395262 X:70774146-70774168 ACAGACTGCGCACTGTCCTGGGG + Intronic