ID: 1166566949

View in Genome Browser
Species Human (GRCh38)
Location 19:43771162-43771184
Sequence CTGGGTCTATGGAGGGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 415
Summary {0: 1, 1: 0, 2: 4, 3: 51, 4: 359}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166566941_1166566949 5 Left 1166566941 19:43771134-43771156 CCAGGGCTGGGTGGGAGGACCTG 0: 1
1: 0
2: 3
3: 49
4: 477
Right 1166566949 19:43771162-43771184 CTGGGTCTATGGAGGGAAGGAGG 0: 1
1: 0
2: 4
3: 51
4: 359

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166566949 Original CRISPR CTGGGTCTATGGAGGGAAGG AGG Intronic
900078184 1:834944-834966 ATGGGTGGATGGAGGGAGGGAGG - Intergenic
900740925 1:4330279-4330301 CTGGGTCTAGGGAGGGAAAAAGG + Intergenic
901215938 1:7555462-7555484 CTGGGTCTCAGGAGAGAAAGAGG - Intronic
901727959 1:11257076-11257098 CTGGGTCATTGGAGGGGAGGAGG + Exonic
901862110 1:12081139-12081161 CTGGGTCAATGGAGGGGTAGGGG - Intronic
902446757 1:16471287-16471309 CAGGGGTTAAGGAGGGAAGGAGG - Intergenic
902909615 1:19585818-19585840 GTGGGGCTAGGGAGGGAATGGGG + Intergenic
903221632 1:21872761-21872783 CTGGGTAGACGGATGGAAGGAGG + Intronic
903359456 1:22767673-22767695 CTGGGCCAGTGGTGGGAAGGAGG - Intronic
904435431 1:30491914-30491936 CTGGGTCTGGGGAAGGAAGCTGG - Intergenic
906166857 1:43693024-43693046 CTGGGACTCTTGAGGGCAGGCGG - Intronic
906706753 1:47900592-47900614 CTTGCTCTATGGAGGGGTGGGGG - Intronic
907449306 1:54532953-54532975 CAGGGTCTCTGGGGGGAGGGGGG + Intergenic
907454428 1:54566057-54566079 CTGGCTCTCCAGAGGGAAGGGGG - Intronic
908402002 1:63780145-63780167 ATGGTTCTATGGAGAGAAGCAGG - Intronic
908789692 1:67769425-67769447 GTGGGTCTTTGGAGGGAGGTAGG + Intronic
910857781 1:91713188-91713210 CTGGGCTTATGGAGCGAAGGGGG - Intronic
911724944 1:101233384-101233406 CTGGGTCAGGGGAGGGAAGAGGG + Intergenic
911877194 1:103181870-103181892 CTTGGGCTATGGAGGGAGTGCGG - Intergenic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
912703908 1:111897954-111897976 CCGTGTTTATGGAAGGAAGGTGG - Intronic
913318573 1:117573486-117573508 GTGGGTCTGTGGAGGGGATGAGG + Intergenic
913998384 1:143670897-143670919 CAGGGATTAAGGAGGGAAGGAGG + Intergenic
914703815 1:150155599-150155621 CGGGGTGTCTGGAGGGAACGAGG - Intronic
915110492 1:153561707-153561729 CTGGGTATAAGGTGGGCAGGAGG + Intronic
915357408 1:155263766-155263788 GTGGTTTTGTGGAGGGAAGGAGG - Intronic
915615425 1:157034138-157034160 CTGGGGCTCTGAAGGGAAGAGGG + Intronic
916068323 1:161154263-161154285 CGGGGACTAAGGAGGGATGGTGG + Intronic
916178104 1:162059766-162059788 CTGCTTTTGTGGAGGGAAGGTGG - Intergenic
918106779 1:181422262-181422284 CTGGGGATATGGAGTGAACGAGG - Intronic
918406213 1:184214041-184214063 CTGGGCCTGAGGAGGGGAGGGGG - Intergenic
919563928 1:199160362-199160384 CTGAGTCTATTGAGGCAAGTTGG + Intergenic
920190323 1:204189722-204189744 CTGGCTCCCTGGAGGGAAGGGGG + Intergenic
920816371 1:209336933-209336955 GTGGGTGGAGGGAGGGAAGGGGG + Intergenic
920837425 1:209524572-209524594 CTGGGAGAGTGGAGGGAAGGGGG + Intergenic
920970034 1:210735231-210735253 CTAGGTCTATGGAGGCAGGGGGG - Intronic
