ID: 1166564372

View in Genome Browser
Species Human (GRCh38)
Location 19:43754699-43754721
Sequence CCGTGACGGGAGTCGGGTGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 120}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166564358_1166564372 23 Left 1166564358 19:43754653-43754675 CCTAACGCGGCTGCTGATTGGTT 0: 1
1: 0
2: 0
3: 8
4: 31
Right 1166564372 19:43754699-43754721 CCGTGACGGGAGTCGGGTGGGGG 0: 1
1: 0
2: 0
3: 8
4: 120
1166564356_1166564372 28 Left 1166564356 19:43754648-43754670 CCTTACCTAACGCGGCTGCTGAT 0: 1
1: 0
2: 0
3: 1
4: 28
Right 1166564372 19:43754699-43754721 CCGTGACGGGAGTCGGGTGGGGG 0: 1
1: 0
2: 0
3: 8
4: 120
1166564355_1166564372 29 Left 1166564355 19:43754647-43754669 CCCTTACCTAACGCGGCTGCTGA 0: 1
1: 0
2: 0
3: 0
4: 30
Right 1166564372 19:43754699-43754721 CCGTGACGGGAGTCGGGTGGGGG 0: 1
1: 0
2: 0
3: 8
4: 120
1166564354_1166564372 30 Left 1166564354 19:43754646-43754668 CCCCTTACCTAACGCGGCTGCTG 0: 1
1: 0
2: 0
3: 5
4: 49
Right 1166564372 19:43754699-43754721 CCGTGACGGGAGTCGGGTGGGGG 0: 1
1: 0
2: 0
3: 8
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166564372 Original CRISPR CCGTGACGGGAGTCGGGTGG GGG Exonic
900174109 1:1284291-1284313 CCGTGGGGGGATTGGGGTGGGGG + Intronic
901501662 1:9656135-9656157 CGGTGCCAGGAGTAGGGTGGGGG + Intronic
914240576 1:145850102-145850124 CCGTGAGGGCAGTGGGGTGTAGG - Intronic
917572881 1:176287759-176287781 CACTGATGGGAGTGGGGTGGTGG + Intergenic
919326113 1:196109280-196109302 CCTTTACGGGTGTCGGGTTGGGG + Intergenic
1063201090 10:3785691-3785713 CCGGGACGGGCGTGGGGTGGCGG - Intergenic
1064014725 10:11763152-11763174 CCGAGGCGGGACTCAGGTGGCGG + Intronic
1070328809 10:75403986-75404008 CGGGGAGGGGAGTCAGGTGGGGG - Intergenic
1073471928 10:103727787-103727809 CCCTGAGGGGAGCCGCGTGGAGG + Intronic
1083326184 11:61874068-61874090 GGGTGACGGGTGTCGGGTAGGGG + Intronic
1083656931 11:64234418-64234440 CCGCGGCGGGAGGCGGGAGGGGG + Intergenic
1083855066 11:65389243-65389265 CCCTGAGGGGTGTAGGGTGGGGG + Intronic
1085474819 11:76783256-76783278 CCCTGCCGGGCGCCGGGTGGCGG - Intronic
1091807526 12:3366626-3366648 CAGTGATGGGAGTCGCGGGGCGG - Intergenic
1092431124 12:8409793-8409815 CCTTTACGGGAGTCGGGCTGGGG + Intergenic
1092455102 12:8636065-8636087 CCTTTACGGGTGTCGGGTGTCGG - Intergenic
1092513936 12:9187942-9187964 CCCTGATGGGGGTGGGGTGGTGG + Intronic
1096007836 12:48186273-48186295 CCATGGAGGGAGTGGGGTGGGGG + Intergenic
1103621494 12:122189878-122189900 CCGTGAAGGGAGGTCGGTGGGGG + Intronic
