ID: 1166541201

View in Genome Browser
Species Human (GRCh38)
Location 19:43607336-43607358
Sequence GACCCCAAGGTTCCCCAAGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 132}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166541197_1166541201 21 Left 1166541197 19:43607292-43607314 CCTCATCGAATACAAGCACGCAG 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1166541201 19:43607336-43607358 GACCCCAAGGTTCCCCAAGAAGG 0: 1
1: 0
2: 1
3: 13
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166541201 Original CRISPR GACCCCAAGGTTCCCCAAGA AGG Exonic
900970884 1:5992011-5992033 GACCCCAAGTGTCCCGACGAGGG + Intronic
901819475 1:11817925-11817947 CAACCCAAGTTTCCCCAAAATGG - Intronic
902393474 1:16119496-16119518 GAGCCCCAGGGTCCCCAAAATGG + Intergenic
902634974 1:17729128-17729150 GACCCCAGGGTTCTCCACAATGG - Intergenic
903566188 1:24267491-24267513 GACTCCACAGTTCCCCAAGTAGG - Intergenic
905906525 1:41622076-41622098 GAACCCAAGGATCTGCAAGATGG - Intronic
907547413 1:55274391-55274413 CACCCCAAGGTCCCCCACCAGGG - Intergenic
908357008 1:63331574-63331596 GAACCCAAGGCTCTCCAAGTGGG - Intergenic
913287851 1:117243333-117243355 GACCACAAGGTTGCCTAAGGAGG - Intergenic
915605768 1:156949322-156949344 GACCCCTAGCTGCCCCAGGATGG + Intronic
916597028 1:166253730-166253752 AGCCCCAAGGCTCCCCAAAAGGG - Intergenic
918406921 1:184220547-184220569 CATCCCAAGGATCCCCAAAAAGG + Intergenic
920926305 1:210344666-210344688 GCCCCAAAGGCTCCCCAAAACGG - Intronic
921532992 1:216307847-216307869 GACCTTCAGGTTCCCCAGGAAGG + Intronic
921676230 1:217979359-217979381 GACCCCAACATTCCCCAACCAGG + Intergenic
1062863322 10:827668-827690 AACCCCAAGGATCCCCGAGAGGG + Intronic
1063375823 10:5553690-5553712 GAGCACAAGGTCCCCCACGATGG + Intergenic
1068756863 10:60665171-60665193 GCCCCCAGTGTTCCTCAAGAAGG - Intronic
1069702701 10:70438364-70438386 GCCCCCAAGTCTCCCCATGATGG + Intronic
1070613804 10:77953332-77953354 GACCACCAGGTTGCCCAAGGAGG + Intergenic
1075384848 10:122048216-122048238 GCCCCCAAGGTCCCCCAGGAAGG - Intronic
1075849206 10:125573795-125573817 TCCCCCAAGTTTCCCCAAGGTGG + Intergenic
1076640654 10:131914493-131914515 GACCCCAAGGTTCCACTTGTAGG + Intronic
1077538046 11:3133892-3133914 GACCCCAAGGTCCCCTAAGGAGG + Intronic
1078094736 11:8289778-8289800 GTCTCCAGGGATCCCCAAGAGGG - Intergenic
1084531171 11:69728743-69728765 GACCCCCAGGACCCCAAAGAGGG + Intergenic
1085271170 11:75270856-75270878 AACCCCCAGGTTCCCAATGAGGG - Intronic
1087058778 11:93958500-93958522 GACCCCATAGTCCACCAAGATGG + Intergenic
1089336385 11:117726717-117726739 GACCCCATGATCCCCAAAGAGGG + Intronic
1089671348 11:120059043-120059065 GGCCCAAGGGTTCCCTAAGAAGG + Intergenic
