ID: 1166543286

View in Genome Browser
Species Human (GRCh38)
Location 19:43619573-43619595
Sequence CCGCTCCGGCTCTGCGGCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 163}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166543268_1166543286 21 Left 1166543268 19:43619529-43619551 CCTCGCGCACCCCTGCCCGGGAC 0: 1
1: 0
2: 2
3: 22
4: 280
Right 1166543286 19:43619573-43619595 CCGCTCCGGCTCTGCGGCGGCGG 0: 1
1: 0
2: 3
3: 15
4: 163
1166543264_1166543286 30 Left 1166543264 19:43619520-43619542 CCCGGCATGCCTCGCGCACCCCT 0: 1
1: 0
2: 1
3: 8
4: 132
Right 1166543286 19:43619573-43619595 CCGCTCCGGCTCTGCGGCGGCGG 0: 1
1: 0
2: 3
3: 15
4: 163
1166543271_1166543286 11 Left 1166543271 19:43619539-43619561 CCCTGCCCGGGACACTCACCGGC 0: 1
1: 0
2: 3
3: 21
4: 159
Right 1166543286 19:43619573-43619595 CCGCTCCGGCTCTGCGGCGGCGG 0: 1
1: 0
2: 3
3: 15
4: 163
1166543273_1166543286 6 Left 1166543273 19:43619544-43619566 CCCGGGACACTCACCGGCGCCGG 0: 1
1: 0
2: 0
3: 10
4: 129
Right 1166543286 19:43619573-43619595 CCGCTCCGGCTCTGCGGCGGCGG 0: 1
1: 0
2: 3
3: 15
4: 163
1166543269_1166543286 12 Left 1166543269 19:43619538-43619560 CCCCTGCCCGGGACACTCACCGG 0: 1
1: 0
2: 1
3: 26
4: 164
Right 1166543286 19:43619573-43619595 CCGCTCCGGCTCTGCGGCGGCGG 0: 1
1: 0
2: 3
3: 15
4: 163
1166543275_1166543286 5 Left 1166543275 19:43619545-43619567 CCGGGACACTCACCGGCGCCGGC 0: 1
1: 0
2: 1
3: 12
4: 93
Right 1166543286 19:43619573-43619595 CCGCTCCGGCTCTGCGGCGGCGG 0: 1
1: 0
2: 3
3: 15
4: 163
1166543265_1166543286 29 Left 1166543265 19:43619521-43619543 CCGGCATGCCTCGCGCACCCCTG 0: 1
1: 0
2: 0
3: 10
4: 166
Right 1166543286 19:43619573-43619595 CCGCTCCGGCTCTGCGGCGGCGG 0: 1
1: 0
2: 3
3: 15
4: 163
1166543277_1166543286 -7 Left 1166543277 19:43619557-43619579 CCGGCGCCGGCGGCCCCCGCTCC 0: 1
1: 0
2: 5
3: 72
4: 622
Right 1166543286 19:43619573-43619595 CCGCTCCGGCTCTGCGGCGGCGG 0: 1
1: 0
2: 3
3: 15
4: 163
1166543272_1166543286 10 Left 1166543272 19:43619540-43619562 CCTGCCCGGGACACTCACCGGCG 0: 1
1: 0
2: 6
3: 16
4: 109
Right 1166543286 19:43619573-43619595 CCGCTCCGGCTCTGCGGCGGCGG 0: 1
1: 0
2: 3
3: 15
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166543286 Original CRISPR CCGCTCCGGCTCTGCGGCGG CGG Exonic