ID: 1166541831

View in Genome Browser
Species Human (GRCh38)
Location 19:43610843-43610865
Sequence CTGGGGACCCAGCAGGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 739
Summary {0: 1, 1: 1, 2: 6, 3: 77, 4: 654}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166541831_1166541838 -3 Left 1166541831 19:43610843-43610865 CCACCCTCCTGCTGGGTCCCCAG 0: 1
1: 1
2: 6
3: 77
4: 654
Right 1166541838 19:43610863-43610885 CAGCATCACCAGCCCAGAACAGG 0: 1
1: 1
2: 0
3: 15
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166541831 Original CRISPR CTGGGGACCCAGCAGGAGGG TGG (reversed) Intronic
900161907 1:1227856-1227878 CTCGGGACTCAGCAGGGTGGGGG + Intronic
900184164 1:1325169-1325191 CTGGGGGGCCAGCAGGAGACGGG - Intronic
900385178 1:2407321-2407343 CTGTGTCACCAGCAGGAGGGTGG - Intronic
900536577 1:3180717-3180739 CTGGAGACCCCTCAGGAGGAAGG - Intronic
900558047 1:3289873-3289895 CTGGTGACCGGGCAGGAGTGGGG - Intronic
900592362 1:3465719-3465741 TGGGGGCCCCAGCAGGAGGCCGG - Intronic
900598779 1:3494251-3494273 GTGGGGAGCCAGCAGCAGTGGGG - Intronic
900672677 1:3865620-3865642 CTGGGGACCACGCACAAGGGCGG - Intronic
900796445 1:4711442-4711464 CTGGGGTCCCAGGTGGAGGCCGG + Intronic
900998221 1:6134260-6134282 CTGCAGACACAGCAGGAGGTGGG + Intronic
901067717 1:6502322-6502344 GTAGGGACCCAGCTGCAGGGAGG + Intronic
901626879 1:10629719-10629741 CTGGGGGCCCAGCAAGTGGTAGG - Exonic
902248531 1:15138072-15138094 CTGGGGCCCCAGCAGCCAGGAGG + Intergenic
902638018 1:17747761-17747783 CTGGGGACCCTTCAGGAGGCCGG + Intergenic
902654685 1:17859313-17859335 CTGAGGACCCAGGAGTAGGTAGG - Intergenic
902781013 1:18705132-18705154 CTGGGATCCCAGCAAGAGAGTGG - Intronic
903027242 1:20438161-20438183 TTGGGGACCCTGCAGGGGTGAGG - Intergenic
903067368 1:20708114-20708136 CTGAGGACAGATCAGGAGGGAGG - Intronic
903300275 1:22373910-22373932 CTAGGGACCCCCCAGGAAGGTGG - Intergenic
903323448 1:22556011-22556033 ATGGGGATCAGGCAGGAGGGGGG - Intergenic
903466698 1:23556961-23556983 CTGGGGAGCCACCAGGGGTGTGG + Intergenic
903479163 1:23640437-23640459 GTGAGGACCCAGCAAGAGGGTGG + Exonic
903536182 1:24067868-24067890 TTGGGGACCCAGCAGGGCTGGGG + Intronic
903649520 1:24914346-24914368 CTGTCTACCCAGCAGCAGGGTGG + Intronic
904494244 1:30877766-30877788 CTCGGAACCAGGCAGGAGGGAGG + Intronic
904998625 1:34650765-34650787 CTGAGGAAGCAGCAGGAAGGAGG + Intergenic
905106437 1:35565971-35565993 CTGGCTCCCCTGCAGGAGGGAGG + Exonic
905212819 1:36385979-36386001 CTGGAGACGCAGGCGGAGGGCGG - Intergenic
905232357 1:36522142-36522164 CTGGAGACCCAGTCTGAGGGGGG - Intergenic
905800484 1:40839275-40839297 GTGGCCACCCAGCAGGAGGAGGG - Exonic
905868172 1:41387591-41387613 TTGGGGGCCCAGCAGGTGAGGGG + Intergenic
906147901 1:43570701-43570723 CTTGGTGCCCAGCAGGAGGAGGG + Intronic
906513749 1:46425973-46425995 CTGGTGACTTGGCAGGAGGGTGG + Intergenic
906532928 1:46533653-46533675 GTGGGCACACAGCAAGAGGGCGG + Intergenic
906811802 1:48834591-48834613 CTGAGGACACAGCAAGAAGGAGG + Intronic
907330340 1:53666783-53666805 CTGGGGAGCCAGCAGGGCAGGGG + Intronic
907392583 1:54167981-54168003 CTGGGGATGCAGCAAGAGGGAGG + Intronic
907451975 1:54551344-54551366 CTGGGTACCCAGCAAGTGAGTGG + Intronic
907482924 1:54757164-54757186 CTGAGGCCCCAGCAGGGGGAGGG + Exonic
908253878 1:62286752-62286774 CTGGGGCCCCAGGAGGGGGTAGG - Intronic
909722729 1:78795457-78795479 CTGTGGCCCCAGCACTAGGGAGG - Intergenic
910077526 1:83298579-83298601 ATAGGGATCCATCAGGAGGGTGG + Intergenic
910220974 1:84889207-84889229 CTGGCAAGCCAGCTGGAGGGTGG - Intronic
910231204 1:84988903-84988925 CTGGGGGAACAGCAGTAGGGTGG - Intronic
911506364 1:98757399-98757421 CTGAGGACACAGCAGGAAGGTGG - Intronic
911643191 1:100310837-100310859 TTGGGGACCCTAAAGGAGGGGGG + Intergenic
912713509 1:111966076-111966098 CTGGGGAGCCAGCAGCAGGGTGG - Intronic
915299083 1:154941822-154941844 CTGGGGAGGCAGCAGGAGACGGG + Intergenic
915355853 1:155254989-155255011 CAGGGGACCCAGCCAGGGGGTGG - Exonic
915360544 1:155284100-155284122 ATGGAGACCCAGCAGTCGGGAGG - Exonic
915488727 1:156239890-156239912 CTGGGGAACCAGCAGGAGGGGGG - Intronic
916135205 1:161646655-161646677 CTGTGGACATAGCAGGAGAGTGG + Intronic
916738371 1:167628122-167628144 CTGGGGACCCAGGAGCATGGTGG + Intergenic
917141157 1:171837569-171837591 GTGAGGACACAGCAGGAAGGTGG - Intergenic
917498450 1:175564239-175564261 CAGGGCAGGCAGCAGGAGGGAGG - Intronic
917991581 1:180385677-180385699 GTGAGGACCCAGCAAGATGGTGG + Intronic
919046350 1:192457519-192457541 CTGAGGACACAGCAAGAAGGTGG - Intergenic
919802882 1:201364233-201364255 CTGGGGGCCCAGCAGGAGCTGGG + Intronic
919912274 1:202118909-202118931 CTGGGCACCCTCCAGGGGGGTGG + Intergenic
919920056 1:202162133-202162155 CTGGGGACACAGGAGGGGGCAGG + Intergenic
920850794 1:209626811-209626833 CTGGGGGCCGAGCACGCGGGTGG - Intronic
921009694 1:211129014-211129036 CTGGAGAACCATCAGGAGGGAGG + Intronic
921039589 1:211416840-211416862 CAGGGTCCCCAGCAGGAAGGTGG - Intergenic
921180153 1:212625677-212625699 CTGAGGAGCCAGCAACAGGGGGG + Exonic
922237652 1:223734004-223734026 CTGCAGACTCAGGAGGAGGGAGG + Intronic
922769194 1:228173041-228173063 CTGAGGACCCTGCCGCAGGGAGG - Intronic
923762619 1:236860511-236860533 CTGGGGACCTTGGAGGAGTGGGG + Intronic
924808174 1:247378358-247378380 GTGAGGACACAGCAAGAGGGTGG + Intergenic
924886954 1:248229213-248229235 CTAGGGAACCAGCAGGAGCAGGG + Intergenic
1063663106 10:8047210-8047232 CTGGGGAACCGGCAGGTAGGTGG + Intergenic
1063856016 10:10254943-10254965 CTGGGGACCCAGCTTTAGGGAGG + Intergenic
1064020086 10:11801977-11801999 CTGGAGACTCAGAAGGAGGGAGG + Intergenic
1064277742 10:13922070-13922092 CTGAGGACACAGCAAGAAGGTGG + Intronic
1064358991 10:14646342-14646364 CTGGAGACTCAGGAGGAGGGAGG - Intronic
1065629233 10:27660403-27660425 CTGTCGCCCCAGCTGGAGGGCGG - Intergenic
1066340371 10:34526696-34526718 CTGGTGGCACAGCAGGAGGAGGG - Intronic
1066642575 10:37571077-37571099 CTGGGGACCCAGAGGGAGACAGG - Intergenic
1067272650 10:44805426-44805448 CTGGGGATCCAGCAGGGGAAAGG + Intergenic
1067345866 10:45438884-45438906 CTGAGGACCAAGGAGGGGGGAGG - Intronic
1067739267 10:48882153-48882175 CTTAGGACCCAGCTTGAGGGAGG + Intronic
1067828689 10:49597624-49597646 CTGAGGACCCTGCAGGAGGATGG - Intergenic
1068520635 10:58073468-58073490 CCGGAGACTCAGAAGGAGGGAGG - Intergenic
1069096645 10:64267386-64267408 GTGAGGACCCAGCAAGAAGGCGG + Intergenic
1069808110 10:71138560-71138582 CGGGGACCACAGCAGGAGGGCGG - Intergenic
1069818057 10:71211162-71211184 CTGGGCACCCAGCATCAGGAGGG - Intergenic
1069916556 10:71790360-71790382 CTGGGCACCCAGCAGCTGGTAGG - Intronic
