ID: 1166541407

View in Genome Browser
Species Human (GRCh38)
Location 19:43608133-43608155
Sequence CAGTGGTATCAGAGGAAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 294}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166541403_1166541407 3 Left 1166541403 19:43608107-43608129 CCTGGAGGGGGACAGACAGGGGA 0: 1
1: 0
2: 1
3: 41
4: 391
Right 1166541407 19:43608133-43608155 CAGTGGTATCAGAGGAAAGAGGG 0: 1
1: 0
2: 1
3: 30
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166541407 Original CRISPR CAGTGGTATCAGAGGAAAGA GGG Intronic
901510921 1:9717692-9717714 GAGGGGTAGCAGAGGAAGGAGGG + Intronic
902079165 1:13809361-13809383 CAGTGGTAGAAGAGGAAGGAAGG + Intronic
902979403 1:20112425-20112447 AAGTGGTGTCATAGGAATGAAGG - Exonic
903357793 1:22758712-22758734 CAGTGGTATGAGGGGCAAGCTGG + Intronic
903839436 1:26227806-26227828 TATTGCTATCAGAAGAAAGATGG - Intergenic
904457411 1:30655973-30655995 CAGGGGTGACAGAGGAGAGAGGG - Intergenic
904730538 1:32587685-32587707 TAGTTGTATCCCAGGAAAGAGGG - Intronic
905258654 1:36702003-36702025 CAGTGGCATGATAGCAAAGATGG - Intergenic
907382299 1:54101325-54101347 CCCTGGTATCAAAGGAAAGATGG + Intronic
907871488 1:58447618-58447640 CAGTGCTATGAAAGAAAAGAAGG + Intronic
909039930 1:70637234-70637256 CTAAGGTATCAGAAGAAAGAAGG - Intergenic
910718957 1:90264125-90264147 CAGAGCTATCTGAGGAACGAGGG + Intergenic
911111605 1:94193810-94193832 AAGTGTTACCAGAGGAAAGATGG + Intronic
913439614 1:118883992-118884014 CAGTGGTGCCCGTGGAAAGAGGG - Exonic
913442248 1:118910085-118910107 GAGGGGAATGAGAGGAAAGATGG - Intronic
915950015 1:160183467-160183489 CAGGGGAATCAGAGAAAAGAGGG - Intronic
916448987 1:164901623-164901645 CAGTGGGAGGAGAGGAAGGATGG + Intergenic
916462760 1:165044374-165044396 CTGTGGTAGGAGAGGAAAGTAGG - Intergenic
917246164 1:173003650-173003672 CAGTCTTTTCAGTGGAAAGAAGG - Intergenic
917655246 1:177119593-177119615 GAGAGGTTTGAGAGGAAAGAAGG - Intronic
918081805 1:181213614-181213636 CTGTGGTCTGAGAGGGAAGAAGG + Intergenic
921137221 1:212272665-212272687 GAGGGGTGTCAGAGGAAGGAAGG - Intergenic
921569427 1:216760702-216760724 CAGAGGGATCAGAAGAAGGAGGG + Intronic
922165589 1:223113145-223113167 CTGTGGAGTCAGAGGAATGAAGG - Intronic
922888117 1:229036242-229036264 CAGGGGAATCAGAGGAGGGAAGG - Intergenic
923376686 1:233371053-233371075 CAATATTACCAGAGGAAAGAGGG - Intronic
923503890 1:234589319-234589341 CAGTGGCAGCACAGTAAAGAGGG + Intergenic
1064501456 10:15977819-15977841 CCATGGGATCAGAGGAGAGAAGG - Intergenic
1064970860 10:21065503-21065525 CATTTGTTTCAGAAGAAAGAAGG + Intronic
1065258311 10:23897452-23897474 CACTGGTATCAGAGAAACAATGG + Intronic
1065865884 10:29915081-29915103 CAGTGGAATCAAAGGACAGCTGG - Intergenic
1068228313 10:54135670-54135692 ATGTGCTATCAGAGAAAAGAAGG - Intronic
1068387227 10:56347029-56347051 AAGTGATATGAGAGGAAAAAAGG + Intergenic
1068581575 10:58746494-58746516 CAGTGGTATGATTGGTAAGAAGG + Intronic
