ID: 1166563672

View in Genome Browser
Species Human (GRCh38)
Location 19:43750164-43750186
Sequence CAAATCATGTAGGACCTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 2, 2: 3, 3: 38, 4: 261}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166563672 Original CRISPR CAAATCATGTAGGACCTGGT AGG (reversed) Intronic
903087286 1:20873138-20873160 CAAATCATGTAGTATCTTTTTGG + Intronic
904039809 1:27577275-27577297 CAAATCATTCAGCTCCTGGTCGG + Intronic
905654396 1:39676783-39676805 CCGATCATGCAGGACCTGGAGGG + Intergenic
906232579 1:44177583-44177605 CAAATCATTTATGACATGCTTGG + Intergenic
906390290 1:45409466-45409488 CAAATCATTTAGGGCCTGATAGG + Intronic
906824068 1:48959864-48959886 CAGATCATGTAGGGCCTTGTAGG + Intronic
908714615 1:67055963-67055985 CACATTATCTAGGACCTTGTAGG - Intergenic
909937032 1:81563881-81563903 CAAAACATTTAGTACCTAGTAGG - Intronic
912179034 1:107195542-107195564 CAAATTATGTAGGGCCTTGTGGG - Intronic
912652425 1:111451180-111451202 CAATTCATGTTGGACCTTCTGGG - Intronic
913286902 1:117234880-117234902 TAGATCATGTAGGGCCTTGTGGG + Intergenic
915113312 1:153578647-153578669 CAAATCATGCAGAGCCTTGTAGG + Intergenic
916184650 1:162119027-162119049 CAAATCATGTGAGAGCTGGATGG + Intronic
916521729 1:165569570-165569592 CACATCATTTAGGGCCTGGTGGG - Intergenic
921647970 1:217642120-217642142 AAAATCAGGTAGTATCTGGTAGG - Intronic
922429080 1:225529220-225529242 CAGATCATGCAGGACCTTGCAGG - Intronic
923046893 1:230362221-230362243 CAAATCAGGTGAGACCTGGCTGG + Intronic
923403237 1:233636139-233636161 CAGATCATGTAGGACCTTATGGG + Intronic
924721502 1:246627274-246627296 AAGATCATGTAGGGCCTTGTAGG - Intronic
1063353574 10:5377567-5377589 CAAATGATGTAGGACCTGTGTGG - Intergenic
1065388918 10:25162134-25162156 CAAATCATGTAGGACTTTATGGG - Intergenic
1068684408 10:59854831-59854853 CAAATCATATAGGACTTTGTCGG - Intronic
1069723329 10:70562892-70562914 CAAATCATGGAGAACCTAGAAGG + Intronic
1070437617 10:76408935-76408957 CAAGGCATTTAGCACCTGGTAGG + Intronic
1071506818 10:86237402-86237424 AAAAGCATGTAGCACCTGGATGG + Intronic
1071986950 10:91061535-91061557 CAGATCATGGGGGACCTTGTAGG - Intergenic
1072010342 10:91298007-91298029 GTAATCCTGTAGGGCCTGGTGGG - Intergenic
1072185410 10:93033061-93033083 CAAATCATGTAAGGCCTTGAGGG + Intronic
1075378230 10:121996938-121996960 CAAATCCTGAAGCTCCTGGTTGG + Intronic
1080931213 11:36813343-36813365 CATATCGTGTAGGGCCTTGTAGG - Intergenic
1082758854 11:57106476-57106498 CAAATCACGTAGGGCCTTGTAGG + Intergenic
1082773124 11:57224242-57224264 CAGGTCATGTAGGACCTTGAAGG - Intergenic
1084440701 11:69171194-69171216 GCAATCATGAAGGACCTGGTGGG - Intergenic
1085063697 11:73472456-73472478 CAAATCATGCAGGGCCTCATAGG + Intronic