1070116676 10:73535395-73535417 CCAGGTACCAAGCAGGAGGGAGG + Intronic
1070630919 10:78084064-78084086 CTGGGGAACCAGGATGAGGGTGG + Intergenic
1070684630 10:78471640-78471662 CTGGGGTCCCAGGAGCAGAGGGG - Intergenic
1070704319 10:78626732-78626754 GTGGGGACCCATCAGGAAGCTGG - Intergenic
1070785677 10:79160971-79160993 CTGGGGTCTCAGCTGGAGGCTGG - Intronic
1072254981 10:93612921-93612943 CTGTGGACCGTGCAGGAGGAGGG + Exonic
1072891497 10:99329294-99329316 CTGGGAACCCAGCCGCAGGCAGG - Exonic
1073458345 10:103651187-103651209 GTGGGGACCCAGCTGCCGGGAGG - Intronic
1074574061 10:114651877-114651899 CTGGGGACCCAGCATGCTGGAGG + Intronic
1075070837 10:119319080-119319102 GTGGGGGCCCCGCAGGAGGAGGG - Intronic
1075274607 10:121081859-121081881 CTGGGGACACTGGAGGAGAGAGG + Intergenic
1075712484 10:124538052-124538074 GGGAGGACCCAGCAGGTGGGTGG - Intronic
1075836154 10:125454535-125454557 CTCAGGAGCCAACAGGAGGGTGG - Intergenic
1076614451 10:131746665-131746687 CTGGGGACAGAGCTGGGGGGAGG + Intergenic
1076712409 10:132345647-132345669 CTGGGCACCTGGCAGGAGTGGGG + Intronic
1076739815 10:132477634-132477656 CTGGGGCCCCTGGAGGTGGGCGG - Intergenic
1076817288 10:132921217-132921239 CTGGGCACTGAGCTGGAGGGAGG + Intronic
1076863038 10:133150988-133151010 CTGGGGAGGCCGCAGGATGGCGG - Intergenic
1077177485 11:1197330-1197352 CTGAGGACCCAGCAGGAGTAGGG - Intronic
1077349629 11:2086450-2086472 CAGGGGACTCAGCAGGTGGACGG + Intergenic
1077446098 11:2591575-2591597 CTGGGGACCCAGCCTGTGTGCGG + Intronic
1077456739 11:2685937-2685959 CGTGTGACCCAGCAGGAGGATGG - Intronic
1078225160 11:9384945-9384967 TGAGGGTCCCAGCAGGAGGGTGG + Intronic
1081674922 11:44963203-44963225 CTTGGGGCCCAGCAGGAAGCTGG - Intergenic
1083869352 11:65477456-65477478 CTGGGGACACGGCAGGAAGAAGG + Intergenic
1083920437 11:65779305-65779327 CTGGGGCCCTAGCAGCAGTGGGG + Exonic
1084209954 11:67616256-67616278 ATGGGGACCCAGACGGGGGGCGG + Intergenic
1084241466 11:67823441-67823463 TTGGGGACCCAGCAGACTGGAGG - Intergenic
1084793338 11:71488953-71488975 CAGGTGACCAGGCAGGAGGGTGG + Intronic
1084965609 11:72742923-72742945 CTCGGGACCCAGCAGTTGAGTGG - Intronic
1085047099 11:73359974-73359996 CTGGGGAGCCAGAGGGTGGGAGG + Intronic
1085171626 11:74454466-74454488 CTGGGGAGACAGCAGGAAGCAGG - Intergenic
1085251281 11:75145446-75145468 ATGGGGACTCTGCAGGTGGGCGG - Intronic
1085257161 11:75181659-75181681 CTGGGGGCCCAGCAGACAGGAGG + Intronic
1085886334 11:80526724-80526746 CTGGAGACCCAGAAGAGGGGAGG + Intergenic
1087673042 11:101128658-101128680 CTGGTGACCTCGCAGGCGGGAGG + Exonic
1088839446 11:113611598-113611620 GTGAGGACACAGCAAGAGGGAGG - Intergenic
1089281884 11:117380536-117380558 CTTGAGAGCCAGCAGGAGGATGG + Intronic
1089453745 11:118613793-118613815 CTAGGGACACAGCAGAAAGGTGG - Intronic
1089576439 11:119447698-119447720 CTGAGGACCCAGCATGTGGGAGG - Intergenic
1089622430 11:119729426-119729448 CTGGGGAGCCGGCTGGAGCGCGG + Intergenic
1089625815 11:119750154-119750176 CTTGGGACCCAGAAGTGGGGTGG + Intergenic
1089757095 11:120695152-120695174 CTTGGGACCCAGGAGCATGGGGG + Intronic
1090412002 11:126515705-126515727 CTGGGGACACAGCTGGGGGCTGG + Intronic
1090458467 11:126869393-126869415 CTGGAGACACTGCAGGAGAGTGG - Intronic
1090805815 11:130201428-130201450 ATGGGCCCACAGCAGGAGGGAGG + Intronic
1091004089 11:131936478-131936500 TTGGAGACTCAGAAGGAGGGTGG + Intronic
1091312446 11:134584405-134584427 GTGGGGAGGCAGCAGGGGGGTGG - Intergenic
1091788861 12:3259731-3259753 GTGGGAACCCAGCACGGGGGTGG + Intronic
1091800955 12:3324151-3324173 CTGGGACCACAGGAGGAGGGAGG + Intergenic
1092003794 12:5052040-5052062 CTGGGGATCCTGGAGGAGGCAGG + Intergenic
1092007447 12:5081254-5081276 CTGGTGACCCAGCAGGGCGGAGG + Intergenic
1092106706 12:5926472-5926494 CCAGGGAGCCAGCAGGAGAGAGG - Intronic
1092190055 12:6512639-6512661 CTGGGGAGCCACAAGCAGGGAGG + Intronic
1092196436 12:6552341-6552363 GTGGGGAGCCAGCAGGGTGGTGG - Intronic
1092589959 12:9943601-9943623 CTGCGTACCAAGCAGGTGGGAGG - Intergenic
1095184613 12:39187047-39187069 CTGGGGACCCAGAAGGGAGATGG - Intergenic
1095226336 12:39681306-39681328 CTGGGGACTCTGGTGGAGGGTGG + Intronic
1095351584 12:41220274-41220296 CTGAAGACACAGCAAGAGGGTGG - Intronic
1095500173 12:42829056-42829078 CTGGGGATCCAGCAGGGGGATGG + Intergenic
1096659862 12:53117680-53117702 CTGGGGAGGCAGTGGGAGGGTGG + Intronic
1097288024 12:57892580-57892602 CTTGGCACCCAGAAGGTGGGGGG + Intergenic
1098081607 12:66791834-66791856 CTGGAGACTCAGAAGCAGGGAGG - Intronic
1099777494 12:87151770-87151792 ACAGGGACCCATCAGGAGGGTGG - Intergenic
1100206373 12:92354412-92354434 ATGGGGAGCCAGCAGGGGGATGG - Intergenic
1101623701 12:106417355-106417377 CTGGAGACCCAGGTGGAGGCTGG + Intronic
1102122161 12:110450128-110450150 CTGGGGCCCGAGAAGGAGGGAGG - Intronic
1102239301 12:111314027-111314049 CCGGGGACCAGGCAGGAGGGAGG - Intronic
1102315462 12:111883956-111883978 CTAGGGATGCAACAGGAGGGAGG - Intronic
1102440892 12:112963290-112963312 CTGGGGGCACAGCAGGAAGGTGG - Intronic
1102455884 12:113070514-113070536 CTGAGGGACCAGCAGGAGGAAGG + Intronic
1102822113 12:115917057-115917079 GTGGGGACCAAGCACAAGGGAGG + Intergenic
1103181730 12:118918065-118918087 TTGGGGACCCAACAGAAGGGAGG + Intergenic
1103858499 12:123992204-123992226 CTGGGGACCAAGTAGGAAAGTGG + Intronic
1103921052 12:124399354-124399376 CTGGGGGCTCAGCCGCAGGGTGG - Intronic
1104610805 12:130226179-130226201 CTGGGGGACCAGCAGGACGTGGG - Intergenic
1104773605 12:131379890-131379912 CTGTGGACCCACCAGGAAGCTGG + Intergenic
1104920612 12:132288681-132288703 CATTGGACCCGGCAGGAGGGTGG + Intronic
1104920656 12:132288852-132288874 CGTTGGACCCGGCAGGAGGGTGG + Intronic
1104920670 12:132288910-132288932 CGTTGGACCCGGCAGGAGGGTGG + Intronic
1104947961 12:132425465-132425487 CTGTGCACCGAGCATGAGGGAGG - Intergenic
1104990503 12:132621555-132621577 CTGGGGTCCCAGCGGGTGCGGGG + Exonic
1105747205 13:23388716-23388738 CTGGAGACTCAGAAGCAGGGAGG + Intronic
1107351547 13:39520062-39520084 CTGGGCTCCCAGATGGAGGGTGG - Intronic
1107555437 13:41513480-41513502 CTGAGGACACAGCATGAGGACGG + Intergenic
1107691325 13:42956485-42956507 ATGGGGTCCCAGCAGGCAGGAGG + Intronic
1107869885 13:44736556-44736578 CTGGGGAGCCACAAGGAGAGGGG + Intergenic
1110596501 13:77326462-77326484 CTGGGGACGCACCTGGAGGCTGG + Exonic
1110639374 13:77804380-77804402 TTGGGGACCCAAGAGTAGGGTGG - Intergenic
1111976117 13:94968379-94968401 CTGGAGACCCGGGAGGAGCGAGG + Intergenic
1112655638 13:101449951-101449973 CTGGGGACACAGCAGTAGGTTGG - Intergenic
1113972450 13:114200302-114200324 CTGGGGACAGAGAAGGAGGCTGG - Intergenic