1069621453 10:69840039-69840061 CAGTGGTGACAGAGGAAATGGGG + Intronic
1071133595 10:82426197-82426219 CAGGGGTCTCAGAGTGAAGATGG - Intronic
1072571905 10:96665752-96665774 CAGAGGTTACTGAGGAAAGAAGG + Intronic
1072867985 10:99084824-99084846 CAGTGGTAACAGGGGCAAGTTGG - Intronic
1073304603 10:102493046-102493068 AAGTGGTATGAGAGGAGAGCAGG + Intronic
1074428622 10:113373980-113374002 CAGTGGTTTCTGAAGACAGAAGG - Intergenic
1074665024 10:115712375-115712397 CAGTGGTATCTAAGGAAAGAAGG + Intronic
1074740214 10:116479236-116479258 CAGTGGTACCACAGAGAAGACGG + Intergenic
1075576118 10:123578774-123578796 CAGGAGTAACAGAGGACAGATGG + Intergenic
1076307205 10:129473881-129473903 CAGTGGGGCCAGAGGAAAGATGG + Intronic
1079117960 11:17652574-17652596 CAGAGGGAGCAGTGGAAAGAAGG + Intergenic
1080688716 11:34537725-34537747 CAGAGGTCACAGAGGGAAGACGG - Intergenic
1080928256 11:36781186-36781208 CGGTGATATCAGAAGAAGGAAGG - Intergenic
1086021078 11:82230318-82230340 CAGTAGTATTAGAAGAAAAATGG + Intergenic
1086559077 11:88146206-88146228 CAGTGGGGTCAGTGGTAAGATGG + Intronic
1087190067 11:95244875-95244897 CAGTGGCATCACAGGTAAGAAGG + Intergenic
1087313934 11:96584191-96584213 CAGTGATAACTGAGGTAAGATGG - Intergenic
1087592830 11:100214363-100214385 CAATTGTAGCAGTGGAAAGAAGG - Intronic
1087963730 11:104386153-104386175 CAGTGATTTCAGAAGAAAAAGGG - Intergenic
1087982706 11:104635931-104635953 CCATGTGATCAGAGGAAAGATGG - Intergenic
1088409017 11:109513014-109513036 TAATGGTATTAGAGGAGAGATGG + Intergenic
1088899204 11:114102473-114102495 CAGTGGTAACAGTGGTTAGAGGG + Intronic
1088940564 11:114451060-114451082 CAGCTGTATCAGTGGAGAGAGGG + Intergenic
1090314672 11:125775109-125775131 CAGTGGATTAAGAGGAAAAAAGG - Intergenic
1091364012 11:135001805-135001827 CAGTGGCCTCAGAGGAAGGAGGG + Intergenic
1091440008 12:505392-505414 CAGTGGGAACAGAGGAAAGGGGG - Intronic
1092041751 12:5391099-5391121 CTAGGGTATCAAAGGAAAGATGG + Intergenic
1092923558 12:13253856-13253878 CAGTGGTCCCACACGAAAGAAGG + Intergenic
1093179367 12:15949996-15950018 CAGTGTAATCAGGGGAAAGTAGG - Intronic
1093322715 12:17734017-17734039 CAGTGGTAGCAGAGAAGAGGAGG - Intergenic
1094250092 12:28349826-28349848 CAGTTGTAACAGAGGAATGAGGG - Intronic
1094290983 12:28850027-28850049 CTTGGGTATCAGGGGAAAGAGGG - Intergenic
1094715709 12:33013094-33013116 CACTGGTAAAAGAAGAAAGAGGG - Intergenic
1095929314 12:47609796-47609818 GAGTTGTATCACAGGAATGAAGG - Intergenic
1098969997 12:76843099-76843121 TCTTGGTATAAGAGGAAAGATGG + Intronic
1099257495 12:80331901-80331923 CAATAGAATCAGAGGAAAGAAGG + Intronic
1100464366 12:94832344-94832366 CAGGGGAATGAGAGTAAAGAAGG + Intergenic
1101939896 12:109092072-109092094 CACTGGTCTCATAGGAGAGATGG - Intronic
1102628935 12:114259582-114259604 CAGAGCTCTCAGAGGAAATAAGG + Intergenic
1104203741 12:126616820-126616842 TAGTCGTATCAGATGGAAGATGG + Intergenic
1104579189 12:129997297-129997319 CAGAGGTAGCAGAGGAAGGAAGG + Intergenic
