ID: 1166566742

View in Genome Browser
Species Human (GRCh38)
Location 19:43770169-43770191
Sequence TTGTGGGAGTGGGAGAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1163
Summary {0: 1, 1: 0, 2: 12, 3: 105, 4: 1045}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166566742_1166566750 14 Left 1166566742 19:43770169-43770191 CCATCCTTCTCCCACTCCCACAA 0: 1
1: 0
2: 12
3: 105
4: 1045
Right 1166566750 19:43770206-43770228 CAGCCCTGTCTTCTCTCTCCTGG 0: 1
1: 2
2: 4
3: 71
4: 509

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166566742 Original CRISPR TTGTGGGAGTGGGAGAAGGA TGG (reversed) Intronic
900296913 1:1956502-1956524 CAGTGGGCCTGGGAGAAGGAGGG - Intronic
900698669 1:4029325-4029347 TTGTGGGAGTGGGATCCTGATGG + Intergenic
900883871 1:5401905-5401927 GCGGGGGAGTGGGGGAAGGATGG - Intergenic
901103924 1:6740726-6740748 TCATTGGAGTGGGGGAAGGAGGG - Intergenic
901316793 1:8315130-8315152 TCCTGGGTGTGGGGGAAGGATGG - Intergenic
901624869 1:10618138-10618160 TTGAGGCAGTGGGAACAGGAGGG + Intronic
902264439 1:15251918-15251940 CTGTTAGAGAGGGAGAAGGAAGG - Intronic
902628816 1:17692654-17692676 GGGTGGGAGTGGGAGGAGCAAGG - Intronic
902694779 1:18132908-18132930 TGGAGGGAGTGGGGGAGGGAGGG + Intronic
902718876 1:18291224-18291246 ATGCGGAAGTGGGAGAAGGCAGG - Intronic
902790000 1:18761411-18761433 TGGTGGGAGCGGGAGCTGGAGGG - Intergenic
902813722 1:18904210-18904232 TTGGGGGAGGGGTAGGAGGACGG - Intronic
902936114 1:19766027-19766049 TTGTTGGATGGAGAGAAGGAGGG - Intronic
903232025 1:21927703-21927725 TTCCTGGACTGGGAGAAGGAGGG - Intronic
903282389 1:22257405-22257427 TGGTAGGAGGGGGAGGAGGAAGG - Intergenic
903352462 1:22726018-22726040 GGGTGGGATTGTGAGAAGGAAGG - Intronic
903552737 1:24169308-24169330 TTGGGGAAGTGGGAGACAGATGG + Intronic
904026819 1:27509280-27509302 TTGGGGCAGTGGGGGAAAGATGG - Intergenic
904128693 1:28260127-28260149 GAGAGGGAGGGGGAGAAGGAGGG - Intronic
904357817 1:29952474-29952496 TGGTGGGAGTGGGAGGATGGTGG + Intergenic
904403746 1:30273214-30273236 TGGTGGGAGGGGGACAAGGAGGG + Intergenic
904408731 1:30312034-30312056 CTCTGGGAGAGGGAGGAGGAAGG + Intergenic
904461460 1:30682989-30683011 TGGTGGGAGGGGGATCAGGAAGG + Intergenic
904830929 1:33306526-33306548 CCGTGGGAGTGGGAGTAGGAGGG - Intergenic
904920347 1:34003129-34003151 GAATGGGAGTTGGAGAAGGAAGG - Intronic
905044650 1:34986056-34986078 TTGGGGGAAGGGGAGAAGCATGG - Intronic
905068599 1:35205710-35205732 TTGTGGGAGGGGGAGCATGCAGG + Intergenic
905255837 1:36683657-36683679 TTGTGGGGTGGGGGGAAGGAGGG - Intergenic
905286174 1:36881854-36881876 TTGAGGGAGGGAAAGAAGGATGG - Intronic
905326336 1:37154660-37154682 ATGTGGGTGTGTGAGCAGGAGGG - Intergenic
905326757 1:37158465-37158487 CTGGGGAAGTGAGAGAAGGAGGG + Intergenic
905343210 1:37293349-37293371 TGGTGGGAGGGCCAGAAGGAGGG - Intergenic
905433279 1:37940033-37940055 TTGTGGCAATGGGAGAGGGCTGG - Intronic
905904987 1:41612076-41612098 GGGTGGGAGTGGGAGGAGGAAGG - Intronic
906256975 1:44357853-44357875 CTGTGTGACAGGGAGAAGGAAGG + Intergenic
907294746 1:53443271-53443293 TTGGGGGAGAGTGGGAAGGAGGG + Intergenic
907438380 1:54463716-54463738 TTCTGGGGGTGGGAGAATGGGGG + Intergenic
907450519 1:54542873-54542895 TGGTGAGAGAGGGAGAGGGAGGG + Intronic
907613183 1:55893698-55893720 TTGGGGGAGTGGGGGCTGGAGGG - Intergenic
907672891 1:56492411-56492433 TGGTGGGGGTAGGAGAGGGAAGG - Intergenic
907761013 1:57359935-57359957 GCTTGGGAGTGGGGGAAGGATGG + Intronic
907888896 1:58619526-58619548 TTGTGGGGGAGGGGTAAGGAAGG + Intergenic
908021666 1:59904678-59904700 TTGTGGGGAGGGGAGCAGGAAGG - Intronic
908320412 1:62972949-62972971 GTAGGGGAGAGGGAGAAGGAAGG - Intergenic
908389928 1:63675240-63675262 GTGTGGGAGGGGGAGAGGGAAGG - Intergenic
909432702 1:75607994-75608016 CTGGGGGAGTGGGAGAAGTGAGG - Intronic
909718302 1:78736814-78736836 TTGAGGGAGTTGCAGAAGGAGGG - Intergenic
909739402 1:79009152-79009174 TTGTATGAATGGGAGAAGGTGGG + Intergenic
910275672 1:85446686-85446708 TTGAGGGAGAGGGAGAGGAAGGG - Intronic
910276221 1:85451755-85451777 TTGTGGGTCTGGGAGCAGGTGGG + Intronic
910488952 1:87746684-87746706 TTGTGGGAGGGGGAGCACGCAGG - Intergenic
910810239 1:91228271-91228293 TGTTGGGAGTGGGTGAAGGGAGG - Intergenic
910979847 1:92949155-92949177 TTTTGGGGGTGGGAGTGGGAGGG - Intronic
911029206 1:93468098-93468120 TTGGAGGAGAGGGAGAAGAAGGG - Intronic
911032693 1:93507162-93507184 TTGGGGGGGTGGGGGAGGGAGGG - Intronic
911233935 1:95389614-95389636 CTGAGGGAGTGGGATAAGAAAGG - Intergenic
911493555 1:98600461-98600483 TTGTGGTAGTGTTAGAAGGTAGG - Intergenic
911694242 1:100870529-100870551 ATGAGGGAGGGGAAGAAGGAGGG + Intergenic
912449000 1:109758260-109758282 TTCTGGGCCTGGGAAAAGGAAGG - Intronic
912705491 1:111908826-111908848 GTGTGTGAAAGGGAGAAGGAGGG + Intronic
912738065 1:112167846-112167868 TAGGGGGCGTTGGAGAAGGAAGG - Intergenic
912738770 1:112174375-112174397 TTGTACAAGTGGGAGAAGAAGGG + Intergenic
913197030 1:116465818-116465840 TTGAGAGGGAGGGAGAAGGAAGG - Intergenic
915090073 1:153417991-153418013 ATGTGGGGGTGTTAGAAGGAGGG - Intronic
915263649 1:154698304-154698326 TTGTGGAATTGTGAGTAGGAAGG - Exonic
915318467 1:155042971-155042993 GTGAGGGAGGGGGACAAGGAGGG + Intronic
915700190 1:157784748-157784770 TTGTGTGAGGGGGAGGATGAAGG - Intergenic
915944578 1:160140513-160140535 TTGTGTGTGTGGGGGGAGGAGGG + Intronic
915948879 1:160174434-160174456 CAGGAGGAGTGGGAGAAGGACGG + Intronic
916079251 1:161222251-161222273 TTGGGGGACTGGGAAAAGTAGGG - Intergenic
916097719 1:161365835-161365857 ATGAGGGAGGGGGATAAGGAAGG - Exonic
916360348 1:163961109-163961131 TTGTGGGGGTGGGGGAAGGGGGG - Intergenic
916794691 1:168154879-168154901 TGGTGGGAGGAGGAGAAGGAGGG + Intergenic
916922713 1:169485800-169485822 TTGGCGGAGGAGGAGAAGGAAGG - Exonic
917110681 1:171544125-171544147 TTGAGGGCGTGGGTGAGGGACGG + Intronic
917325882 1:173831514-173831536 TTCTTGGAGAGTGAGAAGGAAGG - Exonic
917610507 1:176684368-176684390 TTGGGGAAGTGAGAGAAGGTGGG + Intronic
917647303 1:177041797-177041819 TTGAGGAAATGGGAGAAAGAGGG - Intronic
917658704 1:177155668-177155690 TTGTTGGAGTAGGATAAGCAAGG + Intronic
917991931 1:180389146-180389168 TTGTGGGCGGGGGAGCGGGAAGG - Intronic
918194902 1:182212122-182212144 TTGTGGAAGGTGGGGAAGGAAGG + Intergenic
918296624 1:183163049-183163071 TTGTGGGTGTGTGTGAAGGATGG + Intergenic
918319169 1:183348535-183348557 TTGGGGGTGTGGGGGAATGATGG + Intronic
919518028 1:198551027-198551049 TAGTGGGAGAAGGAGGAGGAAGG + Intergenic
920291028 1:204923328-204923350 ATGCTGGAGTGGGAGGAGGAGGG - Intronic
920679648 1:208062740-208062762 GGGTGAGGGTGGGAGAAGGAAGG + Intronic
920692191 1:208155451-208155473 GTGTGGGAGGGGCAGAATGAGGG - Intronic
920759996 1:208774308-208774330 TTGTAGGAAAGGGGGAAGGAAGG + Intergenic
921189940 1:212699987-212700009 AGGCGGGGGTGGGAGAAGGAGGG - Intergenic
921372924 1:214443976-214443998 TGGTGGGAGTGAGAGTGGGAGGG + Intronic
921726580 1:218531061-218531083 GTGTGGAAGTTGTAGAAGGAAGG - Intergenic
921988008 1:221333724-221333746 GTGTGGGAGTGGAAAAGGGAAGG + Intergenic
922072531 1:222209915-222209937 TTTTGGGAGAAGGAGATGGAAGG + Intergenic
923042184 1:230327333-230327355 TTGTGGGGGTGGGAGGGGGCTGG - Intronic
923472959 1:234308605-234308627 TGGGGGTTGTGGGAGAAGGACGG - Intronic
923472975 1:234308656-234308678 TGGGGGTTGTGGGAGAAGGACGG - Intronic
923472991 1:234308707-234308729 TGGGGGTTGTGGGAGAAGGACGG - Intronic
923574103 1:235142230-235142252 TGGTGGGAGTGGGCGCAGCAGGG - Intronic
923582377 1:235230474-235230496 TTCTGGGAATGGTAGAAGAAAGG - Intronic
923835580 1:237607421-237607443 TTGTGGGGTTGGGGGAGGGAGGG + Intronic
924355998 1:243176553-243176575 TTGTTGGAGTGGGATAGGGAGGG - Intronic
924809803 1:247391097-247391119 TTGTGGGAGGCTGAGAAGGGAGG - Intergenic
1062907255 10:1187339-1187361 TGACGGGAGTGGGAGGAGGAGGG - Intronic
1063482146 10:6385332-6385354 GAGTGTGAGTGGGAGGAGGAGGG - Intergenic
1064145645 10:12824107-12824129 ATGAGGGGGAGGGAGAAGGATGG + Intronic
1064331195 10:14395867-14395889 TTGTTGGAATGGGAGGAGTAGGG + Intronic
1065369337 10:24967438-24967460 TGGAGGTAGTGGGGGAAGGATGG + Intergenic
1065548228 10:26843711-26843733 TTGTGGTAGTGGGGCAAGGTAGG + Intronic
1065967842 10:30783608-30783630 TGGTGGGACTGGGAGGAGGTAGG - Intergenic
1066681100 10:37937572-37937594 CTCTGTCAGTGGGAGAAGGAGGG - Intergenic
1067056951 10:43058063-43058085 GTGTGGGGGATGGAGAAGGAGGG - Intergenic
1067155975 10:43781736-43781758 TTGAGGCAGTGGGAGTGGGAAGG + Intergenic
1067249407 10:44574538-44574560 CTGTGGGAGTGAGAGGAGCAGGG + Intergenic
1067258587 10:44666580-44666602 TGGTGGGAGAGGGAGAGGGAGGG + Intergenic
1067537701 10:47126707-47126729 TTGTAGCAGTGGCAGAAGGAAGG - Intergenic
1067759102 10:49029905-49029927 TGGTGGGAGAGGGTGATGGAGGG + Intronic
1069105925 10:64383361-64383383 TTGTGGGTGTGGGAGAAGTGTGG + Intergenic
1069693365 10:70369203-70369225 GTGTGTGGGTGGGAGAAGGCGGG + Intronic
1070124244 10:73607585-73607607 TTTTGGGAGCCGGAGGAGGATGG + Intronic
1070329061 10:75405116-75405138 GGGTGGGAGGAGGAGAAGGAAGG + Intergenic
1070367628 10:75751363-75751385 GAGGGGGAGTGGGAGAGGGAGGG + Intronic
1070389624 10:75958132-75958154 TTATGTGAGGAGGAGAAGGATGG + Intronic
1070456766 10:76624777-76624799 GAGTGGGAGTAGGAGAAGAAAGG - Intergenic
1070628387 10:78067293-78067315 TTATTGGAGTGGGACAGGGATGG + Intergenic
1070702796 10:78615761-78615783 TGGTGATGGTGGGAGAAGGAAGG - Intergenic
1070950885 10:80429776-80429798 TTGTCAGAGTGGGAAGAGGATGG - Intronic
1070971230 10:80569169-80569191 TTGTGGGACTGGGAGACTCAGGG + Intronic
1070972563 10:80579584-80579606 AGGTGGGAGTGGGAGGAGGGAGG - Intronic
1071329182 10:84543543-84543565 TTGTGGGAGCAGGGCAAGGAGGG - Intergenic
1071554877 10:86594275-86594297 AAGAGGGAGGGGGAGAAGGAAGG + Intergenic
1071753569 10:88509729-88509751 TGGGGGGAAGGGGAGAAGGAAGG + Intronic
1071960441 10:90804527-90804549 TTGTGGGAGGGGGAGCATGCAGG - Intronic
1071989245 10:91084215-91084237 TTGAGGAGGTGGGAGAAAGATGG - Intergenic
1072024867 10:91445325-91445347 TAGTGGCAGAGGGATAAGGAAGG - Intronic
1072251517 10:93585797-93585819 TGGTGGGAGTGGGTGTGGGAAGG - Intronic
1072620858 10:97078353-97078375 TGGTGGTGGAGGGAGAAGGAGGG - Intronic
1072933857 10:99693074-99693096 TTGTGGTAGTGTGAGTAGGGTGG + Intronic
1073173552 10:101534533-101534555 CTGGGAGAGTGGGAGAAGGAAGG - Intronic
1073175547 10:101554499-101554521 GTGTGGGAGAAGCAGAAGGAAGG - Exonic