1114080774 14:19200273-19200295 CAGAGGACACAGAAGGAGGGAGG + Intergenic
1114416920 14:22551109-22551131 CTGGGGACCCTGGGGGAGGAGGG - Intergenic
1114493424 14:23117409-23117431 CTAGGCCCCCAGCAGGATGGGGG + Exonic
1114501637 14:23173761-23173783 CTGTGGTCCCAGCACTAGGGAGG - Intronic
1114556567 14:23565690-23565712 CTGGGGTACCACCTGGAGGGAGG + Exonic
1115190323 14:30741195-30741217 ATGAGGACCCAGCAAGAAGGTGG + Intergenic
1117070178 14:52049052-52049074 CTCAGGGCACAGCAGGAGGGTGG + Intronic
1117353585 14:54902937-54902959 CTGGGGACCCCGGGGGCGGGAGG - Intergenic
1118722196 14:68602208-68602230 CTGGGGACCAGACAGGAAGGTGG - Intronic
1118858442 14:69642650-69642672 GGAGGGACCCAGCAGGGGGGCGG - Intronic
1119387405 14:74266227-74266249 CTGGAGGGCCAGCAGGAGGCTGG - Intergenic
1119550997 14:75514132-75514154 CTGGGGACCCAGAAGCTGCGTGG + Intergenic
1119778979 14:77265784-77265806 CTGGGGACCGGCCAGGAAGGAGG - Exonic
1120027460 14:79602513-79602535 CTGGGGTGCTATCAGGAGGGAGG - Intronic
1120131716 14:80815941-80815963 CTGGAGACCCAGAGGGTGGGAGG + Intronic
1121332061 14:93055901-93055923 CTGAGCACCCAGCAGACGGGAGG + Intronic
1122211634 14:100177852-100177874 CTGGGGACCTGGCTGGCGGGGGG - Intergenic
1123213649 14:106785353-106785375 CTGCAGGCCCAGCAGGAGGCCGG - Intergenic
1124019331 15:25904908-25904930 CTGGGTACCCAGCATGAGTGGGG + Intergenic
1124121471 15:26892418-26892440 CCGGGGGCCCAGCAGTGGGGGGG + Intronic
1124154085 15:27209871-27209893 GTGAGGACACAGCAGGAAGGTGG - Intronic
1124183261 15:27498611-27498633 CTGTAGTCCCAGCAGGAGGCTGG - Intronic
1124700750 15:31909886-31909908 CTGGGTACCCAGAAGGCAGGGGG + Intergenic
1125529847 15:40406005-40406027 TTGGGGACCAGGCAGGAAGGAGG - Intronic
1125529856 15:40406030-40406052 ATGGGGACCAGGCAGGAAGGAGG - Intronic
1128498230 15:68210326-68210348 CTGGAGCCCCAGCAGGAAGGGGG - Intronic
1129151539 15:73691631-73691653 CTGGGCTCCCTGCAGGAGTGCGG + Intronic
1129158050 15:73731140-73731162 CTGTAGACCTAGCGGGAGGGCGG - Intergenic
1129454728 15:75670591-75670613 CAGGGCAGCCAGCAGGAGAGGGG - Intergenic
1129608304 15:77035442-77035464 TCAGGGACCCACCAGGAGGGAGG - Intronic
1129609764 15:77043880-77043902 GTGTGGAGGCAGCAGGAGGGAGG + Exonic
1129688523 15:77700080-77700102 CTGGGGAACCAGCAGAGGGGAGG + Intronic
1130350269 15:83085184-83085206 GTGGGGAGGCAGCAGGAGGTGGG + Intergenic
1130520625 15:84658305-84658327 CTGGTAACCTAGCGGGAGGGTGG - Exonic
1130884461 15:88081641-88081663 CTGGGGGCTCAGAAGGAAGGGGG - Intronic
1130957791 15:88639415-88639437 CTGGGGCCCCACCGGGAGAGTGG + Exonic
1131367367 15:91852764-91852786 GTGGGGACCCAGCAGGCCTGCGG + Intergenic
1131653146 15:94423988-94424010 CTGGGGACAAAGCAGGAAGGAGG - Intronic
1131781710 15:95866724-95866746 CTGTGGACCAAGCAGGAGGAAGG + Intergenic
1132322237 15:100934427-100934449 CTGGGGACACAGCAGGAGTGTGG + Intronic
1132344880 15:101102159-101102181 CCGAGGACCCAGCTAGAGGGAGG + Intergenic
1132464472 16:71401-71423 CTGGGGACCAAGCAGCTGGCTGG - Intronic
1132478600 16:154440-154462 CTGGGGAACCTCCAGGACGGGGG - Exonic
1132639347 16:970651-970673 CCCGGGCCCCAGCAGGAAGGAGG + Intronic
1132656608 16:1044241-1044263 CAGGGGTCCCAGGAGGAGGGCGG - Intergenic
1132903344 16:2270067-2270089 CTGGGGCCCCTTCAGCAGGGGGG - Intergenic
1132932186 16:2464406-2464428 CTGGAGCCTCAGAAGGAGGGAGG + Intronic
1132942798 16:2516530-2516552 CTGGGGACACAGCTGGAGGTTGG - Intronic
1132975620 16:2709825-2709847 CTGGGTGCCCAGCATGAGGCCGG + Intergenic
1132987368 16:2774653-2774675 CTGTGGACCCAGCAGCTGTGTGG - Intronic
1133020489 16:2964772-2964794 CTGGGGACCCAGGCGGGAGGTGG + Intronic
1133612730 16:7448674-7448696 CTGGGGAGCCACCAGGAGCCAGG - Intronic
1133681181 16:8121645-8121667 CTGGGAACCCAGGAGGTGGAGGG - Intergenic
1133875926 16:9734267-9734289 CTGGCGAAACAGCAAGAGGGAGG - Intergenic
1133997880 16:10761991-10762013 TTGGGGTGCCAGCTGGAGGGTGG - Intronic
1134218332 16:12333772-12333794 CTGGGGACTGGGCAGGAAGGAGG + Intronic
1134244060 16:12526779-12526801 CTGTGGACCCCGCAGGGGGTGGG - Intronic
1134247634 16:12551841-12551863 CTGGGGACACAGGAGCAGGCAGG + Intronic
1135356489 16:21773350-21773372 GTGGGGACCCAGTAGGAGATTGG + Intergenic
1135398252 16:22147476-22147498 CTGGGGCATCAGGAGGAGGGAGG + Intronic
1135454985 16:22589493-22589515 GTGGGGACCCAGTAGGAGATTGG + Intergenic
1136656211 16:31710851-31710873 CTGGGGTCCCAGGAGGATGGTGG - Intergenic
1138446931 16:57070440-57070462 CAGGGGACAGAGCAGGAGAGGGG + Intronic
1138639763 16:58375508-58375530 CTGGGGCCAAAGAAGGAGGGAGG - Intronic
1139320312 16:66109218-66109240 CTGGGGACCCTGGAGAAGAGAGG - Intergenic
1139469249 16:67169652-67169674 CTGGACATCCAGCAGGAGTGGGG - Exonic
1139924440 16:70478465-70478487 CTCTGGCCCCAGCATGAGGGAGG + Intronic
1140840715 16:78836442-78836464 CTGTGGACCCACCTGAAGGGTGG + Intronic
1141461370 16:84180345-84180367 CTGGGGCCCGAGAAGGAAGGGGG + Intronic
1141615296 16:85206674-85206696 CTGGGGGCCCAGCCGGGGAGGGG - Intergenic
1141780679 16:86158439-86158461 CTGGGGACACAGCATGAGGATGG + Intergenic
1142107785 16:88315602-88315624 CTGTGACCCCAGAAGGAGGGTGG + Intergenic
1142149602 16:88506764-88506786 GGGGGGACCCAGGAGGAGGCAGG + Intronic
1142218462 16:88841394-88841416 CTGGAGACCAGGCAGGTGGGAGG - Intronic
1142496620 17:309592-309614 CTGGACCCCCAGCAGGAGGCTGG - Intronic
1142496660 17:309705-309727 CTGGACCCCCAGCAGGAGGCTGG - Intronic
1142713602 17:1736400-1736422 CAGGGGTCTCAGCAGGAGGCAGG + Intronic
1142967812 17:3592025-3592047 CTGGGCTCCCAGCAGGGAGGGGG + Intronic
1142981744 17:3676404-3676426 CTGGGGAACCGGGAGGACGGAGG + Intronic
1143141110 17:4742308-4742330 CTGGGGACACAGCGGGTGGTGGG - Intronic
1143443773 17:6995705-6995727 CTGGGGAGCCAGGAGGAAGTAGG - Intronic
1144249715 17:13403486-13403508 CTGGGGTACCAGAAGGAAGGTGG - Intergenic
1144575974 17:16429727-16429749 CTGGGGAGATGGCAGGAGGGTGG + Intronic
1144585424 17:16484756-16484778 CTGAGGGCCGAGCAGGAGCGAGG + Intronic
1144780425 17:17805587-17805609 CTGGGGACCCACCAGGCAGGTGG - Intronic
1145253585 17:21310521-21310543 CTGGGGCCCTTGCAGGATGGGGG - Intronic
1145403620 17:22568288-22568310 CTCGGGCACCAGCAGGAGGAGGG + Intergenic
1145867546 17:28250578-28250600 CTGGGGCCCCAGGAGGTTGGTGG + Intergenic
1145978616 17:28998412-28998434 CTGGGGACCCAGGGGTAGGGAGG + Intronic
1146265576 17:31450605-31450627 AAAGGGACCCAGGAGGAGGGCGG - Intronic
1146916222 17:36680082-36680104 CTGGGGACCCGGCAGCAGAAAGG + Intergenic
1147161850 17:38573034-38573056 CTCGGGTTGCAGCAGGAGGGAGG + Intronic
1147384161 17:40071887-40071909 CTGGGTACCCAGAAAGAGGCTGG - Intronic
1147889130 17:43704740-43704762 CTGGGAACCCAGCAAGGGGTGGG - Intergenic