1107119168 13:36778746-36778768 CTGTGCAGGGAGTGGGGTGGGGG - Intergenic
1114559690 14:23580922-23580944 GGGTGAGGGGAGTGGGGTGGGGG - Intergenic
1115687245 14:35809008-35809030 CCGCGGCGCGAGGCGGGTGGAGG - Exonic
1116887036 14:50231638-50231660 CCGTAGCGGGAGTCGGGGCGGGG - Intergenic
1121299815 14:92861500-92861522 GGGTGATGGGAGTGGGGTGGAGG - Intergenic
1121507485 14:94487716-94487738 CAGTTACGGGAGTCGGTGGGGGG + Intronic
1123625581 15:22224859-22224881 CCTTGACGGGGGCGGGGTGGGGG - Intergenic
1123689298 15:22823623-22823645 CGGTGGCGGGTGGCGGGTGGGGG + Intronic
1125678127 15:41513261-41513283 CTGCGACCGGAGTCGGGTAGTGG - Intronic
1127606554 15:60592626-60592648 CCGGGGCGGGAGGCGGGAGGCGG + Intronic
1128315107 15:66655121-66655143 CCGGGCCGGGAGCCGGGTGGGGG - Intronic
1130370600 15:83283428-83283450 CCGTGCTGGGAGCCGGGCGGCGG - Intronic
1132790020 16:1680610-1680632 CTGTGAAGCGAGTCAGGTGGTGG + Intronic
1132915623 16:2341763-2341785 ACGGGACGGGAGTGGGGAGGTGG + Intergenic
1136914262 16:34167596-34167618 CAGGGACTGTAGTCGGGTGGGGG - Intergenic
1137328112 16:47461489-47461511 CCTTGGCGGGAGGCAGGTGGGGG + Intronic
1138386352 16:56638283-56638305 CCGTGAGAGGGGTGGGGTGGAGG + Intergenic
1139781292 16:69353632-69353654 CGGTGGTGGGACTCGGGTGGGGG - Intronic
1142631493 17:1229177-1229199 CCGTGCCGGGAGCCGCCTGGGGG + Intergenic
1144206844 17:12985440-12985462 CAGGGAGGGGAGTCTGGTGGAGG - Intronic
1145846295 17:28041865-28041887 CGGGGACGGAAGCCGGGTGGGGG + Intronic
1146157403 17:30535699-30535721 CTGTGACTGGGGTGGGGTGGGGG - Intergenic
1148909789 17:50935284-50935306 CCGAGACGGGGGTTGGTTGGAGG - Intergenic
1149970913 17:61217551-61217573 CCATGAGGGGAGGTGGGTGGGGG - Intronic
1152687675 17:81702638-81702660 CTGGGAAGGGAGTCGGGTGATGG + Intronic
1154173566 18:12067642-12067664 CCGGCAAGGGAGTTGGGTGGGGG + Intergenic
1160424394 18:78770248-78770270 CCGAGGCGGGAATCAGGTGGCGG + Intergenic
1160723901 19:609165-609187 CCGTGACGGCGGGCGGGTGGTGG - Intronic
1160879471 19:1312972-1312994 CTGTGACGGCAGGCGGGTGGGGG - Intergenic
1166564372 19:43754699-43754721 CCGTGACGGGAGTCGGGTGGGGG + Exonic
1167991380 19:53364202-53364224 CCTTCACGGGTGTCGGGTTGGGG - Intergenic
1168358519 19:55718295-55718317 CCTTTACGGGTGTCGGGTTGGGG - Intronic
925414358 2:3658791-3658813 CCGGGATGGGATTGGGGTGGAGG + Intronic
930018385 2:46986303-46986325 CCGTGAGGGGAGTCAGGTTTAGG + Intronic
931687336 2:64805780-64805802 CTGGGCCTGGAGTCGGGTGGGGG + Intergenic
932189932 2:69732312-69732334 CCTTGATGGGAGTGGGGTTGTGG + Intronic
932657732 2:73624855-73624877 CTGTGCCTTGAGTCGGGTGGGGG + Intergenic