1073388461 10:103149416-103149438 TTGTGATAATGGGAGCAGGATGG + Intronic
1073609347 10:104928016-104928038 TTTTGGGATTTGGAAAAGGAGGG + Intronic
1074377055 10:112949792-112949814 TTAAGGGAGGGGGAAAAGGAAGG - Intergenic
1074600642 10:114909901-114909923 TTGGGGGACAGGGAGCAGGATGG + Intergenic
1074873275 10:117594698-117594720 TAGTGGGAGTGGGCCAGGGAGGG + Intergenic
1074902540 10:117831378-117831400 CAGATGGAGTGGGAGAAGGACGG + Intergenic
1075451830 10:122557061-122557083 TGGGGGGAGTGAGTGAAGGAGGG + Intergenic
1075474737 10:122724444-122724466 CTGTGGGGGTGAGAAAAGGAGGG - Intergenic
1075851166 10:125588543-125588565 TGATGTGAGTGGGAGAAAGAGGG + Intronic
1076059702 10:127404185-127404207 TGGTGGGAGAGGGAGATGGTGGG - Intronic
1076318866 10:129564175-129564197 GTGGGGGAGTGGAAGAAGAAGGG - Intronic
1077661069 11:4069027-4069049 ATGTGGGAGTCAGAGAAAGAGGG - Intronic
1077885561 11:6385061-6385083 TTTTGGCAGTAGGAAAAGGAGGG - Intergenic
1079001655 11:16762720-16762742 TTGTGGGAGTTGGAGAGAGCAGG - Intergenic
1079070310 11:17339496-17339518 TTGTGGGGGTGGGGGGAGGGGGG - Intronic
1079408034 11:20162491-20162513 GAAAGGGAGTGGGAGAAGGAGGG - Intergenic
1080412709 11:32040934-32040956 TTGTGGGAGAGAGGGAAGGGAGG - Intronic
1080569421 11:33542619-33542641 CTGGGGGAGGGGGAGACGGATGG - Exonic
1080624520 11:34016441-34016463 TTGTGGGAGGGGGAGCAAAATGG + Intergenic
1081199511 11:40199389-40199411 TTGTGGTTGTTGGGGAAGGAGGG + Intronic
1081497700 11:43632005-43632027 GTGAGGGAGGGGGAGGAGGAGGG + Intronic
1081578590 11:44335233-44335255 TTGTGTGAGTGAAAGCAGGAGGG - Intergenic
1081755605 11:45542152-45542174 TTGTGGGAGAGGGTGAGGCAAGG - Intergenic
1081845335 11:46237333-46237355 TAGGGGGAGGGGGAGAAGGGAGG + Intergenic
1081978909 11:47254143-47254165 TTGTGGGAGTGGGGGTGGGCAGG - Intronic
1082914743 11:58420508-58420530 TGGTGGGAGTGGGGGAAATAGGG + Intergenic
1082934818 11:58645652-58645674 TTCTGGGATCTGGAGAAGGATGG + Intronic
1083039582 11:59672506-59672528 TTGAGTGGGTGGGAGAAGGGAGG + Intergenic
1083177064 11:60957038-60957060 TTGTGGGGGTGAGAGAGAGATGG - Intergenic
1083263144 11:61533876-61533898 TTCAGCAAGTGGGAGAAGGATGG - Intronic
1083589808 11:63887014-63887036 TTGGGGGGCTGGGAAAAGGAAGG + Intronic
1084683210 11:70679188-70679210 TTGTGTGAGAGAGAGAATGAGGG - Intronic
1084709035 11:70832690-70832712 GGGTGGGAGTTGGACAAGGAAGG - Intronic
1085353153 11:75813963-75813985 TTGTGTGTGTGTGGGAAGGAGGG + Intergenic
1085655944 11:78315100-78315122 TTGAGAGAGTAAGAGAAGGAAGG + Intronic
1085947067 11:81284812-81284834 CTGTAGGAGGGGGAGAAGGCAGG - Intergenic
1086100393 11:83093084-83093106 TTGTGGGGGAGGGAACAGGATGG + Intergenic
1086497505 11:87419734-87419756 TTGTGGGTGTGGGAGGAAGGAGG - Intergenic
1086651924 11:89302169-89302191 GTGGAGGAGTGGGAGGAGGATGG + Intergenic
1087439290 11:98162000-98162022 TTGTGGGAGGGGGAGCATGCAGG - Intergenic
1087727342 11:101736956-101736978 CAGTGGGGGTGGGTGAAGGAAGG + Intronic
1087774020 11:102241383-102241405 TTGTGGCAGTGGGAGAGAAAAGG + Intergenic
1087826803 11:102773809-102773831 TGCTGGGACTGAGAGAAGGAAGG - Intronic
1087873742 11:103330897-103330919 TACTTGGAGTGGAAGAAGGAAGG + Intronic
1087919631 11:103851454-103851476 TTGTGGGTGGAGGAGAAGGAAGG - Intergenic
1088334855 11:108692498-108692520 TTGTGGGAATGGGACGGGGATGG + Intronic
1088425078 11:109693563-109693585 TGGTGGCAGTGGCAGCAGGAAGG - Intergenic
1088639835 11:111861470-111861492 ATCTCGGAGTGGGAGGAGGAGGG - Intronic
1089598489 11:119598106-119598128 CTTTGTGTGTGGGAGAAGGATGG + Intergenic
1089735934 11:120550283-120550305 TGGAGTGAGTGGGAGGAGGATGG + Intronic
1089905227 11:122031424-122031446 TAGTGGGAGGAGGAGGAGGAGGG + Intergenic
1090175362 11:124644250-124644272 TTCTGGGTGTGGAAGAAGTAGGG - Intronic
1090299892 11:125626188-125626210 TTGTGGGGGCGGGGGCAGGAGGG + Intronic
1090463838 11:126915288-126915310 TGCTGGGAGTGGGGGAAGAATGG - Intronic
1090653505 11:128825579-128825601 CTGATGGAGTGGGAGAGGGATGG + Intergenic
1090872668 11:130762121-130762143 TTGGAGCAGTTGGAGAAGGAGGG - Intergenic
1091055519 11:132414808-132414830 GTGTGCGAGAGAGAGAAGGAGGG + Intergenic
1091205040 11:133814908-133814930 TGGCGGGAGTGGGAGAGGCAGGG + Intergenic
1091676601 12:2495508-2495530 TTGTGGTGGTGGGAGAAGAAGGG - Intronic
1091678650 12:2510409-2510431 TTTTGGGAGTGTGAGAGGGATGG - Intronic
1091777831 12:3196139-3196161 TGGTGAGAGAGGGAGGAGGAGGG + Intronic
1091915774 12:4271200-4271222 TAGGGGGAGGGGGAGAGGGAAGG + Intergenic
1092040178 12:5377262-5377284 CTGTGAGAGTGGGAGAGAGATGG + Intergenic
1092074526 12:5662021-5662043 TTGAGGGTGGGGGAGAAGGGAGG - Intronic
1092140239 12:6178794-6178816 TTGTGAGAGTGGGGGAAAAAAGG - Intergenic
1092144181 12:6203255-6203277 GAGTGGGAATGGGAGAAGGGTGG + Intronic
1092217861 12:6695242-6695264 CTGAGAGACTGGGAGAAGGAAGG + Intronic
1092735718 12:11580627-11580649 CTGTGGGAGAGAGAGAAGTAAGG + Intergenic
1092861950 12:12725852-12725874 TGGAGGCAGTGGGAGCAGGATGG + Intergenic
1092903981 12:13085647-13085669 GTGTTGGGGTGGGAGAGGGAGGG - Intronic
1092945340 12:13449296-13449318 TTGTGGGGGAGGGCGAAGCAGGG - Intergenic
1093057473 12:14568990-14569012 CAGTGGGAGAGGGGGAAGGAGGG + Intergenic
1093490030 12:19695402-19695424 ATTTAGGAGTGGGAGGAGGAAGG + Intronic
1093703579 12:22250093-22250115 TTTTGGGAGTGGGAGTGGGGTGG - Intronic
1093767297 12:22979623-22979645 TGGTGGGACTGAGAGAAGGATGG - Intergenic
1093838602 12:23868051-23868073 GTGAGGGAGGGAGAGAAGGAGGG - Intronic
1094030217 12:26003429-26003451 TTCTGGCAGTGGGAGAAGTAAGG + Intronic
1094081936 12:26546333-26546355 GGGTGGGAGTGGGAAAATGAAGG - Intronic
1094161968 12:27400594-27400616 TTGTTGGAATGGAAGAAGAAAGG + Exonic
1094166491 12:27448848-27448870 GTGTGGGAGCGGGAGATTGAGGG - Intergenic
1094365985 12:29681660-29681682 TTGTGGGGGTGGGAGGGGGAGGG - Intronic
1094581872 12:31740710-31740732 CTGGGGGAGGGGGAGAAAGATGG + Intergenic
1094729778 12:33161573-33161595 CTGTGGGAGAGGGAGCATGAGGG + Intergenic
1094827081 12:34277838-34277860 GTGAGGGAGGAGGAGAAGGATGG - Intergenic
1095473670 12:42563942-42563964 TTTTCATAGTGGGAGAAGGATGG - Intronic
1095763260 12:45865249-45865271 TTTTTGGTGTGGGAGAAAGAAGG - Intronic
1096592429 12:52669778-52669800 GTGTGGGAATGGGAAAAGGTGGG + Intergenic
1096689208 12:53309138-53309160 TTCGGTGAGTGGGACAAGGATGG - Exonic
1097046855 12:56193386-56193408 TTGTTGGAGTGGAAGAGGAAGGG - Intergenic
1097229395 12:57500245-57500267 TGGTTGGAGTGGCAGGAGGAAGG + Intronic
1097246868 12:57611756-57611778 CTGTGGGAGGGGGGGAGGGAGGG - Intronic
1097653753 12:62336321-62336343 TTGAGGGGATGGGAGAAGGAGGG - Intronic
1097947328 12:65385198-65385220 TGGTGGGAGAAGGAGGAGGATGG + Intronic
1098101413 12:67021288-67021310 TTGGGGGACAGGAAGAAGGAGGG - Intergenic
1098123056 12:67263423-67263445 TTTTGAGATTGGGAGAAGGGAGG - Intergenic
1098164833 12:67684417-67684439 TTGGGGGAGTGGGAAGAGGTAGG - Intergenic
1098434785 12:70457127-70457149 GTTTGGGGGTGGGAGTAGGAAGG + Intergenic
1098499550 12:71174972-71174994 TGGAGGGACTGGGAGGAGGAGGG + Intronic
1098608103 12:72419505-72419527 TGGTGAGAGTGGGAGCAAGAGGG + Intronic
1098876539 12:75871858-75871880 CAGTGGGAGTGGGAGGAGGGAGG - Intergenic
1099136746 12:78914270-78914292 TTCTGTGAGTGGGAAAAAGATGG + Intronic
1099208799 12:79759648-79759670 TTGTGGGATGGGGAGAGGGGGGG - Intergenic
1100021259 12:90072006-90072028 GTGTGTGTGTGGGAGAGGGAGGG + Intergenic
1100353318 12:93805633-93805655 TTGTTGGGGAAGGAGAAGGAGGG - Intronic
1100860698 12:98803374-98803396 TCCAGGGAGCGGGAGAAGGAGGG - Intronic
1101095179 12:101331273-101331295 TGGTGGGAATGGGAGATGGATGG + Intronic
1101499535 12:105289427-105289449 TTGTGGGGTTGGGAATAGGAAGG + Intronic
1101510575 12:105389191-105389213 TCGGGGGTGAGGGAGAAGGAAGG + Intronic
1102193302 12:111005759-111005781 TGGTGGATGTGGGAGAGGGAAGG - Intergenic
1102245387 12:111352683-111352705 TGGTGGGAGTGGGAGGTGGCAGG + Intergenic
1102451504 12:113045076-113045098 GAGGGGGAGTGGGGGAAGGAGGG + Intergenic
1102457071 12:113077486-113077508 GTGTGGGAGTGGGAGAACGACGG + Exonic
1102599329 12:114017281-114017303 TTGTGGGAGGGGGAGGAGGGAGG + Intergenic
1102759172 12:115370405-115370427 GTGTGGGAGAGAGAGAGGGAGGG + Intergenic
1102849889 12:116231978-116232000 TTGTAGGAGTGTGGGAAGGCTGG - Intronic
1103059615 12:117847954-117847976 ACGTGGGAGGGGGAAAAGGAGGG + Intronic
1103175366 12:118858735-118858757 GTGTGGGGTTGGGAGAAGGGAGG + Intergenic
1103291948 12:119853941-119853963 CTTTGGGAGGGGGAGATGGAAGG + Intronic
1103297293 12:119898754-119898776 TTGTGGGGGTGGGTGGAGGGGGG - Intergenic
1103363246 12:120366455-120366477 TTCTGGGAGAAAGAGAAGGATGG - Intronic
1103633193 12:122279948-122279970 TTGTGGGAGTGAGAAGAGAAAGG + Intronic
1104568074 12:129903185-129903207 GTGTGGGAGTGTGTGGAGGATGG - Intronic
1104922625 12:132299043-132299065 TGGTGGGAGTGGGTGAGGTATGG - Intronic
1106320162 13:28630293-28630315 TTGTGGGAGTTGAATGAGGATGG - Intergenic
1106353813 13:28959623-28959645 TGGTGAGAGAGGGAGCAGGAGGG + Intronic
1106448163 13:29855106-29855128 TTGAGGGAGTGGGAGTGGGGAGG + Intergenic
1106833907 13:33613675-33613697 TTGAAGGAGTGAGAGAATGAAGG + Intergenic
1107144340 13:37042042-37042064 TTGTGGAAATGAGACAAGGATGG + Intronic
1107294432 13:38894621-38894643 TTGTGGGAGAGGGAGTATGCAGG - Intergenic
1107340427 13:39399585-39399607 TAGTGGAAGAGGGAGAAGCATGG + Intronic
1107417179 13:40211541-40211563 TTGTGGGAGATGGAAGAGGAAGG - Intergenic
1107497497 13:40941900-40941922 TTTTGGGAGCCTGAGAAGGAAGG - Intronic
1107866545 13:44708746-44708768 TGAAGGGAGTGGGAGAAGAAAGG - Intergenic
1109881805 13:68487737-68487759 GTGTGGGAGAGGGAGAAGGGAGG + Intergenic
1109923197 13:69097998-69098020 GTGTGTGAGAGGGAGAAAGAGGG + Intergenic
1110550346 13:76805030-76805052 TTGTGACAGTGCTAGAAGGATGG - Intergenic
1110551770 13:76818696-76818718 TAGTGGCAGTGGATGAAGGAAGG + Intergenic
1110661641 13:78064597-78064619 CTGTAGGAGTGGGGGAGGGAGGG - Intergenic
1111047598 13:82835139-82835161 TGGGGGTTGTGGGAGAAGGAAGG + Intergenic
1111212076 13:85092396-85092418 TTATAGGATTGGGAGAATGAAGG - Intergenic
1111707275 13:91765853-91765875 TTCAGTGAGTGGGAGAAAGAGGG + Intronic
1111934610 13:94546520-94546542 TGGTGTGGGTGGGGGAAGGATGG - Intergenic
1112161847 13:96876478-96876500 TTGTGAGAATGGGAGATTGAGGG + Intergenic
1112271234 13:97972313-97972335 TTCTGGAAGTGGGAGAAGGTTGG - Intronic