1106510286 13:30407278-30407300 AAGGGGTATCAGTGGAAAGCTGG - Intergenic
1106634941 13:31518594-31518616 CAGTGGAATCTGAGGAAAGCTGG + Intergenic
1108209533 13:48124405-48124427 CAGAGGAATCAGAAGAAAGGTGG - Intergenic
1109444149 13:62411314-62411336 AAGTGATCTCAGTGGAAAGAAGG - Intergenic
1109908358 13:68875392-68875414 CAATTGTACCAGAGGAAATATGG - Intergenic
1111224272 13:85249036-85249058 CAGAGAGATCAGAGGAAAGGAGG + Intergenic
1111669447 13:91311373-91311395 CAGAGGGAGCAGACGAAAGAAGG + Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112245008 13:97725309-97725331 CAGTGTTATTAAAGGGAAGAAGG + Intergenic
1114370130 14:22077342-22077364 CACTGGAATCTGAGGGAAGAAGG + Intergenic
1114373631 14:22118565-22118587 GAGTGGCATCAGAGAAAAGGAGG - Intergenic
1115153423 14:30311718-30311740 CAGTTGAATCATATGAAAGATGG + Intergenic
1116712497 14:48386119-48386141 AAGTGGTATCATTGGCAAGAAGG - Intergenic
1117275970 14:54193898-54193920 AAATGTTATCATAGGAAAGAAGG - Intergenic
1118010348 14:61604489-61604511 CTGTGGCAGCAGAGGAGAGATGG + Intronic
1118932025 14:70251898-70251920 CATTGGAATAAGAGGGAAGATGG - Intergenic
1118953153 14:70453300-70453322 CATTGGAATAAGAGGGAAGATGG + Intronic
1119708436 14:76802925-76802947 AAGTGGTTTCAGAGACAAGAAGG + Intronic
1119892687 14:78194727-78194749 CAGTAGTTGCAGAGGAGAGAAGG + Intergenic
1120266757 14:82260578-82260600 AAGTGGGCTCTGAGGAAAGAGGG - Intergenic
1120826795 14:88963353-88963375 CAGTGCTTTCAGAGGCCAGAGGG + Intergenic
1123477726 15:20602628-20602650 GAGAGGTATCACAGGAGAGAAGG + Intergenic
1123640289 15:22397754-22397776 GAGAGGTATCACAGGAGAGAAGG - Intergenic
1123978117 15:25571927-25571949 GACTGGTATTAGAGGAAGGATGG - Intergenic
1126989264 15:54353725-54353747 CAGTGAGGTCAGAGGAAAGCTGG - Intronic
1127133566 15:55895504-55895526 CTGTGGTAGCTGAGGAAAGCTGG + Intronic
1127842467 15:62843111-62843133 GAGTGGTGTCAGAGTAAAAACGG + Exonic
1128348100 15:66867492-66867514 CAGTTGGAGCACAGGAAAGATGG + Intergenic
1129532314 15:76278299-76278321 CAGTGGGGTCAGAGGAATGTTGG - Intronic
1130246436 15:82254270-82254292 CAGTGGGATCTAAGGAGAGATGG - Intronic
1130454188 15:84088689-84088711 CAGTGGGATCTGAGGAGAGATGG + Intergenic
1131995312 15:98127460-98127482 CTGTGATCTCAGAGGAATGAAGG - Intergenic
1133052696 16:3126264-3126286 AAGTGGCATGACAGGAAAGAAGG - Intergenic
1134131040 16:11650496-11650518 CAGTGGGATCAGAGGCCAGCTGG + Intergenic
1134195188 16:12154370-12154392 CAGGGGTGTCAGAGGGGAGAGGG - Intronic
1134556360 16:15168900-15168922 CAGGGGTATCAAAGTAATGAGGG + Intergenic
1134916942 16:18080606-18080628 CAGGGGTATCAAAGTAATGAGGG + Intergenic
1135122165 16:19775661-19775683 CAGTGACCTCAGAGGTAAGAGGG - Intronic
1135641642 16:24124826-24124848 CAGTGGGAATACAGGAAAGAGGG - Intronic
1135739278 16:24959619-24959641 CAGAGGTGGCAGAGGCAAGAAGG + Intronic
1142260733 16:89041434-89041456 CTGTGGTGTCAGAGAAAAGGAGG - Intergenic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144308935 17:13994590-13994612 CAGTGTTCCAAGAGGAAAGAAGG + Intergenic