1147924584 17:43938688-43938710 CTGGGGCCCCGGGAGGAGGTCGG - Exonic
1147979966 17:44268241-44268263 CTGGGCACCCAGTGGGAGCGGGG - Intergenic
1148215956 17:45834151-45834173 CTAGGGACCTAGGAGCAGGGAGG - Intronic
1148219074 17:45849650-45849672 CTAGGGAACCAGCAGGGGGAGGG - Intergenic
1148866258 17:50630354-50630376 CTGGTGGCCCACCAGGTGGGAGG - Intergenic
1149258986 17:54858637-54858659 CTGGGGAACCAGCCTGAAGGTGG + Intergenic
1149550487 17:57535743-57535765 TTGGGGATCCAGCCAGAGGGAGG + Intronic
1149662012 17:58338996-58339018 CTGGGGAATCAGCTGGAGGCAGG - Intergenic
1149680385 17:58503015-58503037 ATGGGTTCCCAGCAGGAGGATGG - Intronic
1149991674 17:61387084-61387106 CAGGGGCCCCAGCAGTAGGTCGG - Intronic
1150096616 17:62381682-62381704 GAGGGCAGCCAGCAGGAGGGAGG - Intronic
1151341203 17:73472080-73472102 ATGGGGACCCAGGGGCAGGGGGG - Intronic
1151345580 17:73499400-73499422 CTGGGGACCCAGCCTGGGGCCGG + Intronic
1151529027 17:74692534-74692556 CCGGTGACCCAGCAGGTAGGAGG - Intronic
1151578555 17:74964735-74964757 CTGGGACCCCAGCAGGTAGGGGG - Intronic
1151699952 17:75737706-75737728 CTGGGGACCCTGGTGGAGGGTGG - Intronic
1152027348 17:77819713-77819735 CTTGGGAGGCAGCAGGCGGGCGG + Intergenic
1152037134 17:77880421-77880443 CTGGAGCCCAAGTAGGAGGGAGG - Intergenic
1152073152 17:78143985-78144007 CTGGGGACACAGTATGGGGGAGG + Intergenic
1152089566 17:78239248-78239270 CTGAGTCCCCAGCAGGTGGGAGG + Exonic
1152383834 17:79957012-79957034 CTGTGGCCACAGCAGCAGGGAGG + Intronic
1152390877 17:80003011-80003033 CTGGGGATTCAGCAGGAGAGAGG + Intronic
1152504689 17:80741155-80741177 CCCGTGACCCAGCAGGAGAGTGG + Intronic
1152610606 17:81313481-81313503 CTGTGGCCTCTGCAGGAGGGAGG - Exonic
1152933491 17:83122515-83122537 CAGGGGAACCAGGTGGAGGGCGG + Intergenic
1152946317 17:83199384-83199406 GTGGGGGCCCGGCGGGAGGGTGG - Intergenic
1153057987 18:966874-966896 TTGGGGTGGCAGCAGGAGGGAGG + Intergenic
1153226824 18:2906375-2906397 GTGGGGCCCCGGCAGGAGTGTGG + Intronic
1153707138 18:7757530-7757552 CTGGGCAGCCAGCAGCAGGTGGG + Intronic
1153910472 18:9702095-9702117 CTGGGGCCCCACCAGGAGACTGG + Intergenic
1154070888 18:11149977-11149999 CTGTGGACCCAGCAGAAGTCGGG - Intergenic
1154145205 18:11861247-11861269 AAGGAGAGCCAGCAGGAGGGAGG - Intronic
1154492338 18:14931914-14931936 CCCGGGACAGAGCAGGAGGGAGG - Intergenic
1154492376 18:14932005-14932027 CCTGGGACAGAGCAGGAGGGAGG - Intergenic
1157301934 18:46485399-46485421 CTGGGAATGCAGCAGGAGGTGGG + Intronic
1157401864 18:47395453-47395475 CTGTGTTCCCAGCAGGAGGAAGG + Intergenic
1158277139 18:55780551-55780573 CTGGGGACCCAACAGGCCGCCGG + Intergenic
1158395135 18:57073368-57073390 CAGGGGACCCAGCAGAAATGAGG + Intergenic
1158627107 18:59081106-59081128 TTGGGGGCACAGCAGGAAGGTGG - Intergenic
1158816423 18:61103169-61103191 CTGGAGACTCAGAAGCAGGGAGG + Intergenic
1159636110 18:70806855-70806877 CTGGGGAAACAGCAAGAGAGAGG - Intergenic
1159681149 18:71354207-71354229 CTGGAGGCTCAGCAGGAGAGTGG - Intergenic
1160313845 18:77822016-77822038 CTGGGGGCCCAGCTGCAGAGAGG - Intergenic
1160458391 18:79019046-79019068 CCAGGGACCCAGCAAGAGCGGGG + Intergenic
1160544436 18:79643338-79643360 CTGGGGACGCACCAGCTGGGAGG - Intergenic
1160659180 19:290606-290628 CCCGGGACCCTGCGGGAGGGGGG + Intronic
1160694153 19:474522-474544 CTGGGAGCCCAGCAGGAGGCAGG - Intronic
1160732856 19:649141-649163 CAGGGGACCCAGGAGCGGGGGGG - Intronic
1160754208 19:749237-749259 CTGAGGCCCCAGCAGGGTGGAGG - Intergenic
1160766565 19:811205-811227 CTGGGGACCCAAGGGGTGGGGGG + Exonic
1160845411 19:1164036-1164058 CAGAGGACCCACCTGGAGGGAGG - Intronic
1161003769 19:1924423-1924445 CTGTGGCCCTGGCAGGAGGGGGG - Exonic
1161032208 19:2062690-2062712 CCAAGGTCCCAGCAGGAGGGCGG - Intergenic
1161305663 19:3566189-3566211 CTGAGGGCCCAGCAGCAGTGGGG + Intronic
1161404352 19:4083302-4083324 CAGGGGAGACAGCAGGATGGTGG + Intergenic
1161660704 19:5544189-5544211 CTGGCGGTTCAGCAGGAGGGAGG - Intergenic
1161802731 19:6424810-6424832 CTGGGAACCCAGCCGCTGGGAGG + Intergenic
1161814583 19:6492014-6492036 CTGGGGGCTCAGCAGGAGTAAGG - Intergenic
1161843193 19:6694626-6694648 CTGGGGTCCCTGCAGCAGGTGGG + Exonic
1161854388 19:6754933-6754955 CTGGGGGCCCAGCAGGCAGGAGG + Exonic
1161968272 19:7561121-7561143 CAGGGGACCCCCCAAGAGGGAGG + Intronic
1162146009 19:8612325-8612347 GTGGGGAGCAAACAGGAGGGTGG - Intergenic
1162464660 19:10832542-10832564 GTGGGGCCCCTGCAGGAGAGGGG + Exonic
1162917712 19:13883171-13883193 GTGAGGACCCAGCAGCAGTGAGG + Intronic
1162936044 19:13982074-13982096 CTCGGGAGACAGCAGGGGGGAGG + Intronic
1162956765 19:14103067-14103089 CTGAGGACACAGCATCAGGGAGG + Intronic
1163303355 19:16461995-16462017 CTGGGAACCCAGCAGGGAGCAGG + Intronic
1163393681 19:17046169-17046191 CTGGGACCCCAGCAGGTGGGGGG - Intergenic
1163587855 19:18173645-18173667 CTGGGGACCCAGCACCTGGCAGG + Exonic
1163659727 19:18569451-18569473 CTGGGGGCCCTGCTGGAGGGAGG + Intergenic
1163759867 19:19130364-19130386 CTGGGGTCCCAGACGGAGTGTGG - Intronic
1164717929 19:30407075-30407097 CTGGGGTCACAGCAGGTGGCTGG + Intronic
1165076315 19:33281668-33281690 CTGGGGAGGCAGCAGGAGCCCGG + Intergenic
1165148643 19:33748521-33748543 CTGGGGTCCCAGCTGGGGAGGGG + Intronic
1165319563 19:35076888-35076910 CTGGGGACCCAGGTGGCAGGAGG - Intergenic
1165386558 19:35513591-35513613 CTGCAGACCCAGAGGGAGGGAGG - Exonic
1165595477 19:37008784-37008806 CGGGAGACACAGCAAGAGGGAGG - Intronic
1165855683 19:38878330-38878352 CTGAGGCCCCAGAAAGAGGGAGG - Intergenic
1166343301 19:42151133-42151155 CTGGGGACCCAGATGGGAGGAGG + Intronic
1166384990 19:42375874-42375896 CTGGGGATCCAGGAGGAGCAGGG + Exonic
1166541831 19:43610843-43610865 CTGGGGACCCAGCAGGAGGGTGG - Intronic
1166853387 19:45770860-45770882 CTGGGCCCACGGCAGGAGGGCGG - Intronic
1167042653 19:47031911-47031933 CTGAGAGCCCAGCAGGAGGCAGG + Intronic
1167366756 19:49058556-49058578 CTGGGGACCCAGAAAGATGGGGG - Exonic
1167445558 19:49535096-49535118 CTGGGGGCCCAGGAGGGGGAGGG - Intronic
1168277978 19:55287518-55287540 CTGGGGACACGGTAGGAGGATGG - Intronic
1168288827 19:55347308-55347330 CTGGGGTCCCAGCAGGGGCTGGG - Exonic
1168307498 19:55443314-55443336 CAGGGGAGGCAGCTGGAGGGAGG + Intergenic
1168309397 19:55452898-55452920 CGGGGTCCCCAGCAGGTGGGGGG - Intergenic
1168351426 19:55678340-55678362 CAGGGGCCCCAGCAGGAAGGAGG + Intronic
1168353597 19:55689451-55689473 CTTCGGGCCCAGCAGGATGGTGG - Intronic
925169172 2:1740489-1740511 CTGGGGGGCCTGCAGGCGGGAGG + Intronic
925182625 2:1827000-1827022 CTGGGGCACCAGCAGGGGTGGGG - Intronic
925221392 2:2144217-2144239 CTGAGGGCAGAGCAGGAGGGAGG - Intronic