932664409 2:73685139-73685161 CTGTGCCTTGAGTCGGGTGGGGG + Intergenic
932815238 2:74855973-74855995 CCATGACGGGTGGTGGGTGGGGG + Intronic
937873550 2:126803548-126803570 ACTAGACGGGAGTGGGGTGGAGG - Intergenic
943736155 2:191357350-191357372 CCGTGTCGATAGTCGGGTGGCGG + Intronic
947972288 2:234334224-234334246 CAGAGACCGGAGTGGGGTGGTGG - Intergenic
948751711 2:240136821-240136843 CCGGGGCGGGAGACGGGGGGGGG + Intergenic
948852116 2:240713528-240713550 CGGTCACGGGAGGCAGGTGGAGG + Intergenic
1172529321 20:35619135-35619157 CCTTGCCGGGAGTCGGGGCGCGG - Intronic
1173184424 20:40829773-40829795 GAGTGAGGGGAGTCAGGTGGAGG - Intergenic
1174208583 20:48858936-48858958 CCGAGGCTGGAGTGGGGTGGTGG + Intergenic
1175863170 20:62160953-62160975 CCGAGGCGGGTGTGGGGTGGGGG + Intronic
1176548608 21:8212247-8212269 CCGCGGCGGCCGTCGGGTGGGGG + Intergenic
1176556502 21:8256455-8256477 CCGCGGCGGCCGTCGGGTGGGGG + Intergenic
1176567539 21:8395282-8395304 CCGCGGCGGCCGTCGGGTGGGGG + Intergenic
1176575441 21:8439497-8439519 CCGCGGCGGCCGTCGGGTGGGGG + Intergenic
1178261200 21:31101137-31101159 CAGTGAGGGGAGTGGGGTTGGGG + Intergenic
1180738207 22:18034605-18034627 AAGTGGCGGGAGGCGGGTGGAGG + Intergenic
1180908314 22:19431390-19431412 CCGAGCCCGGAGTCGGGTCGGGG - Intronic
1181441103 22:22935579-22935601 CTGAGATGGGAGTAGGGTGGGGG + Intergenic
1182697148 22:32205365-32205387 CGCTGAGGGGAGTGGGGTGGGGG + Intergenic
1203253491 22_KI270733v1_random:128552-128574 CCGCGGCGGCCGTCGGGTGGGGG + Intergenic
1203261546 22_KI270733v1_random:173630-173652 CCGCGGCGGCCGTCGGGTGGGGG + Intergenic
950976750 3:17254754-17254776 CCGTGGCGGGGGTGGGGGGGGGG + Intronic
953614379 3:44477446-44477468 CCGTGGCGGGGGTCTGGCGGTGG - Intronic
956785869 3:72641657-72641679 CCTTGTCGGGAGGCGGGGGGTGG + Intergenic
957045958 3:75374739-75374761 CCTTTACGGGGGTCGGGTGGGGG + Intergenic
961612139 3:128148433-128148455 CTGTGATGGGAGTGGAGTGGAGG + Intronic
970191602 4:13523710-13523732 CCGAGAGGGAAGTGGGGTGGGGG + Intergenic
981034421 4:140154311-140154333 CGGAGACGGGAGCCGGGTGCTGG - Intergenic
986321249 5:6633891-6633913 CCGGGCCGGGAGTAGGGTAGGGG - Intronic
992811149 5:80389794-80389816 CCGTGACGGGTGGCTGGGGGAGG + Intergenic
992869298 5:80990425-80990447 CAGTGAAAGGAGTCGGGAGGGGG + Intronic
998119170 5:139561773-139561795 CCATGGTGGGAGGCGGGTGGCGG - Exonic
999461272 5:151759083-151759105 CCCTGACTGCAGTGGGGTGGGGG + Intronic
1002851010 6:996347-996369 CAGTGCTGGGAGTCTGGTGGTGG + Intergenic
1005649464 6:27873391-27873413 CCGTGCCAGGCGTCGGATGGCGG + Exonic