1113378013 13:109782545-109782567 TTGGGGTTGTGGGCGAAGGACGG + Exonic
1113781768 13:112981284-112981306 TTGTGGGAGCAGGAGAATGCAGG + Intronic
1113909664 13:113836219-113836241 GAGTAGGAGTGGGAGGAGGAAGG + Intronic
1114308513 14:21444971-21444993 ATGTGGTAGTGGGATAGGGATGG - Intronic
1114537551 14:23432570-23432592 GGGAGGGAGAGGGAGAAGGAAGG - Intronic
1114618283 14:24080052-24080074 GTGTGGGAGAGGGAGAGAGAGGG - Intergenic
1115475170 14:33806347-33806369 GTCTAGGAGTAGGAGAAGGACGG - Intergenic
1115486706 14:33917502-33917524 TTGGGGGAGTAGGTGAGGGAAGG - Intergenic
1116228398 14:42182880-42182902 ATGTGGCAGTGGGAGAAGACAGG + Intergenic
1116529832 14:45956436-45956458 TAGTGGCAGTGAGAGAAAGAAGG + Intergenic
1116805827 14:49493293-49493315 TTGGGGGAGTGGTAGTAGGTGGG - Intergenic
1117212478 14:53514946-53514968 TTTTTGGAATTGGAGAAGGAAGG - Intergenic
1118915341 14:70098240-70098262 TTATGGAATTGGAAGAAGGATGG - Intronic
1119866683 14:77980556-77980578 TGGCTGGACTGGGAGAAGGAAGG + Intergenic
1120155354 14:81087542-81087564 GTGTTGGAGTGGGAGGATGAGGG - Intronic
1120408794 14:84123999-84124021 CTACGGCAGTGGGAGAAGGATGG - Intergenic
1120566955 14:86071757-86071779 TTGTTGTAGTAGTAGAAGGAAGG + Intergenic
1121378032 14:93431385-93431407 TTGTTGGAGTGGGGGAAGGGGGG + Intronic
1121697836 14:95927923-95927945 TGGAGGGAGAGGGAGAGGGATGG - Intergenic
1121697861 14:95927999-95928021 TGGAGGGAGAGGGAGAGGGATGG - Intergenic
1121798383 14:96754120-96754142 GTGTGGAAGGGGGAGAGGGAAGG + Intergenic
1122418901 14:101563329-101563351 TTGTGGGGCTGGGAGGTGGAGGG + Exonic
1122776526 14:104119310-104119332 TGGGGGGAGTGGGAGCAGGCTGG - Intergenic
1123140107 14:106068090-106068112 TTGTGAGACAGGGAGAAGCATGG + Intergenic
1123170287 14:106366832-106366854 CTGTGTGAGAGAGAGAAGGAGGG + Intergenic
1123201605 14:106671359-106671381 TTGTGAGTGAGAGAGAAGGAGGG + Intergenic
1123675172 15:22703473-22703495 ATGTGGGAGGGAGAGAAAGAGGG - Intergenic
1123711377 15:22990225-22990247 GGGGAGGAGTGGGAGAAGGAGGG - Intronic
1123912892 15:24986899-24986921 TTGGTGGAGTGGTAGGAGGAGGG + Intergenic
1124327180 15:28776471-28776493 ATGTGGGAGGGAGAGAAAGAGGG - Intergenic
1124386058 15:29209027-29209049 ATGAGTGACTGGGAGAAGGAGGG + Intronic
1124465519 15:29936013-29936035 TTGAGGAAGAGGGAGAAGGTGGG - Intronic
1124529176 15:30488359-30488381 ATGTGGGAGGGAGAGAAAGAGGG - Intergenic
1124668509 15:31616016-31616038 CTGAGGGGGTGGGAGAAGAAAGG - Intronic
1124769485 15:32519334-32519356 ATGTGGGAGGGAGAGAAAGAGGG + Intergenic
1125270717 15:37935815-37935837 GTGTTGAGGTGGGAGAAGGAAGG + Intronic
1125280758 15:38040282-38040304 TTGTGGAAGTTGTAGCAGGATGG - Intergenic
1125303640 15:38285099-38285121 TGGAGGGAGAGGGAGCAGGAGGG - Intronic
1126187166 15:45841630-45841652 TTGTGGGAGTGGGAGCAGGCAGG - Intergenic
1126293977 15:47116640-47116662 TAGTGGGAGTGTGAGAGGGGAGG - Intergenic
1127269870 15:57390796-57390818 CTGTGGGAGGAGCAGAAGGATGG + Intronic
1127470096 15:59282865-59282887 AAGGGGGAGTGGGAGAGGGAGGG + Intronic
1127542759 15:59958524-59958546 TTGAGGGAGAGTGAGAAAGAAGG + Intergenic
1128005574 15:64237123-64237145 GTGAGGGAGTGGGAGGGGGAAGG + Intronic
1128146803 15:65336523-65336545 TGGGAGGAGTAGGAGAAGGAGGG - Intronic
1128157423 15:65400778-65400800 TGGAGGGGGTGGGAGAAGGAGGG - Intronic
1128612834 15:69087684-69087706 TTGAGGGAGTGAGAGAGGAAGGG + Intergenic
1128661490 15:69504406-69504428 TTGGGGGAGTGGGGAAAGGGAGG - Intergenic
1128666888 15:69544879-69544901 GTGTGGGAGTTGGCGAGGGATGG + Intergenic
1128765095 15:70246511-70246533 CTGTGGGTGTTGGAGCAGGACGG + Intergenic
1128868880 15:71137062-71137084 TTGTGGAAGGGAGAGAAGGTGGG + Intronic
1129162910 15:73757083-73757105 TAGTGGCAGTGGGATAGGGATGG - Intergenic
1129193833 15:73952808-73952830 GGGTGTGAGTGGGAGATGGAGGG + Intergenic
1129671066 15:77607895-77607917 TTGTGGAAGTTGGGGGAGGAGGG - Intergenic
1130048077 15:80461482-80461504 TTGTGGGAGTTTGAGAGGGCTGG + Intronic
1130437832 15:83919675-83919697 GTGTGGGTGTGGGTGAAGGGTGG + Intronic
1130459845 15:84152748-84152770 TTGGGGAAGTGGGGAAAGGAGGG + Intergenic
1130614646 15:85393106-85393128 TTTCTGGAGTGGGAGAAGGGAGG + Intronic
1130755318 15:86756614-86756636 TTCTGAGGGTGAGAGAAGGAGGG + Intronic
1131153679 15:90062245-90062267 TGCTGGGAGTGGGGGAAGGGAGG - Intronic
1131366501 15:91846311-91846333 TGGGGGGAGAGGGAGAGGGAGGG - Intergenic
1131386818 15:92014852-92014874 TTGAGGGAGGTGGAGGAGGAGGG + Intronic
1131389015 15:92032246-92032268 GTGTGGCAGGGGGAGAATGAGGG + Intronic
1131561551 15:93447800-93447822 TTGGGGGAGTGGGTGAGGGAAGG - Intergenic
1132868272 16:2104349-2104371 TTGGGGGAGGGGGATGAGGATGG + Intronic
1133064794 16:3198117-3198139 GAGAGGGAGAGGGAGAAGGAGGG + Intergenic
1133365213 16:5203731-5203753 TGGAGGGAGAGGGAGAGGGAGGG + Intergenic
1133392767 16:5422811-5422833 AGGAGGGAGTGGGAGGAGGAGGG + Intergenic
1133485491 16:6214952-6214974 GAGAGGGAGAGGGAGAAGGAGGG + Intronic
1133662446 16:7931925-7931947 TTGTGTGAGAGAGAGAAGAAGGG - Intergenic
1133813602 16:9179718-9179740 TGGTGGGAGTGAGAGCAGAAGGG + Intergenic
1134394929 16:13854001-13854023 GTGATGGAGTGAGAGAAGGAAGG + Intergenic
1134523463 16:14928670-14928692 TTGGGGGAGGGGGATGAGGATGG - Intronic
1134523474 16:14928696-14928718 TTGGGGGAGCGGGATGAGGATGG - Intronic
1134523483 16:14928722-14928744 TTGGGGGAGGGGGATAAGGATGG - Intronic
1134523494 16:14928748-14928770 TTGGGGGAGGGGGATAAGGATGG - Intronic
1134549398 16:15132172-15132194 TTGGGGGAGGGGGATAAGGATGG + Intronic
1134711057 16:16327154-16327176 TTGGGGGAGGGGGATGAGGATGG - Intergenic
1134711068 16:16327180-16327202 TTGGGGGAGCGGGATGAGGATGG - Intergenic
1134711077 16:16327206-16327228 TTGGGGGAGGGGGATAAGGATGG - Intergenic
1134711088 16:16327232-16327254 TTGGGGGAGGGGGATAAGGATGG - Intergenic
1134948486 16:18341351-18341373 TTGGGGGAGGGGGATAAGGATGG + Intergenic
1134948497 16:18341377-18341399 TTGGGGGAGGGGGATGAGGATGG + Intergenic
1134948506 16:18341403-18341425 TTGGGGGAGCGGGATGAGGATGG + Intergenic
1134948515 16:18341429-18341451 TTGGGGGAGCGGGATGAGGATGG + Intergenic
1134948526 16:18341455-18341477 TTGGGGGAGGGGGATGAGGATGG + Intergenic
1135331381 16:21562925-21562947 AGGAGGGAGAGGGAGAAGGAAGG - Intergenic
1135506169 16:23038367-23038389 TTCTGGAAGAGGAAGAAGGAAGG + Intergenic
1135660544 16:24292651-24292673 TTGTGGGAGAGAGATAAAGAGGG - Intronic
1136030621 16:27500043-27500065 TGGAGGGAGTGGGCGAGGGATGG - Intronic
1136381497 16:29898151-29898173 GTGTGGGAGTGGGAGTATGAGGG - Intronic
1136576070 16:31126155-31126177 TGCTGGCAGTGAGAGAAGGAAGG + Intronic
1136631540 16:31491932-31491954 GGGTGGGAGTGGGGGAAGGCGGG + Intronic
1137350746 16:47712355-47712377 TCCTGGGAGTGGGAGCAGAAAGG - Intergenic
1137649890 16:50110682-50110704 TTGGGGGAGTGTGAGATGGGAGG + Intergenic
1137787689 16:51151735-51151757 TTGTGGGGGGGGGCGAAGGAGGG - Intergenic
1138163899 16:54781707-54781729 ATGTGGATGTGGGAGTAGGAAGG - Intergenic
1138186813 16:54983440-54983462 TTGTGGGAGGGAGGGAAGGGGGG - Intergenic
1138299698 16:55915678-55915700 TTAAGGGAGAGAGAGAAGGAGGG - Intronic
1138552373 16:57754736-57754758 TTGGGGGAGAGGGAGGAGGCAGG + Intronic
1138557826 16:57783024-57783046 TTGTGGGAGTGGGGTAAGCTCGG + Intronic
1138558465 16:57786501-57786523 TTGGGGGAGAGAGAGAAGAATGG + Intronic
1138599472 16:58046256-58046278 TGGTGTGAGTCGGAGAGGGAGGG - Exonic
1139282514 16:65782952-65782974 TGGTGGGGCAGGGAGAAGGAAGG + Intergenic
1139290118 16:65850048-65850070 TTTTGTAAGTGGGAGAAGAAAGG - Intergenic
1139316409 16:66073730-66073752 TTGAGGGAGTGGAAAAAAGAAGG + Intergenic
1139835998 16:69838994-69839016 TTGGGGGGGTGGGGGAAGGGGGG + Intronic
1140191268 16:72819220-72819242 TTGGGGGTGGGGGAGAGGGAGGG - Intronic
1140213064 16:72986062-72986084 TTTTGGGAGTGGGAGATTGTGGG - Intronic
1140342126 16:74174716-74174738 TTTTGGGAGATGGAGAAGGGTGG - Intergenic
1140564671 16:76027337-76027359 TTGTGGGAGTGGGAGCACGCAGG - Intergenic
1141537226 16:84690597-84690619 TTGGATGAGTGGGAAAAGGAAGG + Intergenic
1141568405 16:84918985-84919007 TTTGGGGAGAGGGAGAAGGCAGG + Intronic
1141588159 16:85048971-85048993 GTGTGTGAGAGGGAGAGGGAGGG + Intronic
1141845286 16:86604237-86604259 TGGTGGGAGTGGGAGCAGGAGGG - Intergenic
1141923174 16:87149965-87149987 TGGTGGGGGAGGGAGCAGGAAGG + Intronic
1142125887 16:88410091-88410113 ATGTGGGGGTGGGGGAAGGAAGG + Intergenic
1142152201 16:88517544-88517566 GTGGGTGAGTGGGTGAAGGAGGG + Intronic
1142152832 16:88520304-88520326 GTGGGTGAGTGGGTGAAGGAGGG + Intronic
1142186423 16:88696915-88696937 TTGGGGGATTGGGGCAAGGATGG - Exonic
1142960099 17:3547241-3547263 TTGAGGGAGAGGGAGATGGCTGG + Intronic
1143196348 17:5078816-5078838 CCGTGGGGGTGGGAGAAGCAGGG + Intronic
1143280657 17:5751940-5751962 TGGTGGCAGTGGGAGAGGCAGGG + Intergenic
1143309518 17:5977011-5977033 TTGTGGGAGAGGGTGAGGGAGGG + Intronic
1143422903 17:6809641-6809663 TTGGGTGGGTGGAAGAAGGAAGG - Intronic
1143471067 17:7176325-7176347 GTGTGAGAGTGTGAGAATGAGGG - Intronic
1143471073 17:7176424-7176446 GTGTGAGAGTGTGAGAATGACGG - Intronic
1143532075 17:7511343-7511365 GTGTGGGAGTGGGAGGAGGAAGG - Intronic
1144334341 17:14255524-14255546 TTGTAGGAGAGGGAGGAGGAGGG - Intergenic
1145855851 17:28156564-28156586 TTGTGGGAGGGGGAGGGGGATGG + Intronic
1145991439 17:29081474-29081496 TTGGGGGAGCTGGAGAAGGGAGG + Intronic
1146313499 17:31789228-31789250 TTATTAGAGTGAGAGAAGGATGG + Intergenic
1146322501 17:31858145-31858167 TGATGGGAGTGGGAGAAGAGGGG - Intronic
1146510290 17:33441606-33441628 TCATGGGAGAAGGAGAAGGAAGG - Intronic
1146646902 17:34581854-34581876 TAAAGGGGGTGGGAGAAGGAGGG + Intronic
1146688897 17:34859632-34859654 TTGTGGGAGGGGGACAGGGAAGG - Intergenic
1146698436 17:34930687-34930709 ATGTTGTAGTGGGAGAAGGTAGG - Intronic
1147038069 17:37696493-37696515 TGGTGAGAGTGTGAGCAGGAGGG - Intronic
1147178563 17:38671554-38671576 TTGTGGGAGGAGGAGGAAGAAGG - Intergenic
1147306683 17:39569048-39569070 CTGTGGGTGTGGGAGGAGGAAGG - Intergenic
1147341760 17:39756524-39756546 ATGGGGGAGGGGAAGAAGGAGGG + Intergenic
1147512876 17:41086900-41086922 TTGTGGGGGTGGGGGGAGGGGGG + Intronic
1147996276 17:44362090-44362112 TTGCGGGTGGGGGAGAAGGGAGG + Intronic
1148393674 17:47291555-47291577 TGGTGGGAGGGGAGGAAGGAGGG + Intronic
1148397851 17:47324198-47324220 TGGTGGGGCTGGGTGAAGGAAGG + Intronic
1148662339 17:49344926-49344948 AGGTGGGAGTTGGGGAAGGAGGG - Intronic