1144478417 17:15609289-15609311 GAGAGGGAGCAGAGGAAAGAGGG - Intronic
1144919873 17:18754422-18754444 GAGAGGGAGCAGAGGAAAGAGGG + Intronic
1144936162 17:18900837-18900859 CAGTGGTATCAGAGGCAGCCTGG - Intronic
1146691163 17:34877151-34877173 CAGTGGAATCATAGGAGACAGGG - Intergenic
1146833636 17:36091946-36091968 TTGTGGGTTCAGAGGAAAGAGGG + Intergenic
1147306817 17:39569845-39569867 CCTTGGTTTCAAAGGAAAGAAGG + Intergenic
1149398676 17:56271357-56271379 CAGTGGTATCTAAGGAAGAATGG - Intronic
1152165134 17:78699043-78699065 GAGTGGTATCAGATGAAATCAGG + Intronic
1152260822 17:79266116-79266138 CATTGGAATCAAAGGAAGGAGGG - Intronic
1152818155 17:82421025-82421047 AGGAGGTAACAGAGGAAAGAGGG + Intronic
1153063558 18:1019397-1019419 CTGTGGCCTCAGAGGAAATATGG + Intergenic
1153177879 18:2399477-2399499 CAGTGGTATCAAACTAAAGGAGG + Intergenic
1153269650 18:3307569-3307591 CAGTGGATTCAGATGAAAGCTGG - Intergenic
1154238662 18:12631129-12631151 CTGTGGTATGAGAGCACAGATGG - Intronic
1155014763 18:21822726-21822748 CAGTGATGTCAGAAGACAGAAGG + Intronic
1155049340 18:22132880-22132902 CAGTGGTTTCAGCGGTCAGATGG + Intergenic
1155235620 18:23816257-23816279 CAGATGTGGCAGAGGAAAGAAGG + Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155930507 18:31702730-31702752 CAGTGGTATCTCAGGAAGGCAGG + Intergenic
1157056775 18:44238702-44238724 GAGTGGGATCAGAGGAATGCTGG + Intergenic
1157158605 18:45291561-45291583 CAGTGTCCTCAGAGGCAAGAGGG + Intronic
1157431680 18:47633267-47633289 AACTGGTATCAGAGGACAGAAGG - Intergenic
1157627369 18:49061683-49061705 CAGTGGGAACAGAGGAGAGCTGG + Intronic
1157786853 18:50491419-50491441 GATTGGTATCAGAGGTATGAGGG + Intergenic
1158279520 18:55806950-55806972 CAGTGCTATCAACAGAAAGAAGG - Intergenic
1160368838 18:78353612-78353634 AAAAGGAATCAGAGGAAAGATGG - Intergenic
1164475456 19:28572517-28572539 AACTGGTATCAGAGGGAAAATGG - Intergenic
1165064279 19:33219983-33220005 CTCAGGTCTCAGAGGAAAGATGG - Intronic
1165120760 19:33556963-33556985 CAGTGGCAGCAGAGGGAAGGAGG - Intergenic
1166541407 19:43608133-43608155 CAGTGGTATCAGAGGAAAGAGGG + Intronic
1166695483 19:44849166-44849188 GAATGGAATCAGAGGATAGAAGG + Intronic
925514617 2:4666647-4666669 ACGTGGTATCAGACGAAACACGG + Intergenic
925752876 2:7105419-7105441 CAATGGGATCAGAGGAAGTAGGG + Intergenic
928948070 2:36789934-36789956 CAGTGGTAACAGAGGGGAGAAGG - Intronic
929322467 2:40561220-40561242 AAATGTTTTCAGAGGAAAGATGG - Intronic
929898115 2:45978973-45978995 CAGGGGTGTCATAGGAAAGCAGG + Exonic
930779211 2:55206740-55206762 TACTGGCATCAGAGGAAAGAAGG + Intronic
931326209 2:61227186-61227208 AAGTGTTATCAGAGGAAGAAGGG - Exonic
931869030 2:66439848-66439870 CAGTGCTAAGAGAGGGAAGAGGG - Exonic
932225262 2:70034648-70034670 CAGTGGTATCATACCACAGAAGG - Intergenic
932720348 2:74134292-74134314 CAGTTGTATCAGAGCTGAGAAGG - Intronic