925271213 2:2608819-2608841 CTGGGGACCCAGGAGAATGGCGG + Intergenic
925367106 2:3318050-3318072 CCTGGGACCCAGCAGGAAGCAGG - Intronic
925691266 2:6525717-6525739 CTGGGGACCCAGCAGGTTTAGGG - Intergenic
925959657 2:9003449-9003471 CCGGGGGCCCGGGAGGAGGGTGG - Intronic
926005873 2:9373185-9373207 CTGGAGCCGGAGCAGGAGGGAGG + Intronic
926581695 2:14636568-14636590 CTGGGGCCGCAGCTGGAGGGAGG - Exonic
927518940 2:23687821-23687843 CAGGGGACGCGGCTGGAGGGAGG + Intronic
927704443 2:25288324-25288346 CTGGGGAGGCAGCAGGAGAATGG + Intronic
927937746 2:27085085-27085107 CTGGGGATCCAGCAGGGGAAGGG + Intronic
929054690 2:37865841-37865863 CTGGGGCCCCAGCTGGAGGGAGG + Intergenic
929470748 2:42190263-42190285 GGGGGGACTCAGCAGGAGGAGGG - Intronic
929906411 2:46050076-46050098 CTGGGGACCAGGCAGCAGGGCGG - Intronic
929929256 2:46239477-46239499 CTGGGGCTTCAGGAGGAGGGAGG - Intergenic
930277120 2:49324708-49324730 CTGGGGACTCCAAAGGAGGGAGG + Intergenic
932343716 2:70982347-70982369 CTGGCTCCTCAGCAGGAGGGTGG + Intronic
932729648 2:74209671-74209693 CTGTAATCCCAGCAGGAGGGAGG - Intronic
932740297 2:74285894-74285916 CTGGGGACCCTGCAAAAGAGGGG + Exonic
933141438 2:78795743-78795765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
933709381 2:85314483-85314505 CTCAGGACTCAGCTGGAGGGAGG - Intergenic
933721179 2:85398648-85398670 CCTGGGACCCGGCAGCAGGGAGG - Intronic
934579585 2:95427592-95427614 CTGGAGACCCAGCCGCTGGGAGG + Intergenic
934599859 2:95649133-95649155 CTGGAGACCCAGCCGCTGGGAGG - Intergenic
934704952 2:96470823-96470845 CTTGGGCCCCTGCAGGCGGGAGG + Intergenic
934854321 2:97719424-97719446 GTGGGGCTCAAGCAGGAGGGAGG + Intronic
934949638 2:98567489-98567511 CTGGAGCCCCAGCAGGGAGGTGG + Intronic
936159402 2:110072214-110072236 CTGGGGAGCCCGCTGGAGGCGGG - Intergenic
936185259 2:110299118-110299140 CTGGGGAGCCCGCTGGAGGCGGG + Intergenic
936533204 2:113291137-113291159 CTGGAGACCCAGCCGCTGGGAGG - Intergenic
937227937 2:120380449-120380471 CTGGGGGCCCTGCAGGATGCTGG - Intergenic
937291458 2:120784661-120784683 CTGGGGGGCGAGCAGGAGGCAGG - Intronic
937439490 2:121904078-121904100 TGTGGGACCCAGCAGGATGGTGG + Intergenic
937439738 2:121905693-121905715 TGCGGGACCCAGCAGGATGGTGG + Intergenic
937858682 2:126691360-126691382 CTGGAGTCCCAGCAGAAGTGAGG + Intronic
937859182 2:126694945-126694967 CTGGAGTCCCAGCAGAAGTGAGG + Intronic
937904308 2:127045447-127045469 CCGGGGAGCTGGCAGGAGGGCGG + Intergenic
937904528 2:127046391-127046413 CTGCGGATCCAGAGGGAGGGAGG - Intergenic
937912362 2:127081789-127081811 CTGGGGTCTCAGCAGCTGGGTGG - Intronic
938021144 2:127906626-127906648 CTGGGGACCCCGCTTGTGGGTGG + Intergenic
938105691 2:128528451-128528473 CAAGGATCCCAGCAGGAGGGAGG - Intergenic
938240910 2:129741733-129741755 CTGGGGAACAGGCAGGAGGAAGG - Intergenic
938246246 2:129780024-129780046 CTGGGGAGCCTGAATGAGGGTGG - Intergenic
938291017 2:130150578-130150600 CTGGGGCACAAGGAGGAGGGAGG - Intergenic
938381294 2:130837699-130837721 CAGGTGAGCCAGCGGGAGGGCGG + Intronic
938465527 2:131522378-131522400 CTGGGGCACAAGGAGGAGGGAGG + Intergenic
939639986 2:144628598-144628620 CTGGTGACCCAGGAAGAGTGAGG - Intergenic
940618764 2:156084232-156084254 ATAGGGATCCATCAGGAGGGAGG - Intergenic
941547323 2:166868252-166868274 CTGGCCACACAGCAGGAGAGCGG + Intergenic
941574698 2:167215595-167215617 CTGGGGACCCAGGAGCTGAGAGG - Intronic
942166303 2:173244118-173244140 CTGGAGACGCAGCAAGTGGGAGG + Intronic
942640819 2:178059124-178059146 CTGAGAACCCATCAGGAGGCTGG - Intronic
943129887 2:183841720-183841742 CTGGGGAAGCAGAAGCAGGGTGG + Intergenic
944665543 2:201956094-201956116 ATGGTGGCCAAGCAGGAGGGAGG + Intergenic
945026854 2:205627921-205627943 CTGGGAAGCCTGCAAGAGGGAGG + Intergenic
945169801 2:206983548-206983570 ATGGGGACTCAGCAGAAGGCAGG + Intergenic
946210469 2:218143535-218143557 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
946327188 2:218990783-218990805 ATGGGGACCAAGGAAGAGGGTGG - Intronic
946395854 2:219443325-219443347 GAGAGGACCCAGCAGAAGGGAGG + Intronic
946416985 2:219544632-219544654 CTGGGTCCCCACCAGGATGGGGG - Intronic
946602889 2:221371467-221371489 CTGGCGACGGAGCAGGAGGAAGG - Intergenic
947808259 2:232983172-232983194 TTGGGGAGCCAGCAGTGGGGAGG + Intronic
947855259 2:233319637-233319659 CAGGGCACCCAGGAGGAAGGTGG - Intronic
947982909 2:234425537-234425559 CTGGGGACACAGCACGGGTGAGG + Intergenic
948029031 2:234801293-234801315 CTGGGGAACCAGCAGCCGGGTGG + Intergenic
948384328 2:237572202-237572224 GTGGGGACCCAGCTTGCGGGCGG - Intergenic
948567093 2:238894199-238894221 CTGGGAACCCCGGAAGAGGGTGG - Intronic
948588484 2:239035586-239035608 CGGGGGAGCCCGCAGGAGAGCGG - Intergenic
948669693 2:239559873-239559895 CTGGGGTCACAGCAGGACAGTGG + Intergenic
1169064401 20:2686182-2686204 CTGGGGAGGTAGGAGGAGGGTGG - Intergenic
1169373018 20:5043179-5043201 CTGGGGAGCCAGAAGGAAGCTGG - Intergenic
1170552331 20:17488730-17488752 CTGGGGACCCTTCAAGAGAGCGG - Intergenic
1170882900 20:20313214-20313236 GTGAGGACACAGCAGGAAGGTGG + Intronic
1170941193 20:20849226-20849248 CTGGGGCCCATGCAGCAGGGGGG + Intergenic
1172204961 20:33156805-33156827 CTGGGCACCAGGCAGGAGGCAGG + Intergenic
1172501970 20:35434009-35434031 GTGGGCACACAGCAGGTGGGTGG + Exonic
1174103870 20:48148342-48148364 CTGGGGACCCTGCAGGCAGCAGG - Intergenic
1174295812 20:49544265-49544287 GCCGGGCCCCAGCAGGAGGGTGG + Intronic
1174425737 20:50430585-50430607 CTGGTGCCCCAGGAGGTGGGAGG + Intergenic
1175116407 20:56685741-56685763 CTGAGGAGCAAGCAGGAGGCTGG - Intergenic
1175227783 20:57454905-57454927 CTGGGGATTCTGCAGGAGGCTGG + Intergenic
1175553373 20:59831279-59831301 CTGGGGAGCCAGGAAGAGGCTGG - Intronic
1175643380 20:60649946-60649968 CCGGGGGCCCAGCAAGAGGCAGG - Intergenic
1175774147 20:61642307-61642329 ATGGGGAACCAGCAGGTGGATGG + Intronic
1175774159 20:61642344-61642366 ATGGGGAACCAGCAGGTGGGTGG + Intronic
1175829058 20:61952177-61952199 CGAGGGGCCCAGCAGCAGGGAGG - Intergenic
1175990589 20:62786572-62786594 CTGGGCTCCCAGCAGGGTGGGGG - Intergenic
1176039203 20:63055686-63055708 CTGGGGCCCCAGGAGGGCGGAGG - Intergenic
1176052114 20:63125342-63125364 TGGGGCTCCCAGCAGGAGGGAGG + Intergenic
1176112123 20:63415540-63415562 CTGAGCACCCGGCGGGAGGGAGG + Intronic
1176190072 20:63804294-63804316 CTGGGCACCCAGGAGGGGGCCGG + Intronic
1178884600 21:36475380-36475402 CTGCGGCTACAGCAGGAGGGTGG - Intronic
1178909650 21:36664287-36664309 CTGGAGAAGCAGCAGGAGTGAGG + Intergenic
1179008030 21:37531645-37531667 AGGGGGGCCCAGCTGGAGGGAGG - Intergenic
1179642687 21:42757731-42757753 ATGAGGACCCAGCAAGAAGGCGG - Intronic