1148664270 17:49362480-49362502 TGGGCGGAGTGGGAGAAGGCGGG - Intergenic
1148820389 17:50356491-50356513 TTGCTGGAGTGGGAGAGGCAAGG - Exonic
1149457099 17:56797029-56797051 TGGGAGGAGTGGGGGAAGGAGGG - Intronic
1149549631 17:57530819-57530841 TGGCGGGGCTGGGAGAAGGAGGG + Intronic
1149994430 17:61399422-61399444 CTCTGGGCGCGGGAGAAGGAGGG + Intergenic
1150575270 17:66425257-66425279 TGGTGGAGGTGGGAGAAGAAGGG - Intronic
1150717495 17:67584217-67584239 TTGTGTGAGTGGGAGTGGAATGG - Intronic
1150862517 17:68815932-68815954 TTGTGGGAGTGGGTGGTTGAAGG - Intergenic
1150866979 17:68861667-68861689 TTGAGGGAATAGGAGCAGGAAGG + Intergenic
1150975120 17:70077160-70077182 TTGCAGGAGTGGGAGTAGCAGGG + Intronic
1151049849 17:70965224-70965246 TTTTGGGAGGCTGAGAAGGAAGG + Intergenic
1151150955 17:72086462-72086484 TGGTGGGGATGGGAGGAGGAAGG - Intergenic
1151376994 17:73695911-73695933 TTGTGGGGGTGGGAAGATGAGGG - Intergenic
1151577350 17:74959393-74959415 TTTGGGGAGGGGTAGAAGGATGG - Intronic
1151677176 17:75604544-75604566 TTGTGGGAGGGAGGGAGGGAGGG - Intergenic
1151698854 17:75731908-75731930 TTGAGGCCGTCGGAGAAGGAAGG - Exonic
1151768106 17:76142359-76142381 TTGGAGGAGTGGGAGAGGCAAGG - Intergenic
1151948558 17:77333056-77333078 TGGTGGGAGTGTGAAATGGAAGG - Intronic
1152075238 17:78155420-78155442 TTGGGGGAGGGGTAGAAAGAAGG - Intronic
1152102650 17:78311653-78311675 TTGTGGGTGTGGGAGTGGGGAGG - Intergenic
1152167538 17:78720096-78720118 GAGGGGGAGTGGGAGAATGAAGG + Intronic
1152524431 17:80879426-80879448 ATGTGGGAGTGGGAGGAGAAAGG - Intronic
1152909270 17:82989339-82989361 TTGTGGAGGTGGGGGAAGGGAGG + Intronic
1152929022 17:83100659-83100681 CTGTGGGAGGGGGACAAGGTTGG + Intergenic
1152929060 17:83100756-83100778 CTGTGGGAGGGGGACAAGGGTGG + Intergenic
1152936078 17:83137572-83137594 CTCTCGGAGTGGGGGAAGGAAGG + Intergenic
1152940816 17:83172238-83172260 GGGTGGGAGTGGGAGCAGGAGGG + Intergenic
1153575070 18:6511957-6511979 CTGTGGGAGGTGGAGAAGCATGG - Intronic
1153946895 18:10026384-10026406 TTGCTGGGGTGGGAGAAGGCCGG - Intergenic
1154078194 18:11225816-11225838 TTGAGGGAGTGTGAGCAGGTGGG - Intergenic
1155242367 18:23875895-23875917 TGGTGGGAGTGTGAGATGCATGG - Intronic
1156034744 18:32753771-32753793 ATCTGGGAGGTGGAGAAGGAGGG - Intronic
1156508516 18:37615199-37615221 TTGTGGGAGAAGGACAAGGGTGG - Intergenic
1157404861 18:47414266-47414288 GTGTGGAGGTTGGAGAAGGAGGG + Intergenic
1157502232 18:48199635-48199657 GAGCGGGAGGGGGAGAAGGAGGG - Intronic
1157627211 18:49060727-49060749 GAGAGGGAGAGGGAGAAGGAGGG + Intronic
1157627222 18:49060771-49060793 GAGAGGGAGAGGGAGAAGGAGGG + Intronic
1157637351 18:49171697-49171719 TTGTAGGAGAGGAGGAAGGAGGG - Intronic
1157879195 18:51304094-51304116 TTGTGTGCTTGGGAGAGGGAAGG + Intergenic
1158412943 18:57223639-57223661 TAGTAGGACTGGGGGAAGGAAGG + Intergenic
1158599350 18:58843787-58843809 TTTTGGGGGTGGGGGAAGCAGGG - Intergenic
1159918279 18:74204739-74204761 GGGTGAGGGTGGGAGAAGGAGGG + Intergenic
1159918290 18:74204766-74204788 GGGTGAGGGTGGGAGAAGGAGGG + Intergenic
1159918309 18:74204820-74204842 GGGTGAGTGTGGGAGAAGGAGGG + Intergenic
1159918318 18:74204847-74204869 GGGTGAGTGTGGGAGAAGGAGGG + Intergenic
1159998810 18:74995668-74995690 TGGTGGGAGAGGCAGAAGGGAGG + Intronic
1161262607 19:3346123-3346145 TGGCTGGAGTGGGAGAAGGAGGG - Intergenic
1161470739 19:4455739-4455761 CCGGGGGAGTGGGAGGAGGATGG + Intronic
1162091457 19:8282831-8282853 TTTTGGGAGTGTGAGGAGGGAGG + Intronic
1162093693 19:8297684-8297706 TTTTGGGAGTGTGAGGAGGGAGG + Intronic
1162181924 19:8875782-8875804 GTGGGAGAGTGGGAGAAGGGTGG + Intronic
1162777623 19:12989569-12989591 TTGTGTGTGTGGATGAAGGATGG + Intergenic
1162964807 19:14150789-14150811 TGGTGGGAGAGGGAGACAGATGG - Exonic
1164245172 19:23422054-23422076 GTGTGGGAGTGAGGGTAGGATGG + Intergenic
1164262351 19:23579122-23579144 TTTTGGCAGTGGGAGGGGGATGG + Intronic
1164536140 19:29087762-29087784 ATCTGGGGGTGGGAGAAGCAAGG + Intergenic
1164561654 19:29296543-29296565 TACCGGGAGTGAGAGAAGGAAGG - Intergenic
1164692592 19:30222474-30222496 TGTTGGGAGTGGGAGGTGGAGGG - Intergenic
1165343937 19:35231872-35231894 CTGTGGCATTGGGACAAGGATGG + Intergenic
1166179385 19:41096032-41096054 TGGGGGCAGTGGGGGAAGGAAGG + Exonic
1166269487 19:41705286-41705308 TTGTGGGATTGGGACAAGGGAGG + Intronic
1166283294 19:41809199-41809221 TGGAGGGAGGGAGAGAAGGAGGG + Intronic
1166566742 19:43770169-43770191 TTGTGGGAGTGGGAGAAGGATGG - Intronic
1166623400 19:44326388-44326410 GTGTGTGAGTGGGAGAAGTATGG + Intergenic
1166711731 19:44942088-44942110 GTGTGGGAGGGTGAGAAGGAGGG + Intergenic
1166895384 19:46019098-46019120 TTGTGGGAGGGAGAGAAGGAGGG + Intronic
1166980837 19:46631208-46631230 TGGTGGGAGTGGGACACAGAGGG - Intergenic
1166993157 19:46705154-46705176 TTGTTGCAGTGGGAAAAGGTGGG - Intronic
1167095376 19:47372618-47372640 TGGAGGGGGTGGGAGCAGGAGGG + Intronic
1167108549 19:47445691-47445713 TTGTGGGGGTGGGGGACAGAGGG + Intronic
1167112756 19:47471742-47471764 GTGGGGGCGTGGGAAAAGGACGG - Intronic
1167320863 19:48796538-48796560 TTGTGGGTGGGAGGGAAGGAGGG - Intronic
1167787000 19:51645344-51645366 TTGGGGGGTTGGGAGCAGGAAGG + Intronic
1167924336 19:52810897-52810919 TGGAGGGAGAGGGAGAGGGAGGG - Intronic
1168123328 19:54267354-54267376 TTTTTGGAGTGGGGGAGGGAGGG + Intronic
1168256404 19:55168020-55168042 TTGGGAGAGTGGGAGAAATAGGG - Intergenic
1168322092 19:55516944-55516966 TTGCGGGAGCGGGTGCAGGAGGG - Intronic
1168594109 19:57661237-57661259 TTGAGGTTGTGGAAGAAGGAGGG - Intergenic
1168626219 19:57920275-57920297 TTGGGGGAGCGGGAGAGAGACGG - Intergenic
925910700 2:8571900-8571922 GAGGGGGAATGGGAGAAGGAGGG - Intergenic
926221137 2:10936216-10936238 GAGTGGGAGTGGGTGAATGACGG + Intergenic
926373495 2:12204096-12204118 GTGTGGGAGGGGCTGAAGGATGG + Intergenic
926464794 2:13175212-13175234 TTGTGGGAGAGGGAGCATGCAGG + Intergenic
926589058 2:14720265-14720287 GTGTGAGAGAGGGAGAGGGAGGG - Intergenic
927606632 2:24491731-24491753 TCGGGGAAGTGGGAGGAGGATGG - Intergenic
928255809 2:29721337-29721359 ATGTGGTAGTGGGAGAAGAGGGG + Intronic
928334275 2:30382857-30382879 TTGAGGGGGTAGGGGAAGGATGG - Intergenic
928692626 2:33816700-33816722 TGGAGGGAGGGAGAGAAGGAGGG - Intergenic
929382082 2:41365229-41365251 GGCTGGGAGTGGGAGAATGATGG - Intergenic
929582876 2:43094514-43094536 CTGTGTGAGTGGGAGAGAGAAGG - Intergenic
929583078 2:43096504-43096526 CTGTGTGAGTGGGAGAGAGAAGG - Intergenic
929873413 2:45776686-45776708 TGGAGGGAGGGGGAGAAGCAGGG - Intronic
929886075 2:45879666-45879688 TCGTGGGAGGGGGAGCAGGCAGG - Intronic
929948031 2:46384958-46384980 GTGTGTGAGAAGGAGAAGGAGGG - Exonic
930176596 2:48307195-48307217 GAATGGGAGTGGTAGAAGGAGGG - Intergenic
930380592 2:50622856-50622878 TTTTGGGGTTGGGAGGAGGAGGG + Intronic
930881879 2:56279411-56279433 TGGTGGGAGGGGGAGAAATAAGG - Intronic
931262605 2:60633107-60633129 TTGGGGGAGTGGATGAAGGGTGG + Intergenic
931769261 2:65483739-65483761 TTGGGAAAGTGGGAGAAAGATGG - Intergenic
932498168 2:72157873-72157895 GTGAGGGAGAGGGAGGAGGATGG + Intergenic
932777160 2:74535277-74535299 TTCTGAGAGTGAGTGAAGGAGGG - Exonic
933665465 2:84961053-84961075 TGGTGAGGGTGGGAGATGGAGGG - Intergenic
933894125 2:86795008-86795030 GTCTGGGAGTGGGAGGGGGAAGG - Intronic
934160411 2:89244261-89244283 TTTTGGGAGTGGGAGAAAAGGGG + Intergenic
934493920 2:94781392-94781414 GTGTGGGGGTGGGAGAAAAAAGG - Intergenic
934607200 2:95705276-95705298 GTGTGTGTGTGTGAGAAGGATGG - Intergenic
934945056 2:98534784-98534806 TTGGGGGAGTGAGAGTTGGAGGG + Intronic
935206851 2:100903732-100903754 CTGTGGGAGTGGGAGGCTGAAGG - Intronic
935370095 2:102336338-102336360 TTGGGTGAGTGTGAGAATGAAGG + Intronic
935418137 2:102840215-102840237 ATGAGGGAGTGGGAGGTGGAGGG + Intronic
935641271 2:105292642-105292664 GAGGGGGAGAGGGAGAAGGAGGG + Intronic
936004565 2:108872219-108872241 TGGGGGGAGGAGGAGAAGGAGGG - Intronic
936071127 2:109371992-109372014 TTGGGGGAGTTGGAGAAGCATGG - Intronic
936980028 2:118255679-118255701 TGGGGGGAGTGAGAGGAGGAGGG - Intergenic
937506627 2:122544838-122544860 TTGTGTGAGTTGGGGAAAGAAGG + Intergenic
937542407 2:122974219-122974241 TTGTGGGAGGGGGAGGGGGAAGG - Intergenic
937839693 2:126512785-126512807 TTCTGGGAGTGGGAGGAGTCAGG - Intergenic
937872205 2:126793879-126793901 ATGGGGGAGGGGGAGAGGGAGGG + Intergenic
937911192 2:127076370-127076392 TTGGGGGAGGGGGAGGGGGAGGG - Intronic
938094248 2:128451324-128451346 TTCTGGTAGTGGCAGCAGGAAGG + Intergenic
938096096 2:128465280-128465302 TTGGAGGAGTGGGGGCAGGAAGG - Intergenic
938577428 2:132618057-132618079 TTCTTGGAGTGGGAAATGGAGGG - Intronic
938757281 2:134392541-134392563 TGGTGGGAGCAGGGGAAGGAAGG + Intronic
938889812 2:135692798-135692820 CTGTGGTAGTGGCAGTAGGAGGG + Intronic
939314341 2:140528534-140528556 CTTTGGGAGGGGGACAAGGATGG + Intronic
939340930 2:140895442-140895464 TCGTGGGAAGGGGAGAAGGCAGG + Intronic
939454902 2:142421420-142421442 TGGTAGGATGGGGAGAAGGATGG + Intergenic
939500314 2:142975620-142975642 TTGTGGGAGGGGGAGCATGCAGG - Intronic
939705092 2:145442599-145442621 TTGTGGGGGTGGGGGGAGGGGGG + Intergenic
939900886 2:147847981-147848003 TTGTGGGAGCTGGAGCAGTATGG + Intronic
940063982 2:149606322-149606344 TTGGGAGATTGAGAGAAGGAAGG - Intergenic
940106917 2:150111477-150111499 ATGATGGAGTGGGAGGAGGAAGG - Intergenic
940156021 2:150658061-150658083 TGGTGGGAGAGGGAGCAAGAGGG - Intergenic
940374185 2:152938850-152938872 TCATGGGAGAGGGTGAAGGAGGG - Intergenic
941091765 2:161184993-161185015 AAGTGGGAGATGGAGAAGGAAGG + Intronic
941258108 2:163259196-163259218 TTGTGGGTTTAGGGGAAGGAGGG - Intergenic
941442458 2:165555249-165555271 TGGTGGAAGTGGGAGAAAAAGGG - Intronic
941591659 2:167427871-167427893 TTGTGGAAGAGGGAAAAAGAAGG - Intergenic
941926054 2:170896104-170896126 GTCTGGGATTGGGAGACGGATGG - Intergenic
942481986 2:176398389-176398411 AAGTGGGATGGGGAGAAGGAAGG - Intergenic
942491428 2:176493455-176493477 TTGGTGGAGTGGGAGGAGGCTGG + Intergenic
942539732 2:177003060-177003082 TGGTGAGAGTGGGAGCAAGAAGG + Intergenic
942568927 2:177293881-177293903 GTGTTGTAGGGGGAGAAGGAGGG - Intronic
942601910 2:177650098-177650120 ATGGGGGAGTGGGAGGAGGGAGG - Intronic
943757201 2:191569151-191569173 CTGTGGGAGGGGGAGAGGGGAGG + Intergenic
944593891 2:201244381-201244403 CTGTAGGAGAGAGAGAAGGAAGG + Intronic