932817575 2:74874192-74874214 CAGTAGTATAAGAGGGAAGAGGG + Intronic
932846905 2:75144497-75144519 CAGTGCTTTCTCAGGAAAGATGG + Intronic
933089405 2:78102442-78102464 CAGTGGTATCAGAATAACGTTGG - Intergenic
933315942 2:80715205-80715227 CAGTGGCATTTGAGGAAAGCAGG + Intergenic
934039030 2:88112365-88112387 CAGTGGTCTGAGAGGGAAGGAGG - Exonic
937810390 2:126193297-126193319 CAGTGCTGTCAAAGCAAAGATGG - Intergenic
937941367 2:127288635-127288657 AAGTGGTACCAGAGTTAAGAAGG - Intronic
938809470 2:134839688-134839710 CATTGGTATCTTAGGTAAGAGGG + Intronic
939215139 2:139227571-139227593 CAGTGTTACCACAGAAAAGAGGG - Intergenic
940722963 2:157301706-157301728 CACTGCTTTCAGAAGAAAGAAGG - Intronic
942529276 2:176891209-176891231 CCATGTTGTCAGAGGAAAGATGG + Intergenic
943862906 2:192891699-192891721 TAATGTTATCAGAGAAAAGATGG + Intergenic
944834995 2:203570472-203570494 GGGTGGTAACAGGGGAAAGAGGG - Intergenic
944846254 2:203671213-203671235 CAGTGGTAGCAGAAGAACAATGG - Intergenic
945097647 2:206234696-206234718 CAGAGTTATGAGAGTAAAGAAGG - Intergenic
945673154 2:212826278-212826300 TAGAGATTTCAGAGGAAAGATGG + Intergenic
945936555 2:215908069-215908091 CCCAGGTATGAGAGGAAAGAAGG - Intergenic
946518741 2:220442774-220442796 TTGTTGTATCAGAGGAAAGGTGG + Intergenic
947742567 2:232491287-232491309 CAGAGTAACCAGAGGAAAGAGGG - Intergenic
1169253884 20:4083051-4083073 CAGTGGTCTCAGAGGAAGCCTGG - Intergenic
1169263012 20:4151225-4151247 CAGTGGAGTCAGAGCACAGAGGG - Intronic
1171070634 20:22065043-22065065 CAGTGGAAATAGTGGAAAGATGG - Intergenic
1172900383 20:38330446-38330468 CAGTGATCTCAGAGGAAGGGGGG - Intronic
1173027723 20:39325039-39325061 CAGAGGTCTCAGAGGAAGGAAGG + Intergenic
1173228644 20:41177116-41177138 CAGTGGTACCAGAAGGTAGATGG + Intronic
1173619514 20:44426067-44426089 CTGTGGAATCAGGGGGAAGATGG + Intronic
1175621993 20:60455103-60455125 CAGTGAAACCAGAGGACAGATGG + Intergenic
1175728774 20:61337857-61337879 CAGAATTACCAGAGGAAAGAAGG - Intronic
1177353377 21:19974777-19974799 CAGTGGTTTCAGGGGAAAAGAGG - Intergenic
1178579836 21:33829132-33829154 CAGTGGTTTCTGAGGAAAATGGG + Intronic
1179030401 21:37714975-37714997 CAGAGGTACGTGAGGAAAGACGG - Exonic
1179541954 21:42088744-42088766 CAGAGGGATCCGAGGAGAGATGG - Intronic
1179635070 21:42703553-42703575 CGCTGGGAGCAGAGGAAAGAGGG + Intronic
1182899235 22:33884334-33884356 TAATGCCATCAGAGGAAAGAGGG - Intronic
1182915091 22:34022040-34022062 CAGTGGGATCAGGGAAAAAAGGG + Intergenic
1183094169 22:35542209-35542231 CTGTGGTGTCAGAGACAAGATGG + Intronic
952954355 3:38548001-38548023 GAGTGGTAGCAGAGGACCGAGGG - Intergenic
954619108 3:51985718-51985740 GAGTGGTGGGAGAGGAAAGACGG - Intronic
956180809 3:66516830-66516852 CAGTTGCCTCAGAGGAAATAAGG - Intergenic
956623310 3:71242682-71242704 CAGTTGTCTCAGAGGACATATGG - Intronic
957259188 3:77878361-77878383 TAGTGGTGTCAGAGAAAAGAGGG - Intergenic
957897495 3:86442603-86442625 CATTTCTATCAGAGGAAACATGG + Intergenic