1086980735 11:93195664-93195686 CAAATTATGTAGGGTCTTGTAGG - Intronic
1087039576 11:93785224-93785246 CAGATCATGTAGAACCCAGTAGG + Intronic
1090137458 11:124212522-124212544 CAAATCATATAGTACTTGTTGGG + Intergenic
1091427790 12:406502-406524 CAGATCATACAGGACCTTGTCGG + Intronic
1092860118 12:12713029-12713051 CAGATCAGATAGGACCAGGTAGG - Intergenic
1092955421 12:13545011-13545033 CAAGTCAGGTAGGGCCTTGTAGG - Exonic
1093439619 12:19178930-19178952 GAAATCATGTATGTCCTAGTTGG + Intronic
1093585142 12:20826606-20826628 CAAATCATGTATGATATGCTTGG + Intronic
1093829432 12:23737631-23737653 CAAATCATATAGGGCCTTGCAGG - Intronic
1095580557 12:43792282-43792304 CAAATCATGTAGAAGCTACTGGG + Intergenic
1095909270 12:47409372-47409394 CAGATCATGGAGGGCCTGGAAGG - Intergenic
1096201734 12:49688410-49688432 CAGATTATGTGGGACCTTGTTGG - Intronic
1097657716 12:62388666-62388688 TAAAGCATGTAGGGCCTGGATGG + Intronic
1097682111 12:62658572-62658594 CAAATCATGTAGGATCTTTAGGG + Intronic
1097896526 12:64829104-64829126 CAGATCGTGGAGAACCTGGTGGG + Intronic
1098021015 12:66156668-66156690 TACATCATGTGGGACCTTGTAGG - Intronic
1099346061 12:81501116-81501138 CAAATCATGTAGGACATCATAGG - Intronic
1099496889 12:83359310-83359332 CAGATCATGTAGGATGTTGTAGG + Intergenic
1100016070 12:90012263-90012285 TAAATCATCCAGGACCTTGTTGG - Intergenic
1100321151 12:93494130-93494152 CAAATCATGTAGGTAGTTGTAGG + Intronic
1100321523 12:93497868-93497890 CAAATCATGTAGGTAGTTGTAGG - Intronic
1100505001 12:95211042-95211064 AAAATCATGTTGAACCTGGAAGG - Exonic
1100661290 12:96701804-96701826 CAGATCATGTAAGACCTCATAGG + Intronic
1101650860 12:106675918-106675940 CCAATTAGGCAGGACCTGGTGGG + Intronic
1102370190 12:112376592-112376614 CAAATCAAGTAGATCCTTGTAGG - Intronic
1102552264 12:113700063-113700085 CATGTCATGAGGGACCTGGTGGG + Intergenic
1102749671 12:115281388-115281410 CAAATCAGGTAGGACTTTGTAGG + Intergenic
1107111219 13:36700104-36700126 CAGACTATGTAGGAACTGGTAGG + Intergenic
1108994973 13:56718723-56718745 CAGATCATATATGACCTTGTAGG + Intergenic
1110064765 13:71089386-71089408 CAGATCATGTAGAACCTGGTGGG + Intergenic
1110639217 13:77802530-77802552 AAGATCATGTAGGAGCTTGTAGG + Intergenic
1110913052 13:80987519-80987541 CAAATTCTGTAGGACCTTGCAGG + Intergenic
1111147606 13:84204995-84205017 CAAATAATGTAGGAACTTTTGGG + Intergenic
1113327396 13:109295224-109295246 CAAATCATGTCTTACATGGTTGG + Intergenic
1115732666 14:36287994-36288016 CAGATCATGTAGGGCCCTGTAGG + Intergenic
1117803624 14:59468288-59468310 CAAATCATGCAGTGCCTTGTAGG - Intronic
1117828730 14:59729288-59729310 CAGATCATGTAGGATCTCATGGG + Intronic
1119557558 14:75565421-75565443 CAAATCTTGCAGGGCCTTGTGGG - Intergenic
1119875902 14:78059109-78059131 GAAATCATCCAGGACCTGGGTGG + Intergenic