944945375 2:204678165-204678187 TTGTGGGAGGGGGAGCACGCAGG + Intronic
945047921 2:205798355-205798377 TTGTGGGAGGGGGAGAACACAGG + Intergenic
946097933 2:217291655-217291677 TTGTGGGAGGGAGAGCAGGCAGG + Intronic
946179856 2:217942747-217942769 TTGTGGGGGTGAGAATAGGAGGG - Intronic
946259139 2:218470953-218470975 TTGAGGGAGGGAGAGAGGGAGGG + Intronic
946414914 2:219535125-219535147 CAGTGGGAGTTGGAGAAGGGTGG - Intronic
946687946 2:222290763-222290785 CTGCTGGAGGGGGAGAAGGAGGG + Intronic
947692839 2:232155324-232155346 TGGTGGGAGGGTGAGGAGGAGGG - Intronic
948375069 2:237515870-237515892 GAGTGAGAGTGGGAAAAGGAAGG - Intronic
948422327 2:237867488-237867510 GGGTGGGGGTGGGAGAGGGATGG + Intronic
948426724 2:237892762-237892784 GTGGGGGAGGGAGAGAAGGATGG - Intronic
948487691 2:238291245-238291267 TGGTGGGAGTGGGTGGAGCAGGG - Intergenic
949043700 2:241860700-241860722 GGGTGGGAGAAGGAGAAGGAAGG - Intergenic
1168949550 20:1787228-1787250 TTGGGGGCTGGGGAGAAGGAGGG + Intergenic
1169123444 20:3110889-3110911 TTGGGGAAGTGTGAGAAGGGAGG + Intronic
1169204125 20:3730596-3730618 ATGTGGGGGTGGGGGAAGGAGGG + Intergenic
1169213197 20:3778863-3778885 TTGTGAGAGTGGAAGTAGGGAGG - Intronic
1169224197 20:3846358-3846380 CTGTGGGAGTGGGAGCGGGCGGG - Intergenic
1169269423 20:4187790-4187812 TTGAGTGAGAGGGAGAAGGTTGG + Intergenic
1169292412 20:4364137-4364159 TTGAGGGATGGGAAGAAGGATGG + Intergenic
1169944591 20:10975066-10975088 GTCTGTTAGTGGGAGAAGGAGGG + Intergenic
1170329578 20:15193752-15193774 CTGTGAGAGTAGGAGAATGAAGG - Intronic
1170884246 20:20325389-20325411 TTGTGGGGGAGGCAGGAGGAAGG - Intronic
1171057457 20:21921156-21921178 TTAGGGGAGTGAGACAAGGAAGG - Intergenic
1171202687 20:23254700-23254722 GGGAGGGAGTGAGAGAAGGAGGG + Intergenic
1171391232 20:24802824-24802846 AGGTGAGAGGGGGAGAAGGAAGG + Intergenic
1171517250 20:25747398-25747420 TTGTTGGGGTGGGAGGAGCAGGG - Intergenic
1172004117 20:31805891-31805913 ACGTGGGAGTAGGGGAAGGAAGG - Intergenic
1172011042 20:31845702-31845724 TTGTGGGAGTGGGGCGAGGGAGG - Intergenic
1172801276 20:37578028-37578050 GTGTGGGGTTGGGGGAAGGAAGG - Intergenic
1172836983 20:37879318-37879340 ATGTGGGAGTGGGGCAGGGAAGG - Intergenic
1172869255 20:38125682-38125704 TTGATGGAGTCGGAGAAGGAGGG - Intronic
1172901271 20:38336583-38336605 TTGGGGGAAAGGGAGAGGGAGGG - Intronic
1173005597 20:39137514-39137536 TAATGGGAGAGAGAGAAGGAAGG - Intergenic
1173074969 20:39809357-39809379 TTCTGGGAGAGAGAGAAGGGAGG + Intergenic
1173178360 20:40782701-40782723 GAGAGGAAGTGGGAGAAGGAGGG + Intergenic
1173869229 20:46331287-46331309 TCGGGGGAGTAGGGGAAGGAGGG + Intergenic
1173876671 20:46376626-46376648 TTGTGGGAGTGAGGACAGGATGG - Intronic
1174276864 20:49410195-49410217 ATGTGTGAGGGGGAGAAGCAGGG + Intronic
1174468903 20:50740884-50740906 ATGAGGGAGTGAGAGAATGAGGG - Intronic
1174530791 20:51212013-51212035 TGTTGAGAGTGGGAGAGGGAGGG + Intergenic
1174899050 20:54479374-54479396 TTGAGGGGCTGGGGGAAGGAGGG + Intronic
1175347304 20:58289345-58289367 GTGGGGGAGTGGGAGAAGGGAGG - Intergenic
1175356848 20:58375407-58375429 ATGGGGGAGGGGGAGGAGGAGGG - Intergenic
1175406954 20:58741184-58741206 TGGTGGGAGTCTGAGAAGGTGGG - Intergenic
1175633178 20:60559293-60559315 GGGTGGGTGTGGGTGAAGGAGGG - Intergenic
1175745778 20:61456008-61456030 TGGAGGGAGGGAGAGAAGGAAGG + Intronic
1176100518 20:63362351-63362373 TGGGGGGAGGAGGAGAAGGAAGG - Intronic
1177903166 21:26942324-26942346 TTGTGGAACTGGGAAAAAGACGG + Intronic
1178951978 21:36992789-36992811 GAGTGGAGGTGGGAGAAGGATGG - Intergenic
1179078831 21:38150959-38150981 GTGTGATAGTGGGAGGAGGATGG + Intronic
1179608100 21:42531288-42531310 GGGTGGGGGTGGGAGAAGAAAGG - Intronic
1179932697 21:44580631-44580653 GTGTGTGAGTGAGTGAAGGAGGG + Intronic
1180729765 22:17972644-17972666 TTGGGGCAGCAGGAGAAGGAAGG + Intronic
1181120363 22:20663963-20663985 TTGTGGATCTGGGAGAAGGGTGG + Intergenic
1181410257 22:22713439-22713461 TTGTGTGAGTTAGAGAATGAAGG + Intergenic
1181546516 22:23605515-23605537 TAGTGGGAGGAGGAGGAGGAGGG + Intergenic
1181698027 22:24603617-24603639 GTATGCGAGTGGGTGAAGGAGGG + Intronic
1181964651 22:26647889-26647911 TGGGGGCCGTGGGAGAAGGAAGG + Intergenic
1182170427 22:28223195-28223217 TTGTGGGATGGAAAGAAGGAAGG - Intronic
1182541261 22:31043802-31043824 TTTTGGGAAAGGGAGCAGGAAGG + Intergenic
1182692058 22:32171102-32171124 TTGGGGGATAGGGAGGAGGATGG + Intergenic
1182727071 22:32456399-32456421 TTGAGGGAGGGAGGGAAGGAGGG - Intronic
1182773142 22:32810425-32810447 TTGTGGGGGTGGGGAAGGGAAGG + Intronic
1182865947 22:33604560-33604582 TGTGGGGAGTGTGAGAAGGAAGG + Intronic
1183040332 22:35173010-35173032 GTGAGGTAGTGGGAGAGGGATGG + Intergenic
1183172392 22:36197924-36197946 AGGTGGGTGTGGGACAAGGAGGG - Intronic
1183501247 22:38181059-38181081 CTGTGGGTGTGGGACAGGGAGGG - Intronic
1183656865 22:39190989-39191011 GTGTGGGGGTGGGAGAGGAATGG + Intergenic
1183914853 22:41109719-41109741 TTTTGGCAGGGGGAGGAGGACGG + Intronic
1184079093 22:42205279-42205301 TTGTGGGAAGGGAAAAAGGAAGG + Intronic
1184127190 22:42495956-42495978 TTGTGAGAGTGGGAGGAGTCAGG - Intergenic
1184134298 22:42537592-42537614 TTGTGAGAGTGGGAGGAGTCAGG - Intergenic
1184134578 22:42539601-42539623 TTGTGAGAGTGGGAGGAGTCAGG - Intergenic
1184526972 22:45029944-45029966 TCTTGGGAGCGGGAGAAGCAGGG - Intergenic
1184581181 22:45418825-45418847 TGGTAGGAGTGGGAGAAGAATGG - Intronic
1184707392 22:46224058-46224080 TTGTGGGTGTGGGTGGAAGAGGG - Intronic
1184840777 22:47051161-47051183 CTGAGGGAGTGGGAGCAGGGAGG + Intronic
1185181373 22:49365442-49365464 TGGTGGGAGGGGGAGCAGCAGGG - Intergenic
1185207133 22:49546372-49546394 GTGTGGGAGGTGGAGAAGAAGGG - Intronic
1185272598 22:49935847-49935869 CTGGGGGTCTGGGAGAAGGAGGG + Intergenic
1185372040 22:50465433-50465455 TGGTGGGAGGGGCAGAAGGATGG - Intronic
949433521 3:4003911-4003933 TGGTGGGAGGGAGAGAAGGAAGG + Intronic
949491600 3:4594698-4594720 TGGTGGGGGTGGGAGGTGGAGGG - Intronic
949535015 3:4988849-4988871 TGGAGGGAGGGAGAGAAGGAGGG + Intergenic
949905490 3:8855144-8855166 ATGTGTGAGTGGAAGAAGGGAGG - Intronic
950006853 3:9697006-9697028 TTTTGGGGGTGGGAGGAAGAAGG - Intronic
950466408 3:13157776-13157798 CTGTGGCAGAGGGAGAAGAAAGG + Intergenic
951103071 3:18711571-18711593 TTGGGAGAGTGTGAGAAGAAGGG + Intergenic
951234991 3:20224008-20224030 TTGGGGTAGTGGGTGAGGGAGGG + Intergenic
951292363 3:20888667-20888689 TTCTTAGAGTGGGAAAAGGAAGG + Intergenic
951460937 3:22951171-22951193 TTTTTGGAGTGGGGCAAGGAAGG - Intergenic
951773936 3:26287704-26287726 TTATGGGAGAGGGAGAAGAGGGG + Intergenic
952203261 3:31152409-31152431 TGTTGGGAGTGGGAGAGGGGTGG + Intergenic
952383943 3:32825600-32825622 GGGTGGGAGTGGGAGAAGGGGGG - Intronic
952869510 3:37886004-37886026 CTGTGGCAGTGGGAAATGGAGGG - Intronic
953126498 3:40095871-40095893 TGGTAGGAGAAGGAGAAGGAGGG - Intronic
953958111 3:47246936-47246958 ATGTTGGAGTGGGCCAAGGAGGG - Intronic
954264042 3:49459685-49459707 TTGGGGGATTGGGAGTAGGGAGG + Intergenic
954698986 3:52441911-52441933 TAGTGGGAGGGAGAGAGGGAGGG + Intronic
954712073 3:52510121-52510143 ATCTGGGGGTGGGTGAAGGAGGG - Exonic
954921152 3:54192173-54192195 TTCTGGAAGTGGGAGGATGAAGG - Intronic
955166413 3:56518602-56518624 ATGTGGGAGGGAGGGAAGGAAGG + Intergenic
955227658 3:57074339-57074361 TGGTGGGGGTGGGGGATGGAAGG - Exonic
955480924 3:59389133-59389155 TTGTGAGCGTGGGAGAGAGAGGG + Intergenic
955551672 3:60091759-60091781 TGGTGGGAGCAGGAGAAGAAAGG - Intronic
955692902 3:61607568-61607590 TTTTGGTAGTGGTAGAGGGAAGG + Intronic
955965061 3:64380577-64380599 TTGTCTGAGTGGGCTAAGGATGG + Intronic
956208241 3:66776180-66776202 TTGATGGATTGAGAGAAGGATGG + Intergenic
956259970 3:67328839-67328861 TTCTGGGAGTGGGAGAGAAAGGG + Intergenic
956302112 3:67783236-67783258 GAGTGGGGGTTGGAGAAGGAGGG - Intergenic
957039857 3:75328518-75328540 GTGTGGGGGTTGGAGAAGAAGGG - Intergenic
957280490 3:78145155-78145177 TAGTGGGGGTGGGAGAAGGTGGG - Intergenic
957416971 3:79917578-79917600 TAGTGGGAGGGAGAGAGGGAGGG + Intergenic
958461130 3:94397270-94397292 ATGAGGGAGTAGGAGAGGGATGG + Intergenic
958466729 3:94469352-94469374 TTGTGGGAGGGGGAGCATGCAGG + Intergenic
958864563 3:99485798-99485820 TTGTGGCAGTGGGAGACAGCAGG + Intergenic
959295306 3:104528131-104528153 TTGTGGGATGGGGGGCAGGAGGG - Intergenic
959802622 3:110512966-110512988 CTGTGAAAGTGGGAAAAGGAGGG - Intergenic
960254657 3:115499182-115499204 TAGTGGGAGGGTGACAAGGAAGG + Intergenic
960372017 3:116852466-116852488 ATGGGGCAGTGGGTGAAGGAGGG - Intronic
960532688 3:118782696-118782718 TTGGGGCAGAGGGAGAAGGAGGG + Intergenic
960634351 3:119768604-119768626 TTGGGGGACTGGGAGCAGGCAGG - Intergenic
961432247 3:126891426-126891448 TAGTGGGAGTGGGAGATGGGCGG + Intronic
961503235 3:127352117-127352139 TTGTGGGAGTGGCAAGAGGAGGG + Intergenic
961518058 3:127450778-127450800 CTGTGGGAGTTGGGGGAGGATGG + Intergenic
961528909 3:127527389-127527411 GTGAGGGAGTGAGGGAAGGAGGG - Intergenic
961843853 3:129743369-129743391 TAGAGGGATTGGGATAAGGAAGG + Intronic
962151363 3:132896905-132896927 TGTTGGGAGGTGGAGAAGGAGGG + Intergenic
962345937 3:134619088-134619110 CTGTGGAAGAGGGAGAGGGATGG + Intronic
962580585 3:136794402-136794424 TTGGGGAAGTGGGAGATGGAAGG - Intergenic
962710482 3:138081654-138081676 CTGGGGGAGAGGGAAAAGGAGGG + Intronic
962801972 3:138898179-138898201 TATAGGGAGAGGGAGAAGGATGG - Intergenic
962839409 3:139220446-139220468 TTGTGGGAGTGGGGCAGGGTGGG + Intronic
963000514 3:140677397-140677419 TTTTTGGAGTGGGGGTAGGATGG + Intergenic
963534704 3:146513157-146513179 GTGAGGAAGGGGGAGAAGGAGGG - Intergenic
963841811 3:150115538-150115560 TCCTGGGGGTGGGAGAACGAGGG - Intergenic
963920454 3:150900025-150900047 GCCTGGGAGTGGGAGAAGGTGGG + Intronic
964313013 3:155414377-155414399 TCGTGGGAGTAGGAGGAGAAAGG - Intronic
964871288 3:161316205-161316227 TTGGGGGAGTGGGAGGAGATGGG + Intergenic
965028224 3:163329257-163329279 TTGTGGCTGTGGGAGAAACAAGG + Intergenic
965688976 3:171335009-171335031 TTTTGGCAGTTGGGGAAGGAAGG - Intronic
966563672 3:181351917-181351939 TGGTGAGAGTGGGAGCAAGAGGG - Intergenic
966748857 3:183303215-183303237 TGGTGGGAGTGAGTGGAGGAGGG - Intronic
967221410 3:187250924-187250946 TTCTGGGGGTGGGAGAGTGAGGG + Intronic
967350676 3:188511041-188511063 AGGAGGGAGAGGGAGAAGGAAGG - Intronic
967416986 3:189230139-189230161 TTGTGGGAAAGAGAGAAGGATGG + Intronic