1090142265 11:124277546-124277568 AACCCCAAGGGTCCAGAAGAGGG + Intergenic
1096628786 12:52912204-52912226 GGCCCAAAGGTCCCCCAAGAAGG + Intronic
1096865720 12:54561516-54561538 GAGCCCCAGGGCCCCCAAGAGGG - Intronic
1098659221 12:73071968-73071990 GATCACAAGGTTCCACAATAGGG - Intergenic
1106641682 13:31590707-31590729 GACTCCAAGGTTTCAGAAGAGGG - Intergenic
1107963590 13:45579766-45579788 GACCCCAAACCTCCTCAAGAAGG - Intronic
1108556077 13:51594040-51594062 GACCACCAGGTTGCCTAAGAAGG - Intronic
1108733443 13:53258232-53258254 GACCACCAGGTTCCCCGAGGAGG + Intergenic
1112099324 13:96169706-96169728 GACCACCAGGTTGCCTAAGAAGG + Intronic
1115997436 14:39209336-39209358 GATCCCAAAGTTCCACAACAAGG - Intergenic
1116055737 14:39862091-39862113 GACCCCAATCTTCCCAAAAAGGG - Intergenic
1118506603 14:66420280-66420302 CACCCCTAGGTTCCTAAAGATGG + Intergenic
1118631300 14:67706110-67706132 GACCACCAGGTTACCTAAGAAGG + Intronic
1118980276 14:70710545-70710567 GACCTCAGGGTTACACAAGAAGG + Intergenic
1122485557 14:102077300-102077322 GACCACCAGGTTGCCTAAGAGGG - Intergenic
1128053420 15:64682648-64682670 GACTCCAAGGTTCCCCAAGCTGG - Exonic
1129597643 15:76977033-76977055 GACCACCAGGTTGCCCAAGGAGG - Intergenic
1131140371 15:89972276-89972298 GTCCCCAAGCTTCCTCAGGAGGG + Intergenic
1131836902 15:96399942-96399964 GACCCCCATGTTCCTCTAGACGG + Intergenic
1132022256 15:98372787-98372809 GACCCCCAGGTCCTCAAAGATGG - Intergenic
1132730444 16:1358410-1358432 GTCCCCAAGGTCCCCCAGGCTGG + Intronic
1135227248 16:20671577-20671599 GACCACAGGCTTCCCCAAGATGG - Exonic
1137855144 16:51787114-51787136 GACCCCATGCTTCACCAGGAAGG + Intergenic
1140860520 16:79013804-79013826 GACCCCAACCTTCCCCATGTAGG - Intronic
1140892775 16:79299011-79299033 CACCACAAGGTGCCCAAAGAAGG - Intergenic
1141493292 16:84389584-84389606 GACACCAAGGGGCCCGAAGAGGG - Intronic
1141845357 16:86604653-86604675 GACCCCACTCTTCCCCAGGAGGG + Intergenic
1142690634 17:1604495-1604517 GACCCCCAGGTTGCCTAAGGAGG - Intronic
1143448689 17:7023126-7023148 GACTCCTGGGTCCCCCAAGAGGG + Intronic
1144815601 17:18032307-18032329 GACAGCCAGGTTTCCCAAGAGGG + Intronic
1145396057 17:22495982-22496004 GACCCCAAGGTTCCTAAGAAAGG - Intergenic
1146464529 17:33075660-33075682 GCCCCCAAGTTTCCCCCAGAAGG - Intronic
1146943621 17:36860010-36860032 GGCCCCAAGTTTCCCCCAGAAGG + Intergenic
1151590632 17:75041875-75041897 GACCACCAGGTTGCCTAAGAAGG + Intronic
1153641801 18:7163986-7164008 GCCCACCAGGTTCCCCAAGCCGG - Intergenic
1161661053 19:5546572-5546594 GCCCCCAAGGATCCCCAGGCTGG + Intergenic
1162759661 19:12881199-12881221 CACCCCAGGGTTCCCCGAGGAGG + Intronic
1166259631 19:41628334-41628356 GTCCCCAAGGTTTCAAAAGAAGG + Intronic
1166541201 19:43607336-43607358 GACCCCAAGGTTCCCCAAGAAGG + Exonic