1120568570 14:86090053-86090075 AAAATCAAGTAGGACCTCGATGG + Intergenic
1121210133 14:92202283-92202305 CAGATCCTGTGGGGCCTGGTGGG + Intergenic
1121752101 14:96365506-96365528 CACATCATGTAGGGCCTCGTAGG + Intronic
1122699095 14:103575219-103575241 CATATCAGGTAGGACTAGGTCGG + Intronic
1125456398 15:39864131-39864153 CAAATCAGGCAGCATCTGGTAGG - Intronic
1125900629 15:43343337-43343359 CAGATCATGTGGGACCTTGTAGG - Intronic
1129196401 15:73969786-73969808 CAGCTCATGTAGGGCCTGGTAGG - Intergenic
1130743202 15:86623268-86623290 TCAATCATGTAGAGCCTGGTTGG + Intronic
1131141697 15:89981637-89981659 CTAATAATGAAGGAACTGGTAGG - Intergenic
1134023720 16:10939415-10939437 CATACCATGGAGGACCTGGAAGG - Intronic
1135520556 16:23173902-23173924 GAAATCATGTAGGGCCTTATGGG + Intergenic
1136657536 16:31719346-31719368 CAAAACATGTAGGGCCTTCTGGG - Intronic
1138044357 16:53705312-53705334 CAGATCATGCAGGATCTTGTAGG - Intronic
1138369742 16:56517290-56517312 CAGATCATATAGGAACTTGTAGG - Intronic
1138646024 16:58425504-58425526 CATGTCATGGAGGGCCTGGTGGG + Intergenic
1139068381 16:63348124-63348146 CAAATCATTTCCCACCTGGTGGG + Intergenic
1139608211 16:68035310-68035332 CAGATCATGTAGAGCCTTGTAGG - Intronic
1141364626 16:83431444-83431466 CAAATCATGGAGGTCTTTGTAGG + Intronic
1143092964 17:4460201-4460223 CAGATCATGTAGGATGTTGTGGG + Intronic
1143474051 17:7192930-7192952 CAGAGCAGGTAGGACCTGGCGGG - Exonic
1144301200 17:13924105-13924127 CAAATTATGAAGGACTGGGTTGG + Intergenic
1146560240 17:33862647-33862669 CCAGTCATGGAAGACCTGGTTGG - Intronic
1147060355 17:37871391-37871413 GAAATCATGTACCACCTGATAGG + Intergenic
1148248686 17:46054621-46054643 CAAATACTATAGGACCTTGTGGG - Intronic
1148409637 17:47453869-47453891 GAAATCATGTACCACCTGATAGG + Intergenic
1149203790 17:54219468-54219490 CAAATGATTAAGGGCCTGGTGGG + Intergenic
1149451861 17:56755934-56755956 CAAATCATGCAGGAGCTTGGGGG - Intergenic
1150944931 17:69734661-69734683 CAAATCAGGTAGGACCTTTTCGG - Intergenic
1155419707 18:25641873-25641895 TATTTCAGGTAGGACCTGGTTGG + Intergenic
1156809684 18:41232408-41232430 CAGATTATGTAGGGCCTTGTGGG - Intergenic
1158366964 18:56747183-56747205 CAAAACATGGAGGAAGTGGTGGG + Intronic
1159076133 18:63683987-63684009 CGGATCATGTAGGAAGTGGTGGG - Intronic
1161619195 19:5289533-5289555 CAGGTCGTGCAGGACCTGGTGGG - Intronic
1161657167 19:5523396-5523418 CAAATCATGCAGGCCTTTGTGGG - Intergenic
1162432154 19:10635551-10635573 CAAATCATCTGGGGCCTGCTGGG - Intronic
1163221904 19:15927719-15927741 CAGAACATGTTGGACCTTGTAGG - Intronic
1165322674 19:35095980-35096002 CAGATCCTGTAGGGCCTTGTGGG + Intergenic
1165661326 19:37582989-37583011 CAAATCATGTAGGACCTTGTTGG - Intronic
