ID: 1166547552

View in Genome Browser
Species Human (GRCh38)
Location 19:43642376-43642398
Sequence CAGGGTACCCTGAAGTAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166547552_1166547559 23 Left 1166547552 19:43642376-43642398 CCATCCTACTTCAGGGTACCCTG No data
Right 1166547559 19:43642422-43642444 GACAGCAAGTGCAACCCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166547552 Original CRISPR CAGGGTACCCTGAAGTAGGA TGG (reversed) Intergenic
No off target data available for this crispr