1166723245 19:45009675-45009697 GAGCCCAGGGTTTCCCAGGACGG + Intronic
928322288 2:30293390-30293412 GACCACAGTGTTCCACAAGAAGG - Intronic
930882493 2:56287980-56288002 GACCCCAAAGCTTCCCCAGAGGG - Intronic
931292842 2:60891320-60891342 TCCCCCAAGATTCCCCAAGAAGG - Intronic
931438315 2:62268210-62268232 GAAGCCAAGGGTCCCCAAGAAGG - Intergenic
932887877 2:75563289-75563311 GACCCGTAGGAACCCCAAGAGGG - Intronic
934609516 2:95724248-95724270 GACCCCAAGCTACTTCAAGAGGG - Intergenic
943638011 2:190327288-190327310 GGCCCAAAGGATTCCCAAGAGGG + Intronic
944586397 2:201177545-201177567 AACCTCAAAGTTCCGCAAGATGG - Intergenic
946032513 2:216716416-216716438 GACCCAAATGTCTCCCAAGAAGG - Intergenic
946941959 2:224778599-224778621 TACCCCAAGCTGCCACAAGAGGG - Intronic
1169430135 20:5529056-5529078 TCCCCCAAGGTACCACAAGATGG + Intergenic
1170144133 20:13154172-13154194 AACCCCAAGGTGACCTAAGATGG + Intronic
1172644071 20:36459064-36459086 GACCCCAAGGCTCCCCATCCGGG - Intronic
1172704071 20:36870253-36870275 GACCACTAGGTTGCCCAAGGAGG + Intergenic
1172998936 20:39091858-39091880 GACGCCAAAGTTCTCCTAGATGG + Intergenic
1172999378 20:39094473-39094495 GACCACATGGTTCCCCTAGCTGG - Intergenic
1174441371 20:50557803-50557825 GACCACCAGGTTGCCTAAGAAGG - Intronic
1175514472 20:59560094-59560116 CACCCCATTGTTCCCCAAGGTGG + Intergenic
1179797506 21:43793952-43793974 GACCTCATGGTTCAACAAGAGGG - Intronic
1181954485 22:26578545-26578567 GACCCCAAGGTCCTCAGAGAAGG + Intronic
1182647331 22:31820876-31820898 GACCACAAGATTAGCCAAGAAGG - Intronic
1184834171 22:47011206-47011228 CACCCCAAGGCTGCCCAAGTAGG - Intronic
1184875867 22:47275139-47275161 GGCACCAACATTCCCCAAGAAGG - Intergenic
1185173084 22:49304752-49304774 GCTCCCAAGGGACCCCAAGAAGG + Intergenic
950194763 3:11001340-11001362 GAACTCGAGCTTCCCCAAGAAGG + Intronic
950865916 3:16188916-16188938 GAGCCCAGGGTTCCCAAACATGG + Intronic
953128103 3:40111080-40111102 GACCCCAGGGTCCCCCCAGAAGG + Intronic
953771139 3:45779493-45779515 GACCCCTAAGTTCTCCTAGAAGG - Intronic
954001413 3:47560351-47560373 GACCACCAGGTTGCCCAAGGAGG - Intergenic
954216950 3:49129985-49130007 GACCCCATGGGTTCTCAAGACGG - Exonic
954605203 3:51904249-51904271 GTCCCCAAGGAACCCCATGAGGG + Intergenic
956770594 3:72522731-72522753 GACCCCAAGGGTTTCCAAGCTGG - Intergenic
968491667 4:893514-893536 GGCCCCACGGTTCCCCAGGCGGG + Intronic
968876085 4:3268729-3268751 GTCAGCAAAGTTCCCCAAGAAGG + Intronic
969350039 4:6593204-6593226 TTCCCCAAGCCTCCCCAAGATGG + Exonic
970428074 4:15963602-15963624 AAACCCATGGTCCCCCAAGATGG - Intronic
973860928 4:55063882-55063904 GACCACCAGGTTGCCTAAGAAGG + Intergenic
973880947 4:55270379-55270401 GACCCCAATTTTCCCCCAGAGGG + Intergenic
974034518 4:56805989-56806011 GACCACCAGGTTGCCTAAGAAGG + Intergenic