1165882555 19:39053927-39053949 CAGATCATGTGAGGCCTGGTGGG - Intergenic
1166563672 19:43750164-43750186 CAAATCATGTAGGACCTGGTAGG - Intronic
1167794577 19:51701289-51701311 CAAACCATGTAAGACCTAATAGG + Intergenic
927601805 2:24449298-24449320 CAGATCATGTAGATCCTTGTAGG - Intergenic
928537157 2:32251825-32251847 CAAATCTTATAGCAGCTGGTTGG + Intronic
931065191 2:58578264-58578286 CAGATCATGCTGGACCTTGTGGG + Intergenic
931361569 2:61582367-61582389 CACTACATGTAGGATCTGGTTGG + Intergenic
932657298 2:73621111-73621133 CACAACATGTAGCACGTGGTTGG + Intergenic
932663974 2:73681359-73681381 CACAACATGTAGCACGTGGTTGG + Intergenic
935115778 2:100135145-100135167 CAGATCATGTAGCCCCTGATAGG + Intronic
935799439 2:106678885-106678907 CAAATCGTGAAGGACCTGGAGGG - Intergenic
936410296 2:112252581-112252603 CCAATCATGGAGGAACTGGTAGG - Intronic
937320293 2:120956803-120956825 GAAATCATGTGGGACCAGGCGGG + Intronic
937940791 2:127284321-127284343 CAGGTCTTGTAGGACCTTGTAGG - Intronic
939357961 2:141128419-141128441 CAGATTATGTAGGACCTGACTGG - Intronic
939706520 2:145460276-145460298 TAAATTATGCAGGACCTTGTGGG + Intergenic
942028371 2:171933810-171933832 CTTATCATGTAGGATCTGTTTGG + Intronic
942177710 2:173350471-173350493 CAGATCATGTGGGACCTTCTTGG - Intergenic
942797233 2:179835756-179835778 CATATCATGTGGGTCCTGGCTGG + Intronic
942843921 2:180400084-180400106 CAAATCAGGTAGGATCTAATAGG + Intergenic
944325777 2:198401825-198401847 CAGATCATGCAGGACCTTGTAGG - Intronic
944395529 2:199262213-199262235 CAGATCATGTAGGGCCTTGCAGG + Intergenic
944668573 2:201976528-201976550 AAGCTCATGTAGGACCTTGTAGG + Intergenic
945629596 2:212256729-212256751 AAAATCATGTAGATCCAGGTTGG - Intronic
946801028 2:223416182-223416204 CAGATCATGGAGTACATGGTAGG + Intergenic
946926375 2:224631211-224631233 CAGATCATGTAGAGCCTGATGGG + Intergenic
948202820 2:236142203-236142225 CAGATCACGTAGGACCTTGCAGG - Intergenic
948949462 2:241239597-241239619 GAGATCATTGAGGACCTGGTAGG - Exonic
1168781443 20:494698-494720 CAAATCATGTAAAACCTTATTGG - Intronic
1169036119 20:2453796-2453818 CAAACCATTTTGGACCTGCTAGG + Intergenic
1169097297 20:2913676-2913698 GAAATTATGTAGTACCTGGATGG - Intronic
1169798984 20:9495952-9495974 CAAATCATGTAAAGCCTGGTAGG + Intergenic
1171399002 20:24859466-24859488 CAAATCAGAGAGGCCCTGGTGGG + Intergenic
1172433032 20:34908287-34908309 CAAATCACGTAGAGCCTTGTAGG - Intronic
1172807105 20:37619913-37619935 CAGAACATGCAGGACCTCGTAGG + Intergenic
1173388187 20:42608005-42608027 CCAATCATCTATGCCCTGGTGGG + Intronic
1173587446 20:44193615-44193637 CAGATCATGGAGGGCCTGGTAGG - Intergenic
1174411549 20:50339856-50339878 AAGATCTTGTAGGGCCTGGTAGG - Intergenic
1175467943 20:59205267-59205289 CAAATCCTGCAGGGCCTGGGTGG - Intronic