922784904 1:228277965-228277987 CAGGGACTCAGGAGGGAAGGGGG + Intronic
923127730 1:231047188-231047210 AAGGGGTTATGGAGGGAAGGAGG - Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924856307 1:247878562-247878584 CAAGGTCTGTGTAGGGAAGGTGG + Intergenic
1064444644 10:15382764-15382786 CTGGGTAGATGGAGTGAAGGAGG - Intergenic
1067250424 10:44581779-44581801 CCAGGTCTCTGGAGGAAAGGAGG + Intergenic
1067743498 10:48914716-48914738 CTGGGTCCATGAGGGGAAGAGGG - Intronic
1068356508 10:55916734-55916756 CTGGGTCAGGGGAGAGAAGGAGG + Intergenic
1069536222 10:69255363-69255385 CAAGAACTATGGAGGGAAGGAGG + Intronic
1069913930 10:71775655-71775677 CTGGGCTTGGGGAGGGAAGGTGG - Intronic
1073060316 10:100729935-100729957 CTGGGTCCATGGCGGGGAAGGGG - Intergenic
1073128466 10:101168338-101168360 AGGTGTCTATGGAGGAAAGGGGG - Intergenic
1073301573 10:102474095-102474117 CTGGGTCCAGTGACGGAAGGTGG + Intronic
1075342951 10:121661776-121661798 CTGGGACTCTGGAGGGAGCGTGG + Intergenic
1075474031 10:122717816-122717838 CTGGGGTAATGGAGGTAAGGCGG - Intergenic
1075969147 10:126638147-126638169 CTGGGCCTAGGGAGGCAGGGGGG - Intronic
1076499622 10:130927156-130927178 ATGGGTCCATGGAGGAAAAGGGG + Intergenic
1076853930 10:133106109-133106131 CTGGGTCTGTGGAGGGGCAGTGG + Intronic
1077610192 11:3639217-3639239 CTGGGTCTTGGGTGGGAAGAGGG - Intronic
1078484361 11:11707854-11707876 CAGGGTCACTGGAGTGAAGGTGG + Intergenic
1079314848 11:19398808-19398830 GTGTGTCTGTGGGGGGAAGGAGG - Intronic
1079525830 11:21386447-21386469 CTTTGTCTATGGAAGGAAGTGGG - Intronic
1080015896 11:27506643-27506665 CTGTGTCGCTGGAGGGGAGGAGG - Intronic
1080419776 11:32099497-32099519 GTGGGTCTTTGGAGGGTGGGTGG + Intronic
1080666046 11:34337257-34337279 CAGGGGCTGTGTAGGGAAGGAGG + Intronic
1081154861 11:39677480-39677502 CTGAGCCTAGCGAGGGAAGGAGG + Intergenic
1081445931 11:43131568-43131590 CTGGGTCTAAGGATAGGAGGAGG - Intergenic
1081615438 11:44587969-44587991 CTGGGTGGATGCAGGGATGGAGG - Intronic
1082021680 11:47539327-47539349 CTGGGGCTAAGGAGGGTATGGGG + Intronic
1082824574 11:57568179-57568201 CTGGGCCCATGGAGGGAAGGCGG - Intronic
1083106337 11:60361787-60361809 CTGGTTCTCTTCAGGGAAGGAGG - Intronic
1083764855 11:64836812-64836834 CAGGGCCTCTGGAGGGGAGGTGG + Exonic
1084179049 11:67437532-67437554 CTGGGCCTGTGGAGCTAAGGAGG - Intronic
1084495624 11:69501500-69501522 ATGGGTGGATGGAGGAAAGGAGG + Intergenic
1084888586 11:72225313-72225335 CTGGGTCTGAGGAGGGACGCAGG + Intronic
1085457388 11:76672714-76672736 CTGGGGCTATGGTGGGCTGGGGG + Intergenic
1085533447 11:77204737-77204759 CTGGGTGTAAGGAGAGAGGGTGG - Intronic
1087007969 11:93487434-93487456 GTGGGTGTATGGAGGGGAGGAGG + Intronic
1088100265 11:106146733-106146755 TTGGGGCTATGTATGGAAGGAGG - Intergenic
1089556876 11:119319949-119319971 CTGGGTCTTTGGAGGGGGTGCGG + Intronic
1090645380 11:128763132-128763154 TTGTGTCTCTGGTGGGAAGGAGG + Intronic
1091312152 11:134582189-134582211 CAGGGTCTAAGGATGGAGGGTGG + Intergenic
1091930277 12:4390338-4390360 CTAGGACTAAGGAGGGCAGGAGG - Intergenic