1179644185 21:42765668-42765690 AGGAGGACCCATCAGGAGGGAGG - Intronic
1179926748 21:44539079-44539101 CAGGGGACCTAGCAGGCAGGTGG + Exonic
1179932461 21:44579553-44579575 CAGGGGACCCAACAGGCAGGTGG + Exonic
1179937159 21:44613083-44613105 CAGGGGACCCAGCAGGCAGGTGG - Intronic
1179973155 21:44847474-44847496 CTGAGAAGGCAGCAGGAGGGTGG - Intergenic
1179994090 21:44966030-44966052 CTGAGGACCCAGAGGAAGGGTGG + Intronic
1180087422 21:45514259-45514281 CTGGGGACCCTGCTTGGGGGGGG - Exonic
1180499999 22:15922412-15922434 CAGAGGACACAGAAGGAGGGAGG - Intergenic
1181236031 22:21448172-21448194 CAGGGGAACCATGAGGAGGGTGG + Exonic
1181335761 22:22126419-22126441 CTCAGGAGCCAGCAGGAGGTGGG - Intergenic
1181535075 22:23537620-23537642 CTGGGGACCCAGAGAGAAGGAGG + Intergenic
1182052213 22:27322094-27322116 GTGAGGACCCAGCAAGAAGGTGG - Intergenic
1182426870 22:30278247-30278269 CTGGAGAGCCAGCAGGGTGGGGG + Intergenic
1183041046 22:35178270-35178292 CTGGGGACACGGCAGTAGAGGGG - Intergenic
1183173407 22:36204430-36204452 TTAAGGGCCCAGCAGGAGGGAGG + Intronic
1183212644 22:36460335-36460357 GTGAGGACCCAGCAAGAAGGTGG + Intergenic
1183269454 22:36851518-36851540 CTGGGGCCCGGGCTGGAGGGAGG + Intergenic
1183589082 22:38769546-38769568 CTGGGGACCCAGGATCAGTGAGG - Intronic
1183663704 22:39235516-39235538 GTGGGGTGCCAGGAGGAGGGAGG - Intronic
1183716731 22:39537617-39537639 CTGGGGACCTGGCAGGACTGGGG - Intergenic
1184091997 22:42297772-42297794 CAGGGGCCCCAGCTGGTGGGGGG - Intronic
1184242767 22:43220151-43220173 CCCGGGTCCCAGCAGGAGTGTGG + Intronic
1184430689 22:44440167-44440189 CTGGGGACCAGGCAAGAGGCTGG + Intergenic
1184728889 22:46362416-46362438 CTGGGGACCCAGGGGGCCGGCGG + Exonic
1184751520 22:46489062-46489084 CTGGGTGACCAGCAGGAAGGTGG - Intronic
1184811021 22:46832099-46832121 GTGGGGGCCCAGCAAGAGGCTGG + Intronic
1185050893 22:48553466-48553488 CTGGACACCCAGGAGGAGGATGG + Intronic
1185173451 22:49306290-49306312 CTGGGGATTAGGCAGGAGGGAGG + Intergenic
1185199379 22:49492206-49492228 CTGGGGAGGTAGGAGGAGGGCGG - Intronic
949500096 3:4671590-4671612 CTGGGGACCGTGGAGGTGGGTGG - Intronic
949824799 3:8154263-8154285 CTTGGGACCCAGGATGAGGTTGG - Intergenic
950011908 3:9729956-9729978 CTGGGGCCACATCAAGAGGGAGG + Intergenic
950193205 3:10992307-10992329 CTGGTGACCCAGGATGAGGCCGG + Intergenic
950885579 3:16359563-16359585 GTGAGGACACAGCAGGAAGGTGG + Intronic
952097274 3:29968443-29968465 ACAGGGATCCAGCAGGAGGGTGG - Intronic
953383672 3:42492708-42492730 CTGGGGACCCAGGAGGAGAAGGG + Intronic
953878952 3:46681766-46681788 CTCGGGACCAGGCTGGAGGGAGG - Intronic
953933225 3:47017500-47017522 CTGGGGACCCAGGAACGGGGAGG - Intronic
954035382 3:47848414-47848436 CTGGGGACCAGGCAGGTGGGAGG + Intronic
954149816 3:48651791-48651813 CTGGGGAACCTGAAGGAGGCAGG - Intronic
954379046 3:50210009-50210031 CTAGGGACAAAGCAGGTGGGAGG - Intronic
954580867 3:51702348-51702370 CTGGGGCCTCAGCAAGAGGAGGG + Intronic
954760381 3:52869540-52869562 TTGGGGACCCAGGAGAAGGGAGG - Intronic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
958952314 3:100429789-100429811 CTGGGGCCACAGCTGGAGAGAGG + Exonic
958977463 3:100683207-100683229 CTAGGGACCCACCAGAACGGCGG + Intronic
960558822 3:119059397-119059419 CTGGGGACTCAGGGGAAGGGTGG + Intronic
960965682 3:123103129-123103151 CTGGGCATCCAGCCTGAGGGTGG - Intronic
961035309 3:123637885-123637907 CTGGGAGCCCAGGAGCAGGGTGG + Intronic
961359567 3:126358295-126358317 CTGAGGATCCAGCTGGAGTGTGG - Intergenic
961651155 3:128417312-128417334 CTGGAGACCTAGGAGGAGTGGGG - Intergenic
961805296 3:129485004-129485026 GTGGGGACCAGGCAGGAGGGAGG - Intronic
961821292 3:129577028-129577050 CTGGGACCCCAGAAGCAGGGAGG - Intronic
962139223 3:132771159-132771181 CTGGGGTCCAAGGAGGAGGGAGG + Intergenic
962342737 3:134598757-134598779 CTGGGGACCCAGGAGGAGTTGGG + Intronic
962423569 3:135249458-135249480 CTGGGTGACCAGCTGGAGGGAGG - Exonic
963941631 3:151101686-151101708 CTGGAGCCCCAGCAGGTTGGGGG + Intronic
967837181 3:193974626-193974648 GTGAGGACCCGACAGGAGGGAGG + Intergenic
968048119 3:195635366-195635388 CTGGGGACCCGGCAGGTGACGGG - Intergenic
968088368 3:195884932-195884954 CTGGGGGCCCAGCAGGGGAGGGG - Exonic
968099283 3:195954254-195954276 CTGGGGACCCGGCAGGTGACGGG + Intergenic
968306492 3:197654555-197654577 CTGGGGACCCGGCAGGTGACGGG + Intergenic
968331965 3:197878524-197878546 CTGGTGACGGAGAAGGAGGGAGG - Intronic
968502137 4:955732-955754 CTGGGGACACGCCAGGAGGGTGG - Intronic
968513306 4:1004640-1004662 ATGAGGACCCAGCTGGAGCGAGG + Intergenic
968520369 4:1032301-1032323 CTGGGGCCCAAGCAGGCTGGTGG - Intergenic
968582233 4:1400484-1400506 CTGGGGACCCAGTAGGAGTGTGG + Intergenic
968621347 4:1604729-1604751 CTGGGGAAGCAGGAGGAGGCGGG - Intergenic
968999754 4:3970634-3970656 TTGGGGCCCCAGCAGGCTGGAGG - Intergenic
969308432 4:6338710-6338732 CTAGGGGCCCAGCAGGAAGGGGG - Intronic
971676425 4:29635354-29635376 CTGGAGACCCAGAAGGATGAGGG + Intergenic
975528191 4:75373947-75373969 CTGAGGACACAGCTAGAGGGAGG + Intergenic
976080609 4:81350969-81350991 CTGGGAACCCAGCATAAAGGTGG - Intergenic
976080708 4:81351750-81351772 CTGGGGCTACAGCAGGTGGGAGG - Intergenic
977082040 4:92542616-92542638 CTGGGGACTCGGTGGGAGGGTGG + Intronic
977974549 4:103249023-103249045 CTGGAGACTCAGAAGCAGGGAGG - Intergenic
978116239 4:105023041-105023063 CTCGGGACCCACCAGGAGCCTGG + Intergenic
978404477 4:108364724-108364746 ATGGGGAAGCAGGAGGAGGGTGG - Intergenic
979518460 4:121638745-121638767 CTGGGCAAGCAGCAGGAGGCTGG - Intergenic
980242984 4:130201782-130201804 TCAGGGACCCAGCAGGAGGCAGG + Intergenic
981574860 4:146193903-146193925 CTGGGGGCCCAGGCCGAGGGAGG + Intronic
983389969 4:167117641-167117663 CTGGGGGCAGAGCAGCAGGGTGG + Intronic
984758217 4:183343004-183343026 CTGCCGGCCCTGCAGGAGGGAGG - Intergenic
985785204 5:1889713-1889735 CTGGAAACTCAGCAGGAGGGTGG - Intergenic
985963800 5:3324626-3324648 CTGGGATCACAGTAGGAGGGAGG - Intergenic
986786025 5:11114536-11114558 TTGGGATCCTAGCAGGAGGGTGG + Intronic
986843337 5:11723687-11723709 CTGGTGACCCAACAGTAAGGAGG + Intronic
988861223 5:35281992-35282014 CTGGAGAGTCAGCAGGAGGAGGG + Intergenic
989812597 5:45695957-45695979 CTGGGCACCCCGCCGGGGGGCGG - Exonic
990591616 5:57271176-57271198 CTGGTGACACAGCAGGAGCCAGG + Intergenic
992443974 5:76818624-76818646 CGGTGGACCCTGCAGGAGGAGGG - Intergenic
992748784 5:79843230-79843252 CTGGGGACCCAGCAGCAGCAAGG + Intergenic
992904619 5:81334108-81334130 ATGGGGAGCCAGAAGGAGGATGG - Intronic
994016738 5:94975429-94975451 CTGAGCACACAGCAGGAAGGTGG + Intronic