1177922371 21:27168712-27168734 CAGATCATATAGTACCTTGTGGG - Intergenic
1178942419 21:36917163-36917185 CAGATCATGTAGGAGCTGGCAGG - Intronic
1179917734 21:44488642-44488664 CAAATTATGAAGGACTGGGTTGG + Intergenic
1181888521 22:26040848-26040870 CAGATGATGTAGGGCCTTGTAGG + Intergenic
1181971735 22:26695747-26695769 TAACTCATGTAGGGCCTTGTAGG + Intergenic
1182190381 22:28453908-28453930 TAGATCATGTATGACCTTGTAGG - Intronic
1183992335 22:41606054-41606076 CAGATCAGGTAGGTCCTGGGAGG + Intronic
1184201106 22:42970346-42970368 AAAATCATCAAGGACCTGGATGG + Intronic
949702865 3:6779478-6779500 CAAATCATATAGGGCCTTATGGG + Intronic
950617954 3:14177607-14177629 CAAAACATGTAGTATCTTGTAGG + Intronic
951279833 3:20734661-20734683 CAAATCATGTAGGCATTTGTTGG + Intergenic
951738572 3:25895462-25895484 TGGATCATGTAGGACCTTGTAGG - Intergenic
952606512 3:35153933-35153955 AGAATCATGTAGGACCATGTAGG + Intergenic
955317059 3:57947918-57947940 CCAATTGTGTAGGACCTTGTAGG + Intergenic
955833831 3:63031931-63031953 CAGATGCTGAAGGACCTGGTAGG + Intergenic
956202999 3:66727256-66727278 GAAGTCATGCAGGACGTGGTAGG - Intergenic
956499292 3:69864695-69864717 CAGACCATGAAGGATCTGGTAGG - Intronic
957849449 3:85787799-85787821 CAGATCATGCAGGACTTGTTAGG - Intronic
958084875 3:88794713-88794735 CGAGTCAGGGAGGACCTGGTGGG - Intergenic
959208945 3:103351063-103351085 CAGATCATGTAGGATCTTTTAGG + Intergenic
963017718 3:140841517-140841539 AAAATCATGAAAGCCCTGGTTGG - Intergenic
964435996 3:156654412-156654434 CAAATCATGCATGGCCTTGTGGG + Intergenic
965824264 3:172714707-172714729 CAGATCATTTAGGACCATGTAGG + Intergenic
966351327 3:179035229-179035251 CAGATCATGTAGGGCCTTATAGG - Intronic
967510189 3:190302146-190302168 CAAATCAAGTGGTACCTGGTAGG - Intergenic
967811385 3:193763999-193764021 CAAGTCATGTAGGACCTGGTGGG - Intergenic
967957465 3:194888322-194888344 CACATATTGTTGGACCTGGTGGG - Intergenic
970179642 4:13377570-13377592 CAAACCATGTAAAATCTGGTAGG + Intronic
970498984 4:16657569-16657591 CAGATAATGTAGGGCCTTGTAGG - Intronic
971404058 4:26304107-26304129 CAAATCATGAAAGATCTTGTGGG - Intronic
971467317 4:26977310-26977332 CAGATCTCATAGGACCTGGTAGG + Intronic
972463242 4:39326296-39326318 CAAATCCTGTAGGTCATGATAGG - Intronic
973207781 4:47579715-47579737 CAAACCATGTAGGACCTTATAGG + Intronic
974010092 4:56598733-56598755 CAGATCATGTAGGGCCTTGTAGG + Intronic
975854451 4:78608409-78608431 CAGATCATGCAGGACCTTTTTGG + Intronic
976274591 4:83263341-83263363 CAAGTCATGGAGGGCCTGGCAGG + Intronic
977155997 4:93574525-93574547 CAACTCATGTCTTACCTGGTTGG + Intronic
978921399 4:114187304-114187326 CAAATCATTTCAGACCTGCTTGG + Intergenic
979078790 4:116308080-116308102 CAAATCATGTACAACCTTGTAGG + Intergenic
