ID: 1166543412

View in Genome Browser
Species Human (GRCh38)
Location 19:43620204-43620226
Sequence CCCCATGCTGGCGGATTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166543401_1166543412 22 Left 1166543401 19:43620159-43620181 CCCTCCCAACCAGGATAAAGGTT No data
Right 1166543412 19:43620204-43620226 CCCCATGCTGGCGGATTCTGTGG No data
1166543405_1166543412 13 Left 1166543405 19:43620168-43620190 CCAGGATAAAGGTTTATTGATCT No data
Right 1166543412 19:43620204-43620226 CCCCATGCTGGCGGATTCTGTGG No data
1166543398_1166543412 29 Left 1166543398 19:43620152-43620174 CCAGGACCCCTCCCAACCAGGAT No data
Right 1166543412 19:43620204-43620226 CCCCATGCTGGCGGATTCTGTGG No data
1166543402_1166543412 21 Left 1166543402 19:43620160-43620182 CCTCCCAACCAGGATAAAGGTTT No data
Right 1166543412 19:43620204-43620226 CCCCATGCTGGCGGATTCTGTGG No data
1166543408_1166543412 -10 Left 1166543408 19:43620191-43620213 CCTAGGTGTCAGGCCCCATGCTG No data
Right 1166543412 19:43620204-43620226 CCCCATGCTGGCGGATTCTGTGG No data
1166543400_1166543412 23 Left 1166543400 19:43620158-43620180 CCCCTCCCAACCAGGATAAAGGT No data
Right 1166543412 19:43620204-43620226 CCCCATGCTGGCGGATTCTGTGG No data
1166543403_1166543412 18 Left 1166543403 19:43620163-43620185 CCCAACCAGGATAAAGGTTTATT No data
Right 1166543412 19:43620204-43620226 CCCCATGCTGGCGGATTCTGTGG No data
1166543404_1166543412 17 Left 1166543404 19:43620164-43620186 CCAACCAGGATAAAGGTTTATTG No data
Right 1166543412 19:43620204-43620226 CCCCATGCTGGCGGATTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166543412 Original CRISPR CCCCATGCTGGCGGATTCTG TGG Intergenic
No off target data available for this crispr