1009957632 6:70474410-70474432 ACGTGAGGGGAGTCTTGTGGAGG - Intronic
1019286226 7:224483-224505 CCGTCACGGGGGTCGCATGGCGG + Intronic
1019286249 7:224602-224624 CCGTCACGGGGGTCGCATGGCGG + Intronic
1019286283 7:224780-224802 CCGTCACGGGGGTCGCATGGCGG + Intronic
1019286328 7:225017-225039 CCGTCACGGGGGTCGCATGGCGG + Intronic
1019286340 7:225077-225099 CCGTCACGGGGGTCGCATGGCGG + Intronic
1019286363 7:225196-225218 CCGTCACGGGGGTCGCATGGCGG + Intronic
1019286385 7:225315-225337 CCGTCACGGGGGTCGCATGGCGG + Intronic
1019286430 7:225552-225574 CCGTCACGGGGGTCGCATGGCGG + Intronic
1019286442 7:225612-225634 CCGTCACGGGGGTCGCATGGCGG + Intronic
1019286465 7:225731-225753 CCGTCACGGGGGTCGCATGGCGG + Intronic
1019286487 7:225850-225872 CCGTCACGGGGGTCGCATGGCGG + Intronic
1019446381 7:1073778-1073800 GCGTGACGGCAGCGGGGTGGGGG - Intronic
1019446463 7:1074023-1074045 GCGTGACGGCAGCGGGGTGGGGG - Intronic
1023835483 7:44065056-44065078 CAGAGTGGGGAGTCGGGTGGGGG - Intronic
1032186922 7:129734746-129734768 TCTTGACTGGAGTTGGGTGGTGG + Intronic
1035117159 7:156534163-156534185 CAGTGCCGGGAGTGGGATGGTGG - Intergenic
1035463427 7:159060635-159060657 CCATGAGGTGAGTCAGGTGGTGG - Intronic
1036479867 8:9130154-9130176 CCATGGTGGGAGTGGGGTGGGGG + Intergenic
1046399160 8:113681238-113681260 CCGGGACGGTTGTGGGGTGGGGG + Intergenic
1049973511 9:841539-841561 CGGTGGCTGGAGTCGGGGGGCGG + Intergenic
1053050482 9:34957828-34957850 CCGCGCCGGGGGTTGGGTGGGGG - Intronic
1056992354 9:91423736-91423758 CCGCGGCGGGAGGCGGGCGGCGG + Exonic
1057222296 9:93263804-93263826 CCGTGGCGGGGGTGTGGTGGGGG + Intronic
1058492783 9:105519938-105519960 CCGCGGCGCGAGGCGGGTGGAGG + Intronic
1061327569 9:129873613-129873635 CCCAGAAGGGAGCCGGGTGGAGG + Intronic
1061517282 9:131097047-131097069 CCGAGACCGGAGGCGGGAGGCGG - Intronic
1061785386 9:133024839-133024861 CTGTGACGTGAGTCGGGGGGGGG - Intergenic
1203469892 Un_GL000220v1:111699-111721 CCGCGGCGGCCGTCGGGTGGGGG + Intergenic
1203477713 Un_GL000220v1:155671-155693 CCGCGGCGGCCGTCGGGTGGGGG + Intergenic
1203403137 Un_KI270519v1:135365-135387 CAGGGACTGTAGTCGGGTGGGGG + Intergenic
1186516138 X:10167211-10167233 CAGTGACGGGAGCCAGGTGGTGG - Intronic
1187562749 X:20418223-20418245 CTGTGTTGGGAGTGGGGTGGGGG + Intergenic
1188483050 X:30653650-30653672 CCGGGGCGGGAGTCGGGGGACGG + Intronic
1192169777 X:68847070-68847092 CCATGATGGGGGTGGGGTGGGGG - Intergenic
1199619465 X:149686342-149686364 CCTTGAGGGAAGTTGGGTGGGGG + Intergenic
1200066011 X:153504391-153504413 CAGTGAAGGGAGTGGAGTGGAGG + Intronic