980091441 4:128447306-128447328 CAGATCATGTTGGACCTTCTAGG + Intergenic
980478428 4:133352048-133352070 CTAATTATGTAGGACCTAGGAGG - Intergenic
981198551 4:141949803-141949825 CTCAGCATGTAGGGCCTGGTGGG + Intergenic
981702296 4:147619934-147619956 CAGATCATGTTGGACCTTGATGG - Intronic
982125297 4:152178818-152178840 CAAGTCAGGAAGGAGCTGGTTGG + Intergenic
984789081 4:183597751-183597773 TAAATCATATAGGACCGGCTGGG + Intergenic
987246943 5:16058749-16058771 TAGATCACGTAGGACCTTGTGGG + Intergenic
988153986 5:27425166-27425188 CAAATCATGTAGGAAAAGATTGG + Intergenic
990866966 5:60390469-60390491 CAAACAATGTAAGTCCTGGTTGG - Intronic
994149352 5:96431110-96431132 CAAATCATGTATGACCTATGGGG - Intronic
994407803 5:99367360-99367382 CAAATCATGGAGGGCCTTATAGG - Intergenic
997211671 5:132080569-132080591 CAAATCATCTAGAACATGGAGGG + Intergenic
997448797 5:133965038-133965060 CAGATCATGTAGGATCTTGAAGG - Intronic
997860536 5:137411424-137411446 CAAATCACCAAGGACCTTGTTGG + Intronic
997958890 5:138303413-138303435 CAGATCGTGTAGGGCCTTGTAGG - Intronic
998692627 5:144604021-144604043 CAGATCAAGTAGGACCTTGCAGG + Intergenic
998727767 5:145037654-145037676 CAAATCATATAGGACTTTTTAGG - Intergenic
998760966 5:145431555-145431577 CAAATCATGCACCACCTGATAGG + Intergenic
999549653 5:152672510-152672532 CACATCATGTAAGGCCTTGTAGG - Intergenic
999559162 5:152781166-152781188 CAGATCATGTAGGGCCTTGCAGG - Intergenic
999861393 5:155650687-155650709 CAGATCATGTAAGAACTTGTGGG + Intergenic
1003654825 6:7996875-7996897 CTAATTATGTAGGACCTTGAAGG - Intronic
1004171680 6:13300130-13300152 CCAATCATGTAGAGCCTAGTGGG - Intronic
1004917559 6:20346028-20346050 CAAATCATAAAAGATCTGGTGGG + Intergenic
1006710472 6:36064862-36064884 CAACTCATGTAGGACCTTTCAGG - Intronic
1007374666 6:41448314-41448336 CAGAGCATGTAAGACCTGGCAGG - Intergenic
1007707614 6:43800355-43800377 GGAATCATGTAGGACCTTGAAGG - Intergenic
1007835944 6:44673905-44673927 CAAACCATGTAGAACCTCATTGG + Intergenic
1008775764 6:55035719-55035741 CAGATCATGTAGGACCCCGTAGG - Intergenic
1009502623 6:64434938-64434960 CAAATCATGAAGGACATAGATGG - Intronic
1010611348 6:77957516-77957538 CAAATCATGTAGGATTTGGCAGG + Intergenic
1012188126 6:96247298-96247320 CAGATCATGTAGGACTTTGTAGG + Intergenic
1012783456 6:103592231-103592253 CAGATCATGTATGGCCTTGTAGG - Intergenic
1015299225 6:131633723-131633745 CAAAATATGTAGGACCGGGCAGG + Intronic
1016350282 6:143159302-143159324 CAAATCATGTAGGCATTTGTAGG + Intronic
1016477865 6:144447774-144447796 CAAATCAAAAAGTACCTGGTTGG - Exonic
1016492007 6:144615898-144615920 CTGATCATGTAGGACCTGGTAGG - Intronic
1016770679 6:147846979-147847001 CAAATCATGAACTACTTGGTTGG + Intergenic
1017397118 6:154014267-154014289 CACATCTTGTAGGGCCTTGTAGG + Intronic