967422262 3:189286620-189286642 AATTGGGACTGGGAGAAGGATGG + Intronic
967467640 3:189825936-189825958 GTGGGGGAGAGAGAGAAGGAGGG - Intronic
967668164 3:192199757-192199779 TTTTCAGAGTGGGAGGAGGAGGG - Intronic
967765461 3:193274473-193274495 GTGTGGAAGTGGTAGAATGAAGG - Intronic
968130992 3:196192699-196192721 AAGTGGGAGGGAGAGAAGGAGGG + Intergenic
968132550 3:196200044-196200066 TTTTGGGAGGTGGAGAAGGGAGG + Intronic
968190698 3:196665137-196665159 AGGTCGGAGTGGGAGAAGCAGGG - Intronic
968502940 4:959548-959570 CTGGGGGCGTGGGAGCAGGAGGG + Exonic
968801249 4:2744559-2744581 CTGTGGGGGTGGGAGAAGCCTGG - Intronic
969149867 4:5160456-5160478 TGTGGGGAGGGGGAGAAGGAAGG - Intronic
969224250 4:5784316-5784338 GGGTGGGAGTCAGAGAAGGAGGG + Intronic
969349670 4:6591166-6591188 CTGGAGGAGTGGGAGAGGGAAGG + Intronic
969473966 4:7410588-7410610 TTTAGGTAATGGGAGAAGGAAGG - Intronic
969587880 4:8104952-8104974 GGGTGTGAGTGGGAGCAGGAGGG - Intronic
969657170 4:8505023-8505045 TGGAGGGAGTGGGACATGGAGGG - Intergenic
969663202 4:8542447-8542469 TTGAGGTCCTGGGAGAAGGATGG + Intergenic
969870845 4:10103790-10103812 TTGGGAGAGTGGGAGGAGGGAGG - Intronic
970558451 4:17259269-17259291 TTGTGGGGGTGGGGGGAGGGGGG - Intergenic
971558282 4:28040838-28040860 TTGGGGATGTGGGAGGAGGATGG + Intergenic
971709665 4:30094309-30094331 AGGAGGGAGTGAGAGAAGGAAGG + Intergenic
972023748 4:34350604-34350626 TGTTGAGAGTGAGAGAAGGAAGG + Intergenic
972083466 4:35182987-35183009 TTTTGATTGTGGGAGAAGGAGGG - Intergenic
972125634 4:35761298-35761320 TAGTTGGAGTGGAGGAAGGAGGG - Intergenic
972204370 4:36754108-36754130 TCGTGAGAGTGGGGGAAGGGGGG + Intergenic
972270884 4:37509973-37509995 CCGTGGGAGAGGGAGAGGGAGGG + Intronic
972350927 4:38235710-38235732 TTGTGGATCTGAGAGAAGGATGG + Intergenic
972539615 4:40027986-40028008 TTGTGGGAGTGGGGAAGGGGTGG + Intergenic
972591496 4:40492405-40492427 TTGCGAGAGTGGGAGAAGTATGG + Intronic
974022715 4:56706002-56706024 AGTTGGGAGTGGGAGGAGGAAGG - Intergenic
974295141 4:59988474-59988496 CTGTGGGAGTGGGACAAGGAAGG + Intergenic
974791353 4:66694114-66694136 TTGTTTGTGTGGGGGAAGGAGGG - Intergenic
975246939 4:72130650-72130672 TTGTGGGAGGGGGAGCATGCAGG + Intronic
975912763 4:79287673-79287695 GTGTGTGAGTGAGAGAAAGAGGG + Intronic
977294768 4:95198331-95198353 TTGTGGGAGAGAGAGATGGAAGG + Intronic
977323716 4:95549283-95549305 TGGGGGGAGTTGGAGGAGGAGGG + Intergenic
977566292 4:98583973-98583995 AGGTGGGAGTGGGAGAGGGAGGG - Intronic
977664799 4:99633527-99633549 TGGTGGAATTGGGAGATGGAGGG + Intergenic
977781086 4:100981594-100981616 TTGTGGAAGTGTGAGAATGGAGG - Intergenic
978082987 4:104617059-104617081 TTGTGGGAGTGAGACAAAGCAGG - Intergenic
978096496 4:104785340-104785362 GGGTGGGGGTGGGAGTAGGATGG - Intergenic
978829387 4:113066179-113066201 TTGTGGGGCTGGGGGGAGGAGGG - Intronic
978924830 4:114230961-114230983 TGGTGGGAGCAGGAGAAAGAGGG + Intergenic
978977210 4:114892737-114892759 TTGTGGGGGTGGGAGTTGGGAGG + Intronic
979245813 4:118503076-118503098 TTGTTGGAGTGGGATAGGGAGGG + Intergenic
979493801 4:121361874-121361896 TGTTGGGAGTGGGCAAAGGAAGG - Intronic
979728456 4:123992573-123992595 TTGTGGGAGGGGGAGCATGCAGG - Intergenic
980800269 4:137738996-137739018 TTGTGGGAGAGGTGGAAGTATGG - Intergenic
980897532 4:138874474-138874496 GCATGGGAGAGGGAGAAGGAGGG + Intergenic
981486287 4:145290047-145290069 GTTTGGGAGTGGGAGGAGGTTGG - Intergenic
981659204 4:147146302-147146324 GTGTGGGGGTGGGAGAGGCAGGG + Intergenic
981728057 4:147868673-147868695 CAGTGGGGGTGGGAGAAGGTAGG + Intronic
981762536 4:148209864-148209886 TTGGGGGAGTGGGAAAAGGCTGG - Intronic
982699634 4:158645209-158645231 TTGTGTGAGTGGTAGAATTATGG + Intronic
983254220 4:165379592-165379614 TGGTGGCGGTGGGGGAAGGAGGG + Intronic
984097999 4:175455169-175455191 TTGTGGGAGTGGGAGTGAGCAGG + Intergenic
984694673 4:182767668-182767690 TAGTGAAAGTGGGAGAAAGATGG + Intronic
984740712 4:183158822-183158844 TTGTGGGAGTGGGCATAGGAAGG + Intronic
984817156 4:183849420-183849442 CTGTTGGGGTGGGAGAAGGAAGG + Intergenic
985526157 5:403032-403054 GTGTGGGAGGGGGATAAAGAAGG + Intronic
985660158 5:1153093-1153115 CTGTGGGGGTTGGAGGAGGATGG - Intergenic
986139577 5:5017397-5017419 GTGTGGGTGTGGGAGAGGGATGG + Intergenic
986401710 5:7388639-7388661 TGCTGAGAGTGGGTGAAGGAGGG + Intergenic
986630634 5:9768594-9768616 GAATGGGAGTTGGAGAAGGAGGG - Intergenic
986791612 5:11166592-11166614 TGGTGGGAGTGGGAGGGGGAGGG + Intronic
987079948 5:14417601-14417623 CTGTGGGAGTGAGAGAAGGGAGG - Intronic
987293893 5:16533417-16533439 TCCTGGGAGATGGAGAAGGATGG - Intronic
987331399 5:16860636-16860658 TTGAGAGGATGGGAGAAGGAAGG + Intronic
987536529 5:19196396-19196418 GTGTGTGAGTGGGAGGAGGCGGG + Intergenic
987589477 5:19904823-19904845 TTGTGGGAACAGGAGGAGGAAGG + Intronic
987640521 5:20606153-20606175 TGTTGGCAGTGGGAGCAGGAAGG - Intergenic
987893826 5:23918545-23918567 TTGTGGGGTGGGGGGAAGGAGGG + Intergenic
987996604 5:25290131-25290153 GAGTGGGAGTGGGGGAAGGGGGG + Intergenic
988786877 5:34573211-34573233 TTGTGGGAGTGGGTTAACTAGGG + Intergenic
988955680 5:36315750-36315772 TAGTGGGAGTGGGTGTGGGAAGG - Intergenic
988999258 5:36744152-36744174 TTGTGGGAGAGGGAGATGGAAGG - Intergenic
989188917 5:38650619-38650641 TTGGGGGAGGGGGAGGGGGAGGG + Intergenic
990112287 5:52342056-52342078 TTGTGAGAAAGGGAGAAGGTAGG + Intergenic
990181748 5:53168231-53168253 CTGTGGGAAGTGGAGAAGGAGGG + Intergenic
990312462 5:54553043-54553065 TGGCTGGAGTGGGAGAAGGGTGG + Intergenic
991337967 5:65571760-65571782 TTTTGGTAGTGGGATAGGGAGGG + Intronic
991918395 5:71628552-71628574 TTTTGGGTGTGGGATAAGGAAGG + Intronic
992116173 5:73540491-73540513 TTGAGGGAGGGAGAGAGGGAGGG + Intergenic
992944381 5:81795279-81795301 TTGGGGAAGTGGGAGAAGTTTGG + Intergenic
992970290 5:82049395-82049417 TTGTGGGGGTGGGGGGAGGGGGG + Intronic
992984291 5:82211734-82211756 ATATGGGAGTGTGAGAAGCAGGG - Intronic
992991376 5:82287175-82287197 TGGGGGGAGTGGGAGCAGGAAGG + Intronic
993036296 5:82761107-82761129 TTGTGGGAGGGGGAGCATGCAGG - Intergenic
993354755 5:86892235-86892257 TTGTGTGAGAAGGAGAAGGAAGG - Intergenic
993628900 5:90259831-90259853 ATTGGGGAGTGGGAGGAGGAAGG + Intergenic
993632048 5:90298323-90298345 TTATAGAAGTGGGAGAATGATGG - Intergenic
993754495 5:91711065-91711087 TTGGGGGCCTGGGAGGAGGAAGG + Intergenic
993998953 5:94755249-94755271 TGATGGCAGTGGCAGAAGGAAGG - Intronic
994401832 5:99290064-99290086 TTGTGGGGTTGGGGGAAGGGGGG - Intergenic
994541326 5:101101699-101101721 GAGGGGGAGGGGGAGAAGGAGGG + Intergenic
994920996 5:106043091-106043113 TGGTGAGAGAGGGAGAAGGAAGG + Intergenic
994947829 5:106418558-106418580 TTGTGGGGGTGGGCGAAGAGAGG - Intergenic
995423600 5:111993844-111993866 ATTTGGGAGTGGAGGAAGGAAGG - Intronic
995540086 5:113177085-113177107 GTGTGGGGGTGGGAGCAGGTAGG - Intronic
995969086 5:117945484-117945506 TGATTGGAGTGGGAGAATGATGG + Intergenic
996045223 5:118864377-118864399 TTGTGGGGTGGGGGGAAGGAGGG + Intronic
996837069 5:127805078-127805100 GTGTGGGACTGGGAGAGGGAGGG - Intergenic
997030077 5:130117202-130117224 TGGTGGGAGTGGGAAAGTGATGG + Intronic
997296350 5:132771347-132771369 TTGTTGCAGTGGGAGTAGAAAGG + Intronic
997952080 5:138250286-138250308 TCCTGGGAGGGGAAGAAGGAAGG + Intergenic
998094565 5:139389984-139390006 AGGAGGGAGTGGGAGGAGGATGG - Intronic
998334405 5:141357944-141357966 CTTTGGGAGTGTGAGGAGGACGG + Intronic
998422627 5:142001464-142001486 CTGTGAAAGTGGAAGAAGGAAGG + Exonic
998522147 5:142811000-142811022 GTGTGGGAGAGGGAGATGGGAGG - Intronic
998630962 5:143898095-143898117 CTGAGGAAGTGGGAGAAGCAGGG - Intergenic
999145111 5:149387370-149387392 TTATGGCTGTGGGAGATGGAAGG + Intronic
999233630 5:150077719-150077741 TTGGGAGAGAGGGAGGAGGAGGG - Intronic
999404582 5:151295805-151295827 GTATTGGAGTGGGAGAAGGTTGG + Intronic
999756824 5:154670724-154670746 GTGTGGGAGTGGGAAGAGAAAGG - Intergenic
1000283050 5:159798864-159798886 TTGGGGTCTTGGGAGAAGGAGGG - Intergenic
1001028585 5:168245149-168245171 CTGTGAGGGTGGGAGCAGGAGGG - Intronic
1001087443 5:168710990-168711012 CTGTCGGAGTGGGTGAAGGCGGG - Exonic
1001106588 5:168859800-168859822 ATTTGGGAGTGGGAGTAGGATGG + Intronic
1001185499 5:169567668-169567690 GAGAGGGAGTGGGAGGAGGAGGG - Intergenic
1001262926 5:170247845-170247867 TTTTGGGGTTGGGAGAAGGTTGG + Exonic
1001412918 5:171523588-171523610 TGTGGGGAGTGGAAGAAGGAGGG + Intergenic
1001414482 5:171535301-171535323 CTGTGGGGGCAGGAGAAGGATGG + Intergenic
1001468242 5:171987788-171987810 TTGTAGGAGTTAGAAAAGGAAGG - Intronic
1001865162 5:175097655-175097677 TTGTGGGAGCCAGAGGAGGAGGG + Intergenic
1002054460 5:176590714-176590736 TGGTGGGAGAGGGTGAAGGTTGG - Intronic
1002542372 5:179914638-179914660 TTTTGGGGGAGGGAGGAGGAAGG + Intronic
1002758487 6:183542-183564 CTCTGGGAGTGGGAGCAGAAGGG + Intergenic
1003134570 6:3424282-3424304 AAGTTGGAGTGGGAGAATGAGGG - Intronic
1003566187 6:7224521-7224543 AAGTGGGGGTGGGAGAAGGAAGG + Intronic
1003609989 6:7604047-7604069 TTGAGGGAAAGGGAGAAGCAAGG + Intronic
1003639811 6:7867198-7867220 GTTTGGGGGTGGGAAAAGGAGGG - Intronic
1003953336 6:11139848-11139870 TTGTGGGGGTTAGAGGAGGAAGG + Intergenic
1004107022 6:12675299-12675321 TTGTGAGAGAGTAAGAAGGATGG + Intergenic
1004497370 6:16177188-16177210 CTTTGGGAGTGGGAGAAGAAAGG - Intergenic
1004831250 6:19478627-19478649 CTGGGGGAGTGGGGGAAGGCAGG - Intergenic
1005084723 6:21993254-21993276 TTGTGGGTCTGGGTGAAGCAGGG - Intergenic
1005380509 6:25229488-25229510 TGGTGGGAGTGGGAGAAGGTGGG + Intergenic
1005997097 6:30938218-30938240 ATCTGGGAGAGGAAGAAGGAAGG - Intergenic
1006174315 6:32112738-32112760 TAAAGGGAGTGGGGGAAGGAAGG + Intronic
1006224066 6:32521660-32521682 TTGTGGGAGGGGAAGCAGGAGGG - Intronic
1006228066 6:32557701-32557723 TTGTGGGAGGGGAGGCAGGAGGG - Intronic
1006230657 6:32583850-32583872 TTGTGGGAGGGGAGGCAGGAGGG - Intronic
1006323268 6:33333589-33333611 CTGGGGGAGTGGGGGAAGGAAGG + Intergenic
1006442203 6:34059679-34059701 GAGTGGGAGTGGGTGATGGAGGG + Intronic
1006994023 6:38241057-38241079 TGCTGAGGGTGGGAGAAGGAGGG - Intronic
1007351650 6:41277841-41277863 TTGAGGAAGTGGGACCAGGAAGG - Intronic
1007506177 6:42337114-42337136 TGGTGGCAGTGGGAGCATGAAGG + Intronic
1007602414 6:43090759-43090781 TCCTGGGAGTAGAAGAAGGAAGG - Intronic
1007751301 6:44073524-44073546 GGGTGGGAGGGGGAGGAGGAGGG + Intergenic