996417699 5:123227971-123227993 CTGGGGACCCAGTGGGAGTGGGG - Intergenic
997255928 5:132427955-132427977 CCTGGCACCCAGCAGGAGGCAGG - Intronic
997634883 5:135398184-135398206 CTGTGGCCCCTGCAGGAGTGGGG + Intronic
997648605 5:135498347-135498369 GTGAGCACCCAGCACGAGGGAGG - Intergenic
998025837 5:138815479-138815501 CAGGGCACCCAGCAGGAAAGAGG - Intronic
998069105 5:139182777-139182799 CTGAGGACACAGGAGCAGGGGGG + Intronic
998182706 5:139956498-139956520 CTGGGGACCCTGGAGGATGCTGG - Intronic
998396185 5:141819849-141819871 CTGGGGCCCCAGGAGGAGAGGGG - Intergenic
999328718 5:150658903-150658925 CAAGGGACCCAGCAGCAGGTAGG - Intronic
999449462 5:151667382-151667404 CTGGGCCCCCAGCTGCAGGGCGG - Intronic
999685161 5:154096214-154096236 ATGGTGACTCAGCAGGAGGCAGG - Intronic
1000318922 5:160118760-160118782 CTGGGGACCCAGCGGACCGGAGG + Intronic
1001164477 5:169351087-169351109 CTGGGGAGCCAGTAGGAGCGAGG + Intergenic
1001541448 5:172542704-172542726 CCGGGGCGCCAGCAGGATGGTGG - Intergenic
1001895345 5:175374601-175374623 TTGGAGACTCAGAAGGAGGGAGG - Intergenic
1002061467 5:176628290-176628312 CTGGGGAGGAGGCAGGAGGGAGG + Intronic
1002352019 5:178590027-178590049 CTGGACACCCAGCAGCAGGCAGG + Exonic
1002593548 5:180307101-180307123 CTGAGGAGCCAGCGGGAAGGAGG - Intronic
1002639053 5:180621999-180622021 CTGGGGCCCCTCCAGGAGAGAGG - Intronic
1002761507 6:205988-206010 CAGGTGACTCAGCAGGAGGCTGG - Intergenic
1002900729 6:1407705-1407727 CTGGGGACCCTGCAGGGCTGTGG - Intergenic
1002905736 6:1447590-1447612 CTGGAGACTCAGAAGGGGGGAGG - Intergenic
1003311191 6:4971215-4971237 GTGAGGACACAGCAGGAAGGTGG - Intergenic
1004288929 6:14348971-14348993 GTGAGGACACAGCAGGAAGGCGG - Intergenic
1004811483 6:19268892-19268914 CTGGGCTCCCAGCAGGTAGGTGG - Intergenic
1006021754 6:31121522-31121544 CAGGGGCCAGAGCAGGAGGGAGG - Intronic
1006028026 6:31159599-31159621 CTGCGGCCCCAGCAGGAGCCTGG + Exonic
1006083699 6:31581743-31581765 CTGGGGACGCAGCAGGGAGCTGG + Intronic
1006144475 6:31950263-31950285 CTGGGGACACAACAGTAGAGAGG - Intronic
1006305160 6:33214187-33214209 CTGGGGACCCGGGAGGGGGCAGG - Intergenic
1006375753 6:33670916-33670938 CTGGGGACACAGAAGGAAGTGGG - Intronic
1006443372 6:34065602-34065624 CTGGGGTCCTGGCAGGAGGCTGG - Intronic
1006505481 6:34486178-34486200 CTGGGAACCCAGGGAGAGGGAGG + Intronic
1006558603 6:34889647-34889669 CTGGGGACCCAAGAGACGGGTGG - Intronic
1006747933 6:36357997-36358019 CTGGGGACCCAGGCTGATGGAGG - Intronic
1007428545 6:41762894-41762916 CTGGGGACAGAGCAGCAAGGAGG - Intergenic
1007726214 6:43917406-43917428 CTGGGGACCGGGCAGGGGGTGGG - Intergenic
1007764665 6:44153550-44153572 CTGGGGCCCGGGCAGGAGGAGGG + Intronic
1007796052 6:44348587-44348609 CTGTGGGCCCAGCAGCAGGTAGG + Intronic
1007994843 6:46295834-46295856 TTGGGGAAGCAGCAGGAGGGAGG + Intronic
1010028374 6:71245743-71245765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
1010165183 6:72906496-72906518 ATGGGGACCCTTCAGGAAGGAGG - Intronic
1010516147 6:76774071-76774093 CTAGGAACCCACCAGGAGGTGGG + Intergenic
1011824760 6:91292830-91292852 GTGAGGACCCAGCAAGAAGGAGG - Intergenic
1013300870 6:108803868-108803890 CTGGTGACCCAGCAAGAGCAAGG + Intergenic
1013911655 6:115282680-115282702 CTGAGGCCCCAGAGGGAGGGTGG - Intergenic
1014088969 6:117381394-117381416 TTGGAGACTCAGAAGGAGGGAGG - Intronic
1014538408 6:122645499-122645521 ATGGTGTCCCAGCAGGTGGGTGG + Intronic
1015928719 6:138335197-138335219 CTGTGGCCACAGCAGGTGGGCGG + Intronic
1017819430 6:158038716-158038738 ATGGGGGCGCAGCAGGAGTGGGG + Intronic
1018393526 6:163359294-163359316 CTGCGGACACAGGATGAGGGAGG + Intergenic
1018606790 6:165606029-165606051 CTGGGCACGCAGCAGGTGCGTGG + Intronic
1018750456 6:166799910-166799932 CTGGGGACTTGGCAGAAGGGTGG - Intronic
1018799677 6:167212307-167212329 CTTGGGACCCAGAAGGTGGCTGG + Intergenic
1018813288 6:167313186-167313208 TTGGGGACCCAGAAGGTGGCTGG - Intronic
1019074137 6:169373450-169373472 CTGGGGACCCAGGGGGAGCGTGG + Intergenic
1019127424 6:169850100-169850122 GTGGGGACACAGCTGGAGGCAGG - Intergenic
1019660186 7:2219775-2219797 CTGGAGCACCAGGAGGAGGGTGG - Intronic
1019905278 7:4057556-4057578 CAGGGGGCCAAGCAGGTGGGTGG - Intronic
1022652766 7:32292734-32292756 CTTGGAACACAGCAGGAGGAGGG - Intronic
1023022143 7:36019831-36019853 CTGGGGACCCAGGAGAAGTAAGG - Intergenic
1023181883 7:37492739-37492761 CTGGGAACCCACTGGGAGGGAGG + Intergenic
1023507685 7:40917760-40917782 CTGAGGACCCAGCAAGAAGGTGG - Intergenic
1023625782 7:42113865-42113887 CTTGGCTCCCAGGAGGAGGGGGG + Intronic
1023872910 7:44272345-44272367 CTGGGTGCCCAGGAGGAGAGGGG - Intronic
1023895646 7:44430933-44430955 CTGAGGACACGGCAGGAGGATGG - Intronic
1024558981 7:50627928-50627950 CTGGGAGCCCAGCGGGTGGGTGG - Intronic
1024932683 7:54680391-54680413 CTGGGGACACAGAAGGTGGTGGG - Intergenic
1025199856 7:56955474-56955496 CTGGGGAGGCAGAAGGAGAGGGG + Intergenic
1025672090 7:63621458-63621480 CTGGGGAGGCAGAAGGAGAGGGG - Intergenic
1026116793 7:67502599-67502621 ATGAGGACACAGCAGGAAGGTGG - Intergenic
1026313925 7:69211683-69211705 ATGGGGAGCCAGAAGGAGGGTGG - Intergenic
1026742941 7:72990331-72990353 CTGGGAGCCCAGAAGGTGGGGGG + Intergenic
1027100794 7:75374747-75374769 CTGGGAGCCCAGAAGGTGGGGGG - Intergenic
1027175267 7:75899290-75899312 ATGGGGACAGAGCAGGATGGGGG + Intronic
1027295301 7:76763784-76763806 ATAGGGATCCATCAGGAGGGTGG + Intergenic
1029118726 7:98252198-98252220 CCGGGGACCGGGCAAGAGGGTGG + Exonic
1029253118 7:99250973-99250995 CTGGGAACCCAGGAGGAGAATGG - Intergenic
1029637363 7:101793944-101793966 CTGGGGAGCAGGGAGGAGGGAGG + Intergenic
1030401495 7:109057235-109057257 CTGGAGACTCAGAAGGAGAGAGG - Intergenic
1031232308 7:119123647-119123669 ATGGGGAGCCAGCAGGGGGATGG - Intergenic
1032072743 7:128818978-128819000 CTGGGGAGGGAGCAGGAGGAAGG - Intronic
1032762453 7:134956506-134956528 ATGAGGACACAGCAGGAAGGTGG + Intronic
1032781806 7:135170194-135170216 CTTGGGGCCCAGAAGTAGGGCGG - Intronic
1032794660 7:135268190-135268212 CAGTGGACCCAGGAGGAAGGAGG - Intergenic
1033984362 7:147205243-147205265 CTGGAGACTTAGAAGGAGGGAGG - Intronic
1034217886 7:149422061-149422083 CTTGGGTCCCAGAAGGAGAGGGG - Intergenic
1034556161 7:151851749-151851771 AGGGGGACCCATGAGGAGGGAGG - Intronic
1034567718 7:151928949-151928971 CTGGGGCCCCATCAGGTGGAGGG + Intergenic
1034931301 7:155166005-155166027 CTGGGGAGCCAGAAGGGGGATGG - Intergenic
1035457246 7:159016592-159016614 CAGGGTGCCAAGCAGGAGGGTGG - Intergenic
1035569981 8:666514-666536 GAGGGGCCCCAGCAGGAAGGTGG - Intronic
1035589503 8:802149-802171 CAGAGGACCCAGGAGGAGTGCGG - Intergenic