1018871480 6:167786925-167786947 CTCATCATTTAGGACGTGGTTGG + Intronic
1020344450 7:7148038-7148060 AGAATCATGTAGGGCCTTGTAGG - Intergenic
1021019783 7:15582969-15582991 CAAATCTTGTAAGACTTGGTTGG - Intergenic
1022146478 7:27547071-27547093 CACATCATGTAGGGCTTTGTAGG - Intronic
1023704719 7:42929730-42929752 CTAATCGTGTAGGACTTTGTAGG - Intronic
1026241768 7:68581716-68581738 CAGATCATGTAGGGTCTTGTAGG - Intergenic
1026375526 7:69746721-69746743 CAGGTCATATAGGACCTTGTAGG + Intronic
1028984829 7:97001671-97001693 CAAACCAGGCAGGACCTGGATGG - Intergenic
1029970380 7:104782729-104782751 CAAATCACAAAGGACCTAGTTGG - Intronic
1030487526 7:110189091-110189113 CAGATCATGCAGGACTTTGTAGG + Intergenic
1030740258 7:113101092-113101114 CAGATCATGTAGGTCATGGCAGG - Intergenic
1032429178 7:131847058-131847080 CACATCATGCAGGACCTCTTTGG + Intergenic
1032554021 7:132812780-132812802 TACATCTTGTAGGACCTAGTAGG - Intronic
1033546037 7:142400813-142400835 CTAATGATATAGGACCTCGTGGG - Intergenic
1033733603 7:144201182-144201204 CAAATCATGAAAGGCCTTGTAGG + Intergenic
1033749447 7:144349790-144349812 CAAATCATGAAAGGCCTTGTAGG - Intergenic
1036125428 8:6057639-6057661 CAGATTAGGAAGGACCTGGTAGG - Intergenic
1036598534 8:10238051-10238073 CAGATAGTGTAGGACCTTGTGGG - Intronic
1036674906 8:10823084-10823106 AATATCAGGTAGCACCTGGTAGG - Intronic
1036691683 8:10948536-10948558 CAGACCTTGTAGGGCCTGGTCGG + Intronic
1036987682 8:13554893-13554915 CCAATCATGTAGGGCCTTGCAGG - Intergenic
1038832091 8:31073014-31073036 CATATCACGTAGGGCCTCGTAGG + Intronic
1042798944 8:72696567-72696589 CAAATCAGGTAGGATTTGGATGG + Intronic
1043551192 8:81374953-81374975 CAGATCCTGTAGGACTTTGTGGG + Intergenic
1044889826 8:96822607-96822629 CATATCATGCAGGACCTCCTGGG - Intronic
1046814417 8:118568383-118568405 CAGATCATGCAGGATCTGGTAGG + Intronic
1047236810 8:123048845-123048867 CACATCATATAGGGCCTGGAAGG - Intronic
1047701883 8:127457029-127457051 CAGATCATGTAAGGCCTGATTGG - Intergenic
1047724235 8:127670423-127670445 CACGTCACGTAGGGCCTGGTGGG - Intergenic
1048476888 8:134751660-134751682 CAGATCAAGTAGCACCAGGTGGG + Intergenic
1050541760 9:6676381-6676403 CACATCATATAGGACTTTGTGGG - Intergenic
1052181820 9:25538232-25538254 CAAACCATGTAAGACTTGGAAGG - Intergenic
1052395303 9:27931147-27931169 CAAATCAAGTAGGGTCTGGCAGG - Intergenic
1055392530 9:75838390-75838412 CAGATCATGGAGAACCTGGTGGG - Intergenic
1056977547 9:91272852-91272874 AAAATCAAGTAAGACCTAGTAGG + Intronic
1057268062 9:93631782-93631804 CAACTCAGGTAGGACCTGAGAGG - Intronic
1058371653 9:104275980-104276002 AAACTCATGTAGGAAATGGTGGG - Intergenic
1058598904 9:106647555-106647577 CAAATGATGTAGGGCCTTATAGG - Intergenic
1059866794 9:118523285-118523307 CAGGTCAAGTAGGACCTGGTAGG - Intergenic