958669884 3:97190207-97190229 AAGTGGTAACAGTGAAAAGATGG - Intronic
959157083 3:102679711-102679733 GATTGGGATCAGTGGAAAGAGGG + Intergenic
959157291 3:102682372-102682394 GGGTGGTTTCAAAGGAAAGAAGG - Intergenic
961150171 3:124631266-124631288 CAGAGTTGTCAGAGGAGAGATGG - Intronic
962006355 3:131353794-131353816 CAGTGGGCTCAGAGTAAAGGAGG + Intergenic
962898693 3:139738014-139738036 CTGTGGTAACAGAGGACACAGGG + Intergenic
963097804 3:141564204-141564226 CAGTTATATGAGAGTAAAGAGGG + Intronic
963474272 3:145783532-145783554 CATTAGTTTTAGAGGAAAGAAGG + Intergenic
964550209 3:157877261-157877283 CAGAGGTATCAGAGAAAAGCAGG + Intergenic
964565739 3:158050567-158050589 CACTGGTATAAGTAGAAAGAGGG - Intergenic
964572528 3:158124404-158124426 CATTGGTATCAGAGTAATGCTGG + Intronic
964850847 3:161094906-161094928 TAGTTGTAGCAGATGAAAGAGGG - Intronic
965489644 3:169320576-169320598 TCATGGTATAAGAGGAAAGAAGG + Intronic
965946567 3:174249176-174249198 CAGTGACATCATAGAAAAGATGG - Intronic
967011467 3:185438789-185438811 AAGTGGCTTTAGAGGAAAGAAGG + Intronic
967664874 3:192158964-192158986 CATTGGGATCACAGGAGAGAGGG - Intronic
968914484 4:3491356-3491378 CAGGGGGAGCAGAGGAAGGAAGG - Intronic
969596398 4:8151638-8151660 CGGTGGTGTCAGAAGAAAGCAGG + Intronic
971969631 4:33604804-33604826 CAGTGGTTGCACAGGAAAGTGGG + Intergenic
972710747 4:41592074-41592096 CAGTGCTATCAGAGGGAGAAGGG - Intronic
972783430 4:42305816-42305838 CAGAGGTGTCACATGAAAGAAGG + Intergenic
974483398 4:62475067-62475089 CAGTGCTTTCAGAGGGAACATGG - Intergenic
977662233 4:99603231-99603253 CAGTGGAGACACAGGAAAGATGG + Intronic
977792757 4:101127557-101127579 TAGAGGTTTCAGAGGCAAGAAGG + Intronic
977942578 4:102874929-102874951 CTCTGGTATCAGATGGAAGATGG - Intronic
982628816 4:157805156-157805178 AAGAGGGAGCAGAGGAAAGAGGG - Intergenic
982973112 4:162016175-162016197 CAGTGCTATCTGAGCAAATAAGG - Intronic
986407078 5:7436980-7437002 CAGTGGTATTTAAGGAGAGAAGG + Intronic
990632920 5:57690704-57690726 CAGTGGTGTCAGTGGTAAGTAGG + Intergenic
991511001 5:67376221-67376243 CAGTGGGAACAGATGACAGATGG - Intergenic
993726493 5:91373798-91373820 AAGTGGTAACAGAGGAACAAAGG - Exonic
993759672 5:91777895-91777917 CAGTTGAATCAGAGGAGAAAAGG + Intergenic
997098740 5:130944039-130944061 GAGAGGTACCAGAGGAAAGAGGG + Intergenic
997773455 5:136575935-136575957 CGGTGATATCATAGGAAAGGCGG + Intergenic
999522476 5:152364874-152364896 CAGTCAAATGAGAGGAAAGATGG - Intergenic
1000038880 5:157470039-157470061 TGGTAGTTTCAGAGGAAAGACGG + Intronic
1000385418 5:160670546-160670568 CATTGGGGTCAGAGGAAAAAAGG + Exonic
1002964317 6:1947463-1947485 CAATTGTATCAGAGGAATAAGGG - Intronic
1003725000 6:8751166-8751188 CAGTTTTATCACAGGAAAAATGG + Intergenic
1003939056 6:11006041-11006063 CAGAGCAGTCAGAGGAAAGAAGG + Intronic
1004038553 6:11950409-11950431 CTGAGGTATCAGAAGATAGAGGG - Intergenic
1005886675 6:30102456-30102478 CGGGGGTATCAGAGGAAGGTAGG - Intergenic