1008485726 6:52033341-52033363 TTGTGGGTGTGGGGGCAGGATGG - Intronic
1008527287 6:52419746-52419768 ATGTGGCAGTGGGAGAATTAAGG + Intergenic
1008768730 6:54952365-54952387 TTGGGGGAGTGGGAGGTGGTGGG - Intergenic
1008930579 6:56934589-56934611 TCGTGAGAGAGAGAGAAGGAGGG + Intronic
1009008178 6:57811854-57811876 TTGTAAGAGAGGGAGAATGATGG - Intergenic
1009527082 6:64760938-64760960 TTCTGGGAGAAGGAGTAGGAAGG + Intronic
1009817837 6:68758831-68758853 TTTTAGGATTGGGAGAAGGGTGG - Intronic
1010489588 6:76459481-76459503 CTGAGGGAGTGAAAGAAGGAAGG - Intergenic
1010732164 6:79402843-79402865 GTGTCTGAGTGGAAGAAGGAAGG - Intergenic
1010789410 6:80047948-80047970 TTTTTCTAGTGGGAGAAGGAGGG + Intergenic
1011163130 6:84414958-84414980 AGGTGGGTGAGGGAGAAGGAGGG + Intergenic
1011194367 6:84766534-84766556 GAGTGGGAGTGGGACAAGGCGGG + Intergenic
1011528833 6:88297878-88297900 TTTTGGGGGTGGGTGAGGGAGGG - Intergenic
1012022411 6:93940808-93940830 TTTTGTGGGTGGGAAAAGGAGGG + Intergenic
1012422318 6:99078608-99078630 TGGTGGGAGGGAGAGACGGAGGG + Intergenic
1012632048 6:101482724-101482746 TTGAGGTAGTGGAAGTAGGAAGG + Intronic
1013101062 6:106987142-106987164 TTGAGGGAGGAGGAGGAGGAGGG + Intergenic
1013154581 6:107481180-107481202 CTATGGGGTTGGGAGAAGGAAGG - Intergenic
1013279515 6:108622595-108622617 TAGTTGGAGTGGGAGGAGGAAGG - Intronic
1013281190 6:108638626-108638648 CTGGGGCAGTGGGAGAAGGCTGG - Intronic
1013991157 6:116255082-116255104 TTGTTGGAGTGTGAGAATAATGG + Intronic
1014011836 6:116484987-116485009 GTGAGGAAGTGGGAGAAGGCAGG - Intergenic
1014140087 6:117931647-117931669 TTGTGTGAGTAGGTGAAGGTAGG + Intronic
1014328585 6:120030672-120030694 TTGTGGGCTTTGAAGAAGGAAGG + Intergenic
1015115574 6:129645548-129645570 TGGAGGGAGAGGGAGGAGGAAGG - Intronic
1015176700 6:130317184-130317206 ATAAGGGAGTGGGAGAAAGAAGG + Intronic
1015911463 6:138171529-138171551 TAGTGGGAGGGGAAGAAGGTGGG - Intronic
1015945156 6:138492212-138492234 ATGTGGGGATGGGAGCAGGAGGG + Intronic
1016491814 6:144613208-144613230 GTGAGGGAGGGAGAGAAGGAAGG + Intronic
1017946318 6:159099129-159099151 TGCTGGAAGTGGGAGAAGGAAGG + Intergenic
1018003593 6:159600850-159600872 ATGTGGGAGCTGGAGAGGGATGG - Intergenic
1018616243 6:165689609-165689631 TAGTGAGAGAGGGAGAAAGAGGG - Intronic
1019168081 6:170112305-170112327 TTTTGGGAGGGGTAGGAGGAAGG - Intergenic
1019345392 7:527177-527199 GGGTGGGAGGGGGAGGAGGAAGG + Intergenic
1019409675 7:901033-901055 TTGGGGTGGTGGGAGAAGGGAGG + Intronic
1019529059 7:1494643-1494665 GCATGGGAGTGGGAGAAGGGTGG + Intronic
1019609235 7:1928596-1928618 TAGTGGGAGTTGGAGAAGAAGGG - Intronic
1020105860 7:5422032-5422054 TTCTGGGGGTGGGAGGAGGGAGG + Intronic
1020361129 7:7327980-7328002 ATGGGGGAGAGAGAGAAGGAAGG + Intergenic
1021064468 7:16156512-16156534 CTGTGGGAGAGGCAGAAGTATGG - Intronic
1021405769 7:20265677-20265699 TTGTGGGAGCGATGGAAGGAAGG + Intergenic
1021541148 7:21760118-21760140 TGGTGGGGGTGGGAGGAGAAGGG + Intronic
1021572938 7:22083480-22083502 TTGCGGGAGGGAGAGAAGGAAGG + Intergenic
1022093482 7:27123488-27123510 TTCTGGGAGTGGGAGATGATGGG + Intronic
1022484308 7:30766019-30766041 TTGTGAGACTTGGAGCAGGAAGG - Intronic
1022566891 7:31412868-31412890 TTGAGGGAGATGAAGAAGGAGGG + Intergenic
1022576248 7:31499847-31499869 TGGTGGGAGTTGGGGAGGGAGGG + Intergenic
1022906438 7:34862219-34862241 TTGCGGGAGTGGGAGTTGGGGGG + Intronic
1023130117 7:36994615-36994637 TTGCAGGAGTGGGAGGAGGAAGG - Intronic
1023290090 7:38659640-38659662 TTGTGGGAATGGGAGAGTGATGG + Intergenic
1024210363 7:47198014-47198036 ATTTGGGAGTTGGGGAAGGAAGG - Intergenic
1024233104 7:47377770-47377792 ATGGGGGAGAAGGAGAAGGAGGG - Intronic
1024541182 7:50476274-50476296 TGGTGGCAGTGGGAGAGTGAGGG - Intronic
1025031108 7:55557633-55557655 TTGTGGGGATGGGAAAAGGAAGG + Intronic
1025849385 7:65233569-65233591 TTGTGGGAGGGGGAGCATGCAGG - Intergenic
1025959828 7:66210167-66210189 GTGAGAGAGAGGGAGAAGGAAGG + Intronic
1025964032 7:66251421-66251443 TTTTGGGATGGGGAGAGGGAGGG - Intronic
1025996236 7:66529251-66529273 CTGTGGGAGAGGAAGGAGGATGG + Intergenic
1026341116 7:69434774-69434796 TTGTGGGAGTGAGGGAGTGAGGG - Intergenic
1026516096 7:71073907-71073929 TAATGGGAGTGGAAGAAGCAAGG - Intergenic
1026576981 7:71580624-71580646 TTGTGACAGTGGGAGAGGAATGG + Intronic
1026612380 7:71871622-71871644 TGGTGGGAGTGGGGGCAGGCAGG - Intronic
1026748133 7:73028421-73028443 TGGTGGGAGAGGGATCAGGATGG + Intergenic
1026751781 7:73056566-73056588 TGGTGGGAGAGGGATCAGGATGG + Intergenic
1026755430 7:73084693-73084715 TGGTGGGAGAGGGATCAGGATGG + Intergenic
1026759080 7:73112707-73112729 TGGTGGGAGAGGGATCAGGATGG + Intergenic
1026777749 7:73241521-73241543 ATGAGTGAGAGGGAGAAGGAGGG + Intergenic
1026847840 7:73707558-73707580 TTCTGGGAGCGAGGGAAGGAAGG - Intronic
1026988200 7:74568157-74568179 CTGTGGGAGAGGAAGGAGGATGG + Intronic
1027018600 7:74794913-74794935 ATGAGTGAGAGGGAGAAGGAGGG + Intergenic
1027034336 7:74913735-74913757 TGGTGGGAGAGGGATCAGGATGG + Intergenic
1027069429 7:75151024-75151046 ATGAGTGAGAGGGAGAAGGAGGG - Intergenic
1027088328 7:75280766-75280788 TGGTGGGAGAGGGATCAGGATGG - Intergenic
1027091970 7:75308694-75308716 TGGTGGGAGAGGGATCAGGATGG - Intergenic
1027095613 7:75336661-75336683 TGGTGGGAGAGGGATCAGGATGG - Intergenic
1027323728 7:77031025-77031047 TGGTGGGAGAGGGATCAGGATGG + Intergenic
1027581000 7:79995662-79995684 GTGTGGTAGGGGGAGAGGGAAGG - Intergenic
1028166963 7:87548346-87548368 TTGAGGGAGGGAGGGAAGGAAGG + Intronic
1028399625 7:90410703-90410725 TTGTGGGGGTGGAAGGAGGAGGG + Intronic
1028839519 7:95412840-95412862 TTGAATCAGTGGGAGAAGGATGG - Intronic
1029205830 7:98869170-98869192 GTGGGGGAGTGGGGGAAGCAGGG - Intronic
1029395718 7:100307385-100307407 TGGTGGGAGAGGGATCAGGATGG - Intergenic
1029421892 7:100476231-100476253 TTGGGGGAGGGGGGGTAGGAGGG + Intronic
1029745101 7:102512249-102512271 TTGTGGGGGAGGGAGAAGGAGGG + Intronic
1029763093 7:102611410-102611432 TTGTGGGGGAGGGAGAAGGAGGG + Intronic
1029795849 7:102893812-102893834 ATGGGGGAGGGGGAGAAGAAGGG + Intronic
1029820153 7:103138953-103138975 TTGAGGGAGTGGAAATAGGAGGG - Intronic
1030033888 7:105392187-105392209 GTTGGGGGGTGGGAGAAGGAGGG + Intronic
1030114914 7:106055706-106055728 TTGTGGCAGTCGGAGTAGAAGGG + Intergenic
1030283267 7:107798917-107798939 TTGGGGGAGTGGGTGAGAGATGG + Intronic
1030306031 7:108019528-108019550 TTGTGGGAGAGGCAGAATTATGG - Intergenic
1030738305 7:113077617-113077639 CTGTGAAAGTGGGAGCAGGAAGG - Intergenic
1031904107 7:127441911-127441933 TAGAGGGGGAGGGAGAAGGAGGG - Intergenic
1031978517 7:128108756-128108778 TTGAGGTGGTGGGAGATGGAGGG + Intergenic
1032082690 7:128867923-128867945 TGATGGGAGTGGGGGCAGGAGGG + Intronic
1032695315 7:134330799-134330821 TTGGGGGCGAGGGTGAAGGAAGG + Intergenic
1033024459 7:137759101-137759123 CTGAGGGAGTAGGAGAGGGAGGG - Intronic
1033092729 7:138402016-138402038 TGGTGGGGGTGGGGAAAGGAAGG - Intergenic
1033275215 7:139966858-139966880 GTGGGGGAGGGGTAGAAGGAGGG - Intronic
1033291724 7:140090882-140090904 GTGGGGGAGAGGAAGAAGGAGGG - Exonic
1034184098 7:149161099-149161121 TGGTGGGACAGGGAGAAGGCAGG - Intronic
1034241240 7:149612793-149612815 TAGTGGGAGTGCTAGAAGCAAGG - Intergenic
1034736014 7:153430186-153430208 AGGTGGGGGTGGGAGATGGAGGG - Intergenic
1034896316 7:154878589-154878611 CTGTGGGAGTGGGAGGAGTCAGG - Intronic
1035409940 7:158631522-158631544 TTGTGGGAATGTGGGAAGGTGGG - Intronic
1035712579 8:1729827-1729849 TTTTGGGAGAGGGAAGAGGAAGG - Intergenic
1036279164 8:7384683-7384705 TTTTGGGTGTGGGAGAAAGATGG + Intronic
1036342352 8:7927190-7927212 TTTTGGGTGTGGGAGAAAGATGG - Intronic
1036561552 8:9903788-9903810 GGGTGGAAGTGGGAGACGGAGGG + Intergenic
1036613452 8:10370301-10370323 CTCTGGTAGTGGGAGAAGCATGG - Intronic
1036617002 8:10396043-10396065 TTGTGGGAAGGGGAGAAGGGAGG - Intronic
1036665398 8:10734077-10734099 GAGGGGGAGGGGGAGAAGGAGGG + Intronic
1036776681 8:11617666-11617688 TTGGGGGTGTGGGAGGAAGAGGG - Intergenic
1037643752 8:20771728-20771750 GGGTGGGAGTGGGGGAGGGAAGG + Intergenic
1037737448 8:21578907-21578929 CAATGGGAGTGGGAGAAGAAGGG + Intergenic
1037884781 8:22590172-22590194 GTGTGGGAGTGAGAGAATGGGGG + Intronic
1038004085 8:23415559-23415581 GGGTGGGAGTAGGAGAAAGAAGG + Intronic
1038040730 8:23722239-23722261 GTGGGGGAGAGGGAGGAGGATGG + Intergenic
1038277638 8:26135075-26135097 TTGAGGGTGTGGCAGAAGAAGGG - Intergenic
1038361813 8:26887110-26887132 TTGTGTGGCTGGGAGAAGTAAGG - Intergenic
1038364377 8:26916088-26916110 TGGTGGGAGTGGGGGCAGGTAGG - Intergenic
1038436356 8:27539529-27539551 ATGTGGGTGTGGGGGAGGGAAGG - Intronic
1038608225 8:29032267-29032289 TTTTGGGGGTGGGAGGAGGGGGG + Intronic
1038609391 8:29046171-29046193 TTCTGGGTGAGGGAGAATGAAGG - Intronic
1039126425 8:34207053-34207075 TGGGGGGAGTGGAAGAGGGAGGG + Intergenic
1039129198 8:34242459-34242481 ATGTGTGTGTGAGAGAAGGAGGG + Intergenic
1039399322 8:37255328-37255350 GTGTGAGAGTGGTAGAATGAAGG - Intergenic
1039439360 8:37584174-37584196 TAGAGGGAGTGGGCAAAGGAAGG - Intergenic
1039481270 8:37875097-37875119 TTGGGGGATGGGGAGGAGGACGG + Exonic
1039652437 8:39356867-39356889 TTGTGGGAGTGTTTAAAGGAAGG - Intergenic
1039808864 8:41027011-41027033 TGGTGGGAGGGAGGGAAGGAAGG + Intergenic
1040015495 8:42696028-42696050 TTGTGGGAATGCAAGGAGGAAGG - Intergenic
1040818475 8:51533501-51533523 TGGAGGGAGAGGGAGAGGGAGGG - Intronic
1041191642 8:55361314-55361336 AAGTGGGATGGGGAGAAGGAGGG + Intronic
1041370484 8:57154616-57154638 ATGGGGCAGTGGGATAAGGAGGG - Intergenic
1041541573 8:58990808-58990830 TTGTGGGAGCAGAAGATGGAAGG - Intronic
1041594656 8:59633911-59633933 TTCTGGGGGTGGGGGAAGAAGGG + Intergenic
1041732259 8:61074723-61074745 TTGTGGGAGTGGGTGGATGGTGG + Intronic
1041908269 8:63057668-63057690 GTATGGGTGTGGGAGGAGGATGG + Intronic
1041988040 8:63950316-63950338 TTGTGGTAACGGGAGAAGAAAGG + Intergenic
1041988350 8:63954307-63954329 TTGTGGAAGCGGGAGCATGAAGG + Intergenic
1042491357 8:69402253-69402275 CAGTTGGAGTTGGAGAAGGAGGG - Intergenic
1042836012 8:73079638-73079660 TTGGGGGAGAAGGAGGAGGAGGG - Intronic
1042980169 8:74518176-74518198 TCCTGGGGTTGGGAGAAGGATGG + Intergenic
1042980195 8:74518373-74518395 TCCTGGGGTTGGGAGAAGGATGG - Intergenic
1043546432 8:81320819-81320841 TGGTGAGAGTGGGAGCAAGAGGG - Intergenic
1043688144 8:83114843-83114865 TTGTGGGGGTGGGAGGGGGGAGG - Intergenic