1060463655 9:123882931-123882953 CAGATCATGTAGGACTTTGTAGG - Intronic
1187771860 X:22707466-22707488 TAAATCATGTGGGGCCTTGTAGG + Intergenic
1188955916 X:36434895-36434917 CAAATCATTAAGTGCCTGGTAGG - Intergenic
1189537986 X:41956206-41956228 CAGATCATGTAGGGCCTTGTAGG - Intergenic
1190489342 X:50965394-50965416 CAGATCATGTAGGATTTTGTAGG - Intergenic
1190981255 X:55458311-55458333 CACATTATGTAGGGCCTGGGAGG + Intergenic
1190987443 X:55514869-55514891 CACATTATGTAGGGCCTGGGAGG - Intergenic
1192273832 X:69610180-69610202 CAGATCATGTAGGGCCTTGTAGG + Intergenic
1192280119 X:69676116-69676138 CAGATCATGTAGGGCTTTGTAGG + Intronic
1192359560 X:70430551-70430573 CAAATTGGGTAGGACCTTGTAGG + Intronic
1193136016 X:77971218-77971240 GAAATCATGTGGGACCTTGTTGG + Intronic
1193624707 X:83803842-83803864 TAGATCATGTAGGGCCTTGTAGG + Intergenic
1194423601 X:93708314-93708336 CAGATCATATAGGACCTTATAGG + Intronic
1194713699 X:97265761-97265783 CAAATCATGTAGGTCCTTGTTGG + Intronic
1195408582 X:104544271-104544293 CAGATCATAAAGGACCTTGTGGG - Intergenic
1195612073 X:106878829-106878851 CAAATCAAGTAGGAATTAGTAGG + Intronic
1195725717 X:107913912-107913934 AAAATCATGCAGGACTTTGTAGG - Intronic
1196764657 X:119231952-119231974 CAGATCCTGTAGGGCCTTGTAGG + Intergenic
1197255118 X:124254467-124254489 CAAAGAATGTCAGACCTGGTAGG + Intronic
1197334236 X:125192329-125192351 CAAATCATGTAAAGCCTTGTAGG + Intergenic
1197415909 X:126172532-126172554 CATATCATGCTGGGCCTGGTAGG - Intergenic
1197631803 X:128869460-128869482 CCAATCATGTTGGGCCTTGTAGG + Intergenic
1197741707 X:129900057-129900079 CAGATCATGTAGGGCCTTGTAGG - Intergenic
1197881749 X:131173841-131173863 CAGATCATGTAGGGCCTTTTAGG + Intergenic
1197916621 X:131542541-131542563 CAAACCATATAGGGCCTCGTAGG + Intergenic
1198320441 X:135514398-135514420 CAGATCATGCAGGGCCTAGTTGG - Intergenic
1198380840 X:136081973-136081995 CAGATCATGTAAGGCCTTGTAGG - Intergenic
1198464321 X:136890934-136890956 CAAATCATGTAGGTTCATGTAGG + Intergenic
1198710430 X:139495661-139495683 CAGATCATGGAGGTCCTTGTAGG - Intergenic
1198789394 X:140327128-140327150 CAGATCATGAAGGGCCTCGTGGG + Intergenic
1198805514 X:140490494-140490516 CAAATGAGGTAGGACTTGGAGGG - Intergenic
1199778274 X:151034728-151034750 CAGATCCTATAGGACCTTGTGGG - Intergenic
1200303029 X:154997727-154997749 CATAACATGTAGGACCTTGCAGG + Intronic
1200385840 X:155890243-155890265 AAAGTCATGTAGGGCCTTGTAGG + Intronic
1202361636 Y:24116898-24116920 CAAATCATGTAGCAACTTGCTGG - Intergenic
1202363437 Y:24136198-24136220 CAAATCATGTAGCAACTTGCTGG + Intergenic
1202507343 Y:25533919-25533941 CAAATCATGTAGCAACTTGCTGG - Intergenic
1202509142 Y:25553215-25553237 CAAATCATGTAGCAACTTGCTGG + Intergenic