1006722764 6:36169354-36169376 GAGAGGAAGCAGAGGAAAGATGG - Intergenic
1010456290 6:76059542-76059564 TAGTGTTAGCAGAGGAAAGTTGG + Intronic
1011440783 6:87384803-87384825 AAGTCCTATCAGAGGAATGAAGG + Intronic
1012359678 6:98361724-98361746 CAGTGAGGTCAGAGGGAAGAAGG + Intergenic
1013734089 6:113205641-113205663 CAGTAAAATCAAAGGAAAGAGGG - Intergenic
1014045702 6:116883347-116883369 GAGTGGTAGAAGAGGGAAGAGGG - Intronic
1015137984 6:129895334-129895356 CAGTGGTATGTGAGTAAACATGG + Intergenic
1015371326 6:132456898-132456920 CAGTGGCCTCTGAGGAAAGATGG - Exonic
1015633741 6:135255765-135255787 CAGTGGGCTGAGAGTAAAGAAGG - Intergenic
1015775205 6:136806969-136806991 CAGTGGTATCAAAAGGAAAAGGG - Intergenic
1017054720 6:150426481-150426503 CAGTGTTCTCAGAGGAAGGAGGG + Intergenic
1017719034 6:157232307-157232329 CAGTGGCCTGAGTGGAAAGACGG + Intergenic
1017726186 6:157277459-157277481 GAGTGGGACCAGAGGAGAGAAGG - Intergenic
1019853927 7:3585629-3585651 CAGTGGTAACAGAGAACAGAGGG + Intronic
1021115871 7:16745957-16745979 CAGCAGAATCAGAGGAAAAATGG + Intergenic
1022515101 7:30970254-30970276 AAGTGGTTCCAGAGGAAACAAGG + Intronic
1023130457 7:36997740-36997762 CAGTGGTAGGAGAGGAAAAGAGG + Intronic
1026375408 7:69745455-69745477 CAGTGGTAACAGTGCAAAGGAGG - Intronic
1027472387 7:78589456-78589478 CAGTTGTTTGAGAGGAAATATGG - Intronic
1028707410 7:93866217-93866239 CAGGGGTTTGAGAGGAGAGAGGG - Intronic
1028968600 7:96830680-96830702 TTTTGCTATCAGAGGAAAGAAGG - Intergenic
1029405305 7:100371435-100371457 GATTGGGATCAGAGGAAAGCAGG + Intronic
1029919043 7:104242859-104242881 CAGTGGCCACAGAGGAGAGAAGG + Intergenic
1030084076 7:105802444-105802466 CAGTGGTATCTGCTGAAACAGGG - Intronic
1030791295 7:113732312-113732334 CTGTGGTATCAGAGTGAAGTGGG - Intergenic
1033259381 7:139829372-139829394 CTGGGGTCTCAGAGGAATGATGG + Exonic
1033910427 7:146257303-146257325 GAGTGGTATAGGAAGAAAGATGG + Intronic
1034497045 7:151429268-151429290 GAGTGGCATCACAGGAGAGAAGG - Intronic
1035572766 8:684549-684571 CAGTGGTACCACAGAGAAGAGGG + Intronic
1036010120 8:4712758-4712780 CAGTGGTCCCAAAAGAAAGAAGG - Intronic
1036374583 8:8189466-8189488 CAGTTGTTTCATTGGAAAGAAGG - Intergenic
1036535520 8:9646978-9647000 GAGAGGTAGCAGAGCAAAGATGG + Intronic
1036630831 8:10513716-10513738 CAGTGACATTTGAGGAAAGATGG + Intergenic
1038061378 8:23917598-23917620 CAGTGACAACAGAGGAAACAAGG - Intergenic
1038326144 8:26574188-26574210 CAGTTGTTTCAGAGGGAAGGAGG + Intronic
1038907766 8:31926214-31926236 CAGAGGTCTCAAATGAAAGACGG + Intronic
1038914637 8:32007038-32007060 CAGTGGGATGTGAGGAAAAATGG - Intronic
1039400071 8:37261844-37261866 CAGTGGCATCAGAGCCAAGCTGG + Intergenic
1039608161 8:38899993-38900015 CGGTGTTAACAGAGGAAAGGCGG - Intergenic
1039721498 8:40169305-40169327 CAGTGGGGTCAGGGGAAAGTGGG + Intergenic
1040697753 8:50022749-50022771 CAGTGGGAACAGAGGCAACATGG - Intronic
1040809550 8:51436491-51436513 CAGTGGGATCACATGGAAGAAGG - Intronic