1043859607 8:85300479-85300501 TGGTGGGGGTGGGAGAAGAAGGG + Intergenic
1043924858 8:86025506-86025528 TTTTGGGAGTCCGAGGAGGAAGG + Intronic
1043925362 8:86030616-86030638 TTGTGGGGCTGGGAGCAGCAAGG + Intronic
1044169967 8:89038224-89038246 TATTGGGAGTGGTAGAATGATGG - Intergenic
1044338258 8:91015332-91015354 TGGAAGGAGGGGGAGAAGGAGGG + Intronic
1044430371 8:92101634-92101656 TTGGGGGAGAGGGGGAGGGAAGG + Intronic
1045319389 8:101070204-101070226 GTGTGGGAGTGGGGCAGGGAGGG + Intergenic
1045474614 8:102542514-102542536 AGGTGGGTGTGGGAGGAGGAGGG - Intergenic
1045793353 8:106012785-106012807 TTGGGGATGTGGGAGAAGGTGGG - Intergenic
1046331936 8:112728605-112728627 TTATGGGAGGAGGAGAAGAAGGG - Intronic
1046530477 8:115438745-115438767 GGGAGGGAGAGGGAGAAGGAAGG - Intronic
1046679623 8:117154236-117154258 TTGTGGGGGTGGGTTAGGGAGGG - Intronic
1046709378 8:117492596-117492618 TTGTGGTGGAGGGAGAGGGAGGG + Intergenic
1047213955 8:122862195-122862217 TTGTGGGAGTGGCTGAGGGAGGG - Intronic
1047225289 8:122951462-122951484 TTTTTGGAGGGGGATAAGGAGGG - Exonic
1047358745 8:124147905-124147927 AGGTTGGAGTGGGACAAGGAGGG - Intergenic
1047908080 8:129494269-129494291 CTTTGGGAGGCGGAGAAGGAGGG + Intergenic
1050186949 9:2984703-2984725 CTGTGGGAGAGTGAGGAGGAAGG + Intergenic
1050315835 9:4399967-4399989 AGGTGGGAGTGGGAGTGGGATGG + Intergenic
1050350254 9:4734384-4734406 GTGTGGGCATGGGAGCAGGAGGG - Intronic
1050361685 9:4836598-4836620 TGGCGGGAGTGTGACAAGGAGGG + Intronic
1050417178 9:5429949-5429971 TTGTGGCAGGGGGAGAGGGTGGG - Intronic
1050584556 9:7097070-7097092 ATGTGGGAGTGGGATGAAGAAGG - Intergenic
1050614576 9:7388608-7388630 GTCTGGGAGAGAGAGAAGGAAGG + Intergenic
1050680242 9:8102874-8102896 TTGTGGTGGTGGGGGAAGCAGGG - Intergenic
1050774798 9:9246486-9246508 CTGTGGGAGTGGAGGCAGGAAGG - Intronic
1050806025 9:9679242-9679264 TGAAGGGAGTGGGGGAAGGAGGG - Intronic
1051330856 9:16023834-16023856 TTGTGGGGGTGGGGGGAGGGTGG - Intronic
1051601536 9:18879150-18879172 TTGTGGGAGAGAGAAGAGGAGGG + Intronic
1051650947 9:19323485-19323507 TTCTGGGTGTGGAAGAATGATGG + Intronic
1051675442 9:19553947-19553969 ATTTGGGTGGGGGAGAAGGAAGG - Intronic
1052228274 9:26116314-26116336 TTGTGGGCGTGGCAGGGGGAGGG + Intronic
1052386702 9:27831258-27831280 CTGTGGGAGTGGCAGGGGGAGGG - Intergenic
1052750321 9:32483511-32483533 TTGGGGAAGTAGCAGAAGGATGG - Intronic
1052786233 9:32831021-32831043 TGGTGGGAGAGGGAGAAGGAGGG + Intergenic
1052968681 9:34363084-34363106 TTGTGGGAGTCAGTGAAGGTGGG + Intergenic
1053051487 9:34964591-34964613 TGGTGGGAGTAAGAGGAGGAGGG - Intronic
1053292425 9:36890200-36890222 GTGTGTGAGTGAGAGAAAGAAGG + Intronic
1053472253 9:38355196-38355218 GGGAGGGAGGGGGAGAAGGAGGG + Intergenic
1054812887 9:69448663-69448685 GTGAGAGAGAGGGAGAAGGAAGG - Intronic
1055485672 9:76754259-76754281 TTGTGGGAGTGGGGGTGGGGTGG + Intronic
1055581469 9:77711112-77711134 GAGTAGGAGGGGGAGAAGGAAGG - Intergenic
1055939545 9:81636596-81636618 TTAGGGGAGTGGGGGAAGCAGGG - Intronic
1056068085 9:82957806-82957828 TTGTGGGCAGGGGAAAAGGAAGG + Intergenic
1056102068 9:83309186-83309208 TTGTGGGGGTGGGGGGAGGAGGG + Intronic
1056240095 9:84636724-84636746 AGGAGGGAGGGGGAGAAGGAGGG - Intergenic
1056481071 9:87006954-87006976 TTCTGGGAGTTGGGGAAGGAAGG - Intergenic
1056586888 9:87932858-87932880 GTGTCAGAGTGGGAGAAGGGAGG + Intergenic
1056609988 9:88120082-88120104 GTGTCAGAGTGGGAGAAGGGAGG - Intergenic
1056780933 9:89550413-89550435 TTCTGGGATTGGGAGGAAGACGG - Intergenic
1056805940 9:89728956-89728978 TAGTGAGAGTGGGATGAGGAGGG - Intergenic
1056942148 9:90964936-90964958 TTGGGGGAGTGTGAGCAGAAAGG - Intergenic
1057171974 9:92968472-92968494 CTGTGGGAGTGGATGGAGGAGGG - Intronic
1057240075 9:93400118-93400140 TTGGGGGAATTGGAGAAAGATGG - Intergenic
1057424013 9:94934263-94934285 TAGAGGGAGAGGGAGAGGGAAGG - Intronic
1057693796 9:97309772-97309794 CTGTGGGAGTGGGGGAATGGGGG - Intronic
1057998026 9:99837895-99837917 TTGTGGGAATGGGAGGTGGAGGG + Intronic
1058049459 9:100392214-100392236 TGGAGGGAGAGGGAGAGGGAGGG - Intergenic
1058151882 9:101472679-101472701 TGTTGGGAGTGGGGGGAGGATGG + Intergenic
1058442130 9:105019196-105019218 TTGGGGAAGTGGGTGGAGGAAGG - Intergenic
1058444586 9:105043449-105043471 GAGGGGGAGGGGGAGAAGGAGGG + Intergenic
1058802172 9:108555235-108555257 TGGTGGGAGTGGGAGGGAGATGG + Intergenic
1058860969 9:109117454-109117476 ACCTGGGAGTGGGAGAAAGAAGG - Intronic
1058929257 9:109702589-109702611 TTGTGGGGGTGGGGGTAGGGGGG + Intronic
1058942491 9:109826211-109826233 TTGTGGGGGTGGGGGTAGGGGGG + Intronic
1059111700 9:111564014-111564036 ATCTGGGAGTGTGGGAAGGAAGG + Intronic
1059145903 9:111898799-111898821 GTGTGAGAGAGAGAGAAGGAGGG + Intronic
1059404830 9:114093193-114093215 TGGTGGGAGTGAGGGAAGGCTGG - Intronic
1059464431 9:114458765-114458787 GGGTGGGAGTGGGAGACAGAAGG + Intronic
1059570815 9:115433062-115433084 ATGTGGGGTTGGGAGAAGGGAGG + Intergenic
1059936821 9:119320159-119320181 TTGGGTGGGTGGGAGAAGGTAGG + Intronic
1060435016 9:123585846-123585868 TAGGGGGAGTGAGAGAAGCAGGG - Intronic
1060820345 9:126658195-126658217 TTGTAGGAGTGGGACAGGGCAGG + Intronic
1060947715 9:127579844-127579866 TTGTGGGAGTGGGGGAGTGTGGG + Intergenic
1061201765 9:129142145-129142167 TTTTGGCTGTGGGAGAAAGAGGG + Intronic
1061900040 9:133668319-133668341 ATGAGGGAGAGGGAGAGGGAGGG - Intronic
1062068088 9:134539768-134539790 CTGTGGCCGAGGGAGAAGGATGG + Intergenic
1062157708 9:135062729-135062751 TTCTGGGAGAGGGAGAGGGGAGG - Intergenic
1062283064 9:135760445-135760467 TTGGGGAGATGGGAGAAGGAGGG + Intronic
1062596164 9:137300758-137300780 TTGAGGGAGAGGGAGAAGGAGGG + Exonic
1185631084 X:1516257-1516279 TGGAGGGAGGGAGAGAAGGAGGG - Intronic
1186269300 X:7867465-7867487 TTGTGGGTGGGAGAGAAGGCGGG - Intergenic
1186548699 X:10479468-10479490 TTGTGGGAGTGGGGGTGGGTAGG - Intronic
1186782681 X:12929099-12929121 TTGAGGGATTGGGAGAAGATGGG + Intergenic
1186786640 X:12962201-12962223 TTATGGGAGTGTGGGATGGATGG - Intergenic
1186845205 X:13523876-13523898 TTGAGTGGGTGGGATAAGGATGG + Intergenic
1186985041 X:15003484-15003506 TTGAGGGAGGGAGAGACGGAGGG + Intergenic
1187019657 X:15367299-15367321 TTGTGGGAGTGAGAGGAGTGGGG + Intronic
1187090599 X:16092307-16092329 TTTTGGGAGGTGGAGTAGGAAGG - Intergenic
1187105564 X:16237967-16237989 TTGTGGCAATGGGAGGAGGGGGG - Intergenic
1187626780 X:21123330-21123352 TTATGGGAGTAAGAGAAGAAGGG + Intergenic
1187709268 X:22037636-22037658 TTTTTGGAGTGGGGGAAGGGAGG + Intronic
1187820068 X:23278033-23278055 TTTTTGGAGTGGGAGAAGAAGGG + Intergenic
1188360230 X:29243968-29243990 GTGGGGGAGAGGGAAAAGGAGGG - Intronic
1189116384 X:38347332-38347354 TTGGCTGAGTGGAAGAAGGAAGG - Intronic
1189575795 X:42351916-42351938 GTGAGGGAGTGGGAGAGGGGAGG - Intergenic
1189856491 X:45229601-45229623 TTGGGGTAGTGGGAGCAGGCAGG - Intergenic
1189939813 X:46109842-46109864 TTGTGGGGTGGGGGGAAGGAGGG + Intergenic
1190231778 X:48587791-48587813 TAGTGGGGGTGGGAGGAGGTGGG - Intergenic
1190248814 X:48707373-48707395 GGGAGGGAGGGGGAGAAGGAGGG - Intronic
1190481715 X:50883973-50883995 TGGTGGGAGTTGGGGCAGGAGGG + Intergenic
1192037956 X:67586254-67586276 TTGTGTGTTTGGGGGAAGGAGGG - Intronic
1192254798 X:69447396-69447418 GTATGGGAGAGGGAGCAGGAAGG - Intergenic
1192853166 X:74979714-74979736 TGCTGGGGGTGGGAGAGGGATGG - Intergenic
1194038455 X:88910379-88910401 TTGTGGGGTTGGGGGAGGGAGGG + Intergenic
1194227734 X:91282026-91282048 TAGTGGGGGTGGGAGGAGGTGGG - Intergenic
1194289482 X:92052325-92052347 TTGTGGGAATGGGATCAGAATGG + Intronic
1194586359 X:95739242-95739264 TGGGGGGATTGGGAGAAAGAGGG + Intergenic
1194787129 X:98100144-98100166 TTGCGGGGGTGGGAGTGGGATGG - Intergenic
1194820209 X:98496641-98496663 TTGGGAGAGGGGGAGAAGGAAGG - Intergenic
1195096294 X:101504447-101504469 GTGTGTGAGAGAGAGAAGGAGGG + Intronic
1195499647 X:105580309-105580331 TGGTGCTAGTGGGAGGAGGAAGG + Intronic
1195560003 X:106272271-106272293 GAGGGGGAGTGGGAGAAAGAGGG + Intergenic
1195561959 X:106294068-106294090 GAGGGGGAGTGGGAGAAAGAGGG - Intergenic
1196124221 X:112082344-112082366 GTGAAGGAGAGGGAGAAGGAGGG + Exonic
1196481597 X:116156667-116156689 GTGGGGGAGAGGGAAAAGGAGGG + Intergenic
1196866813 X:120077866-120077888 GCGTGGGAGGGGGAGTAGGATGG + Intergenic
1196876286 X:120158415-120158437 GCGTGGGAGGGGGAGTAGGATGG - Intergenic
1196900284 X:120375760-120375782 TTGGGGGTGAGGGAGAAGAATGG - Intronic
1196923397 X:120607787-120607809 TTGGGGAAGTGGGGGGAGGAAGG - Intronic
1197213980 X:123851106-123851128 TTGTGGGAGGAAGAGAGGGAAGG - Intergenic
1197564623 X:128066930-128066952 GGGTGGGAGTGGGGGAAGGTGGG + Intergenic
1197637752 X:128934265-128934287 TTGTGTGTGTGGGTGAAGGGAGG + Intergenic
1197859184 X:130951017-130951039 TTGAGGGGGTGGGGGAAGGAGGG + Intergenic
1197959389 X:131987751-131987773 TTGGGGAAGTGGGAGAAAGATGG - Intergenic
1198287865 X:135210322-135210344 GTGTAGGACTGAGAGAAGGATGG + Intergenic
1198526514 X:137506862-137506884 TTGGAGGAGTGGAAGAGGGAGGG - Intergenic
1199528982 X:148825830-148825852 TGGTGGGGGTGGGAGTAGGAAGG + Intronic
1199739958 X:150725906-150725928 TAGGGGGAGTAAGAGAAGGAAGG - Intronic
1199845977 X:151693619-151693641 AAGTGGGAGTGCCAGAAGGAGGG + Intergenic
1199858130 X:151777017-151777039 TCTTGGGAGTGGGAGAAAGGTGG - Intergenic
1199955777 X:152741039-152741061 AGGTGGGAGTGTGAGAAGGGAGG + Intergenic
1200338018 X:155372670-155372692 TAGAGGGAGAGGGAAAAGGAGGG + Intergenic
1200348451 X:155468024-155468046 TAGAGGGAGAGGGAAAAGGAGGG - Intergenic
1200606997 Y:5276897-5276919 TTGTGGGAATGGGATCAGAATGG + Intronic
1200826471 Y:7649989-7650011 TAGTGGGAGTGGGGGTGGGAGGG + Intergenic
1200958842 Y:8978498-8978520 CTTTGGGAGTCTGAGAAGGAAGG + Intergenic
1201316525 Y:12652733-12652755 GTGTGGCAGTGGCATAAGGATGG - Intergenic
1201450975 Y:14115060-14115082 TTGTGGGTGGGAGAGAAGGCAGG + Intergenic
1201512416 Y:14779880-14779902 TTGAGTGAGTGTGCGAAGGATGG - Intronic
1201572736 Y:15431905-15431927 TTGTGGGAGTTGGGGGAGGGGGG + Intergenic
1202233428 Y:22679866-22679888 TAGTGGGAGTGGGGGTGGGAGGG - Intergenic
1202309728 Y:23516292-23516314 TAGTGGGAGTGGGGGTGGGAGGG + Intergenic
1202379399 Y:24262418-24262440 TTGGGGAAGTGGGGAAAGGAGGG - Intergenic
1202491383 Y:25407703-25407725 TTGGGGAAGTGGGGAAAGGAGGG + Intergenic
1202561073 Y:26154301-26154323 TAGTGGGAGTGGGGGTGGGAGGG - Intergenic