1035589555 8:802329-802351 GGGGGGACCCAGGAGGAGCGCGG - Intergenic
1035705086 8:1669253-1669275 CTGGGGGCCCAGATGGACGGCGG - Intronic
1035743441 8:1945487-1945509 CTGGAGGCCCACCAGGAGGAAGG + Exonic
1035784643 8:2250992-2251014 CTGGGGAACCTGCAGAAGGTTGG + Intergenic
1035808164 8:2470721-2470743 CTGGGGAACCTGCAGAAGGTTGG - Intergenic
1035892500 8:3360483-3360505 CTGGGGAAACAGCAAGAAGGAGG - Intronic
1037893205 8:22635040-22635062 CAGGAGAGGCAGCAGGAGGGTGG - Intronic
1037916047 8:22774056-22774078 CTGTGAAACCAGCAGGAGGGAGG - Intronic
1038004136 8:23415924-23415946 CTGGGGCTCCTGCAGGAGGAAGG - Intronic
1038307895 8:26421167-26421189 CTGGTGGTCCAGAAGGAGGGTGG + Intronic
1038450278 8:27634802-27634824 GTGGTGAGCCAGCAGCAGGGTGG + Intronic
1039058983 8:33558567-33558589 GTGGGAGTCCAGCAGGAGGGAGG - Intronic
1040372767 8:46794030-46794052 CTGAGGCCCCTGCAGGTGGGAGG - Intergenic
1040458404 8:47622592-47622614 CTGGCGTCCCAGGAGGATGGGGG + Intronic
1041970953 8:63742172-63742194 CTGAGGACACAGCACGAAGGTGG + Intergenic
1042635878 8:70873953-70873975 CTGCTGACTCATCAGGAGGGGGG - Intergenic
1042701319 8:71618165-71618187 CTGCAGACCCTGCAGGACGGAGG - Intergenic
1045045337 8:98269839-98269861 CTGGGAACTCTGGAGGAGGGAGG - Intronic
1045646942 8:104308454-104308476 GTGAGGACACAGCAGGAAGGCGG + Intergenic
1045705728 8:104920375-104920397 CTGGGGTCCCAGAAGGATGTGGG + Intronic
1046260888 8:111766021-111766043 TTGGGGAACCAGAAGGAGAGTGG - Intergenic
1047006085 8:120621864-120621886 CTGGGGATCGGGGAGGAGGGAGG - Intronic
1047019563 8:120760525-120760547 CTGGAGACCCAGCCTGAGAGAGG + Intronic
1047220397 8:122914070-122914092 TTGGGGTTCCAGGAGGAGGGAGG - Intronic
1047727139 8:127693858-127693880 CTTAGGGGCCAGCAGGAGGGTGG - Intergenic
1048968304 8:139629728-139629750 CTGGGGACACAGCAGGAAGGTGG - Intronic
1048982864 8:139712472-139712494 CTGGGGACCCAGAAGGTACGTGG - Intergenic
1048988559 8:139748297-139748319 CTGGGGTCAGAGCAGGTGGGAGG + Intronic
1049199877 8:141334805-141334827 CCGGGCACCCAGCAGGAGGCTGG - Intergenic
1049230889 8:141480573-141480595 CTGGGGACTCAAAAGAAGGGAGG - Intergenic
1049305365 8:141899978-141900000 CTCAGGACCCAGCCGCAGGGCGG - Intergenic
1049343945 8:142128579-142128601 CTGGGAAAAGAGCAGGAGGGTGG + Intergenic
1049418694 8:142507286-142507308 CTGTGGAGCCAGGAGGACGGAGG + Intronic
1049420426 8:142513995-142514017 CAGGGGTCCCAGCAGGAGTGAGG + Intronic
1049778645 8:144417601-144417623 CCCAGGACCCAGGAGGAGGGAGG - Intergenic
1050834197 9:10055053-10055075 GTGAGGACCCAGCAAGAAGGTGG + Intronic
1052766896 9:32650669-32650691 TGGAGCACCCAGCAGGAGGGTGG + Intergenic
1053217327 9:36283102-36283124 CTGGGGACCTCGGAGGAGGGAGG - Intronic
1054254542 9:62800297-62800319 CTGGAGTCCCAGCGAGAGGGTGG - Intergenic
1056327355 9:85490915-85490937 ATGGGGAGCCAGAAGGAGGATGG - Intergenic
1056574319 9:87843338-87843360 CTGTGGCCCCAGGAGGTGGGTGG - Intergenic
1056658931 9:88530843-88530865 CTGGGGGCCCAGGTGGTGGGGGG - Intergenic
1056731061 9:89167104-89167126 CTGGGGGTCCAGCAGGAGGGAGG + Intronic
1056753605 9:89368587-89368609 CAGGGGCCCCAAGAGGAGGGAGG + Intronic
1056906142 9:90649547-90649569 ATGAGGACACAGCAGGAAGGTGG + Intergenic
1057488761 9:95506600-95506622 CTGGGGACGAAGCAGAAGGGAGG + Intronic
1058176216 9:101738515-101738537 TGGGGGAGCCTGCAGGAGGGTGG - Exonic
1058483161 9:105417399-105417421 CTGAAGACCAAGCAGGAGGGAGG - Intronic
1058560966 9:106228852-106228874 CAGGGGAGCCAGCAGAAAGGAGG - Intergenic
1059296118 9:113272294-113272316 CTGTGGTCCCAGCACGCGGGAGG + Intronic
1059451327 9:114372952-114372974 GTGGGGACGCAGCGGGGGGGGGG + Intronic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1060034112 9:120240368-120240390 CTGAAGAGCCAGCAGGAGGGGGG + Intergenic
1060111468 9:120909798-120909820 TTGGGGACCCAGCAAGAATGAGG + Intronic
1060135597 9:121150372-121150394 TGGGGGCCCCAGCAGGAGGTGGG - Exonic
1060472206 9:123957437-123957459 GTGGGGAGTCAGCAGGATGGCGG - Intergenic
1060986857 9:127825054-127825076 GTGGGGACACAGCAGGACCGAGG - Intronic
1061249062 9:129415999-129416021 CTGGGGACACAGCTGGAAGATGG + Intergenic
1061506043 9:131032340-131032362 CAGGGGACCCGGCAGGAGGTGGG - Intronic
1061908682 9:133711711-133711733 CTGGGGAGGCAGTAGGTGGGTGG - Intronic
1062005457 9:134236479-134236501 CTGGGGCCTCAGCTGGAGGAGGG + Intergenic
1062075887 9:134589816-134589838 CTGAGGAGACAGCAGGAGGTGGG - Intergenic
1062556648 9:137115865-137115887 CCGGGGCCCCCGCAGGACGGGGG + Intergenic
1062610059 9:137369552-137369574 CTGGGGACACAGCAAGGGGCAGG + Intronic
1062725189 9:138069015-138069037 CTGGACACCCAGCAGGTTGGGGG + Intronic
1185575697 X:1170467-1170489 CTGGGCACACAGCAGGGGAGAGG - Intergenic
1187056230 X:15743748-15743770 CAGGGGATGCAGCAGGAGGTGGG - Intronic
1187877536 X:23816565-23816587 CTGGGGACACAGCAGTGAGGAGG + Intergenic
1188095606 X:26017391-26017413 CTGCAGAGCCAGCAGGAGTGAGG + Intergenic
1188266357 X:28080716-28080738 GTGAGGACACAGCAAGAGGGTGG + Intergenic
1190416351 X:50184032-50184054 CTGGGTGCCCAGTAGGTGGGAGG + Intergenic
1191016237 X:55813310-55813332 CCGGGGAGCCAGCAGGGGGCTGG + Intergenic
1191764488 X:64682365-64682387 CAGGGGACACAGGAGGAAGGGGG + Intergenic
1192098515 X:68239071-68239093 ATGGGGAGCCAGAAGGAGGATGG + Intronic
1192543883 X:71996895-71996917 CTGAGGGCTGAGCAGGAGGGAGG + Intergenic
1193456816 X:81741779-81741801 CTGGGGACCCTGAAGTAGGGAGG - Intergenic
1194077771 X:89417653-89417675 CTAGGAACCCACCAGGAGGGAGG + Intergenic
1195954070 X:110310286-110310308 CTGGGGAACCATGAGGATGGTGG - Intronic
1196001992 X:110795987-110796009 GTGGGGAGCGAGCGGGAGGGCGG - Intergenic
1197698335 X:129575229-129575251 CTTAGAACTCAGCAGGAGGGAGG + Exonic
1197973612 X:132141207-132141229 CTGAGGACTCAGCAAGAAGGTGG + Intergenic
1199617612 X:149670471-149670493 CTGTGGACCCAGCTGGGGAGAGG - Intergenic
1199625031 X:149732778-149732800 CTGTGGACCCAGCTGGGGAGAGG + Intergenic
1200182496 X:154159297-154159319 CTCAGCACCCAGGAGGAGGGAGG + Intergenic
1200188150 X:154196411-154196433 CTCAGCACCCAGGAGGAGGGAGG + Intergenic
1200193800 X:154233551-154233573 CTCAGCACCCAGGAGGAGGGAGG + Intergenic
1200199555 X:154271355-154271377 CTCAGCACCCAGGAGGAGGGAGG + Exonic
1200237096 X:154472921-154472943 CTGGGCACAGGGCAGGAGGGTGG - Exonic
1200247699 X:154534735-154534757 CCGGGGACCCAGCATGAGGCAGG - Intronic
1200430420 Y:3073198-3073220 CTAGGAACCCACCAGGAGGGAGG + Intergenic
1202269704 Y:23060095-23060117 CTGAGGTCCCTGCAGGAGAGAGG - Intergenic
1202422698 Y:24693841-24693863 CTGAGGTCCCTGCAGGAGAGAGG - Intergenic
1202448091 Y:24976245-24976267 CTGAGGTCCCTGCAGGAGAGAGG + Intergenic