1041241983 8:55855991-55856013 CAGTGGCAAAAGAAGAAAGAGGG + Intergenic
1041858865 8:62488323-62488345 CAGAATTAGCAGAGGAAAGAAGG - Intronic
1042469706 8:69171404-69171426 CATTGGTATCAGGGTAAAGATGG + Intergenic
1042525576 8:69761454-69761476 CAGTGTAATCAAAGGAAAGACGG - Intronic
1043158801 8:76819694-76819716 CACGGGTATCACAGGAAAGATGG + Intronic
1044304904 8:90627816-90627838 CAGTGGTATCAAAGAAACTAAGG + Intronic
1045065720 8:98442176-98442198 CAGTGGTGTTAGAGAAGAGAGGG - Intronic
1045549784 8:103161218-103161240 CAAAGGAATCAGAGGAAAGGGGG - Intronic
1046744534 8:117862767-117862789 CAGTGGCATCTCAGTAAAGATGG + Intronic
1046774973 8:118154261-118154283 CAGTGTGATGAGAGGACAGATGG - Intergenic
1048919268 8:139213225-139213247 CTGTGTTATGAGATGAAAGAAGG - Intergenic
1050560509 9:6830206-6830228 CAGTGGTATGTGAGGAAACCAGG + Intronic
1050968569 9:11839922-11839944 AAGTGGTGTCAGAGCAATGAGGG + Intergenic
1051518714 9:17960095-17960117 CAATGGAAACACAGGAAAGAAGG - Intergenic
1052173012 9:25425516-25425538 CAGAGGCCCCAGAGGAAAGAAGG + Intergenic
1055746471 9:79451238-79451260 CAGTGGCTTGATAGGAAAGAGGG - Intergenic
1056275742 9:84992437-84992459 CACTGGTATCAGAGGCTACAAGG - Intronic
1056412546 9:86345332-86345354 CAGTGGTAACAGAGGATAGGTGG + Intronic
1058567137 9:106298054-106298076 CAGTGTAGTCAGAGAAAAGAGGG + Intergenic
1058954292 9:109931156-109931178 CCAAGGTATCAGAGGAAAGGAGG - Intronic
1059254587 9:112918039-112918061 CAGAGGTATGACAGGAAAGGAGG + Intergenic
1059599399 9:115760080-115760102 GAGTGGTATTATAAGAAAGAAGG + Intergenic
1059842210 9:118230275-118230297 CAATGGAAGGAGAGGAAAGAAGG - Intergenic
1061111215 9:128572680-128572702 AAGTGGTAGCAGAGGAAGGTGGG + Intronic
1061485134 9:130916701-130916723 CAGTGGGATGGGAGGACAGAGGG + Intronic
1061775752 9:132962584-132962606 CAGTGGAATCAGATGAAAACTGG + Intronic
1062604780 9:137341789-137341811 CAGGGGAGTCAGAGGAAACAGGG + Intronic
1062604796 9:137341849-137341871 CAGGGGAGTCAGAGGAAACAGGG + Intronic
1062604808 9:137341895-137341917 CAGGGGAGTCAGAGGAAACAGGG + Intronic
1062604909 9:137342295-137342317 CAGGGGAGTCAGAGGAAACAGGG + Intronic
1062604921 9:137342341-137342363 CAGGGGAGTCAGAGGAAACAGGG + Intronic
1190937895 X:55013107-55013129 GAGTGGTATTAAAAGAAAGAGGG - Intronic
1192194571 X:69019613-69019635 CAGTGGCCTCAGAGGAAAAGTGG + Intergenic
1192554412 X:72078538-72078560 CTGTGGTTAGAGAGGAAAGAGGG - Intergenic
1195252081 X:103058872-103058894 CAGTGCTATTAGAGGAAACATGG - Intergenic
1198064209 X:133080258-133080280 CAGGAGAATCAGAAGAAAGAAGG + Intronic
1198364546 X:135927684-135927706 CAGTGGTATTTAAGGAGAGATGG + Intergenic
1198801552 X:140452791-140452813 CAGGGGTAGCAGAGGCAGGAAGG + Intergenic
1199729752 X:150620356-150620378 CAGTAGTATAAGGGGAAAGCTGG - Intronic
1199859796 X:151791041-151791063 GAGTGGTGTCAAAGGAAATACGG + Intergenic
1201622378 Y:15974253-15974275 CATTTAAATCAGAGGAAAGAGGG - Intergenic