982160364 4:152562818-152562840 GACCACAAGATTCTTCAAGATGG + Intergenic
985323731 4:188743574-188743596 GCCTCTAAGCTTCCCCAAGAGGG - Intergenic
988689098 5:33554338-33554360 GACCACAAGGTTCTCCATGATGG - Intronic
992011748 5:72534442-72534464 GACTCTGAAGTTCCCCAAGAAGG + Intergenic
992446281 5:76837018-76837040 GACCACCAGGTTGCCTAAGAAGG - Intergenic
999053603 5:148550169-148550191 CACCAGCAGGTTCCCCAAGATGG + Exonic
1000417654 5:160999193-160999215 AATCACAAGGTTCCCCAATAGGG - Intergenic
1007385906 6:41520030-41520052 GAGCCCAAGGTGCCCCTGGAAGG - Intergenic
1013328872 6:109077626-109077648 GACCCCAGGGTTCCCAAAGGTGG - Intronic
1014930326 6:127328027-127328049 TACCACAAGGTTCCAAAAGATGG + Intronic
1018444238 6:163840708-163840730 GACCACCAGGTTGCCTAAGAAGG + Intergenic
1019123587 6:169824623-169824645 GACCTTCAGGTTCCCCAGGAAGG + Intergenic
1019132024 6:169883823-169883845 GACCACCAGGGTCCCCCAGAAGG + Intergenic
1022500961 7:30882198-30882220 GACCCCGAGGTTCCCCATCTGGG + Exonic
1023100443 7:36712582-36712604 GACCCCTGGGTTACCCAAAAAGG + Intronic
1024971631 7:55077136-55077158 GACCCCAAAGATTCCAAAGATGG + Intronic
1028215384 7:88125906-88125928 GAACCCAAGGTGCCACAAGCAGG - Intronic
1030529378 7:110693960-110693982 GTCCCCTCTGTTCCCCAAGAAGG - Intronic
1030804273 7:113895088-113895110 GCCTCTAATGTTCCCCAAGATGG + Intronic
1031781920 7:125978862-125978884 TACCCCAATGTTCCCCATGTTGG - Intergenic
1034179327 7:149125809-149125831 GACCACCAGGTTCCCCAGGGAGG - Intronic
1034411682 7:150945453-150945475 GCCCCAGAGCTTCCCCAAGAAGG - Exonic
1036731834 8:11272393-11272415 GACCCGAAGGCTCCCTGAGAAGG + Intergenic
1037718368 8:21419143-21419165 GACCCCAGGGTACCCCAGGCGGG + Intergenic
1040555210 8:48472060-48472082 CACCCCAAGGTTCATCAACAGGG - Intergenic
1041793662 8:61723410-61723432 GACCCCAAGATTCCCGAGCATGG - Intergenic
1044266627 8:90189571-90189593 CTCCCTAAGGTTCCCCAAGCTGG - Intergenic
1046141207 8:110095093-110095115 GACCACAAAGTACCACAAGATGG - Intergenic
1048889643 8:138936103-138936125 GACCCCAGGGGCCCCCAAGCAGG - Intergenic
1062566631 9:137166596-137166618 GCCACCAGGGTGCCCCAAGAGGG + Intronic
1189809981 X:44772897-44772919 GACCACCAGGTTGCCTAAGAAGG - Intergenic
1190640945 X:52482413-52482435 GACCCCAGGGTTGTCCAAAAGGG + Intergenic
1190646727 X:52530452-52530474 GACCCCAGGGTTGTCCAAAAGGG - Intergenic
1190999670 X:55646643-55646665 GAACACAATGTTCCCCAGGAGGG - Intergenic
1193392549 X:80946001-80946023 AACCCCAAGGCTCCACAAGGTGG + Intergenic
1194888552 X:99348893-99348915 GAGCCAAAAGTTCCCCAACATGG - Intergenic
1196281688 X:113829904-113829926 GACCCAAACATTCCCCAAAATGG + Intergenic
1198423129 X:136487795-136487817 GGTCCCAAGATTCCCCAACAGGG + Intergenic