1092071850 12:5637711-5637733 GTGGGGCTAGGGAGGAAAGGAGG - Intronic
1093811275 12:23494865-23494887 CAGGGTCTTTAGAGTGAAGGAGG + Intergenic
1095583398 12:43825266-43825288 TTGGAACTATGGAGGGAAGGGGG + Intergenic
1096509546 12:52120069-52120091 TTGGGGCTAAGGAGTGAAGGGGG + Intergenic
1096745657 12:53725309-53725331 CTGGAGCTGTGGGGGGAAGGAGG - Intronic
1097222124 12:57457131-57457153 CAGGGACTAGGGAGGGAGGGAGG + Exonic
1097667936 12:62502581-62502603 ATGGGTCTATGAAGGAAATGTGG + Intronic
1098323845 12:69279733-69279755 CTGGGGCTAGGGTGGGAATGGGG - Intergenic
1103992571 12:124809114-124809136 CTGAGTATTTGGAGGTAAGGGGG + Intronic
1104531169 12:129572360-129572382 CAGGGTCTAAGGCGGGAAGTGGG + Intronic
1104965298 12:132506219-132506241 GTGGGTCTGTGGATGGGAGGAGG + Intronic
1106270286 13:28146386-28146408 CTGGATCTATGGGGGGAGGAGGG - Intronic
1108588592 13:51892627-51892649 CTGGGTCCAAGGAGGAAATGTGG - Intergenic
1109520321 13:63501909-63501931 CTGAGTGTAAGGTGGGAAGGTGG + Intergenic
1110605221 13:77424615-77424637 ATGTGTCTGTGGTGGGAAGGGGG - Intergenic
1112145975 13:96700684-96700706 CTGGGTCTGTGTAGGAAAGGAGG + Intronic
1112595708 13:100805138-100805160 CTGGATCCCTGGAGGGATGGAGG - Intergenic
1113186122 13:107687301-107687323 CTGGATGGAGGGAGGGAAGGAGG + Intronic
1115859854 14:37672215-37672237 CTGGGTCAAGGGATGGAGGGAGG - Intronic
1119706953 14:76788947-76788969 CTGGATACATGGAAGGAAGGGGG + Exonic
1120738431 14:88081017-88081039 GTGGGTCTAGGGAGGGATCGTGG - Intergenic
1121016195 14:90550806-90550828 CTGGATAGATGGAGGGATGGAGG + Intronic
1121096573 14:91221537-91221559 GTGGGTGGATGGAGGGATGGAGG + Intronic
1121825000 14:97002741-97002763 GTGGGTGTATGGATGGATGGAGG - Intergenic
1122127279 14:99586195-99586217 CTGGGTGTAGGGAGGGGCGGGGG - Intronic
1124369775 15:29097805-29097827 CTGGGGCAAAGGAGTGAAGGGGG - Intronic
1124631847 15:31342393-31342415 CTGGGTCTCAGGAGGGAAGGCGG - Intronic
1125340559 15:38671543-38671565 CTGGTTCAACGGAGGGAAGATGG - Intergenic
1125713660 15:41806523-41806545 CTGGACCTGTGTAGGGAAGGGGG + Intronic
1128793522 15:70449539-70449561 ATGGGTGGATGGAGGGAAGGAGG + Intergenic
1130079702 15:80721839-80721861 CTTTGTTTCTGGAGGGAAGGAGG + Intronic
1130099142 15:80878892-80878914 CTGGGGCAGTGGAGGGAAGAGGG - Intronic
1131589443 15:93732096-93732118 CTGTGTCTTTGGAGGTCAGGGGG + Intergenic
1132910225 16:2306484-2306506 CTGGGTCTGTGGAAGGAGGTGGG - Intronic
1132978424 16:2721586-2721608 CTGGGGGTCTGGAGGGAAGGAGG + Intergenic
1133444248 16:5846523-5846545 CTGGGTAGATGGAGGAATGGAGG + Intergenic
1133577661 16:7109458-7109480 GTGGATGTATGGAAGGAAGGTGG + Intronic
1134112643 16:11524745-11524767 CTGGGTGGCTGGAGGGAGGGAGG - Intergenic
1136346424 16:29679103-29679125 GTGGGACTGTGGAGGGAGGGAGG - Exonic
1136393837 16:29982326-29982348 ATGGGTCTGTGAAGGGAATGGGG - Intronic
1137494471 16:48959133-48959155 CTGGGACTAGGGAGTCAAGGAGG + Intergenic
1137495393 16:48965406-48965428 ATTGCTCTATGGAGGGGAGGGGG - Intergenic
1137603313 16:49770934-49770956 CTGGTGCGAGGGAGGGAAGGTGG - Intronic
1139264050 16:65622972-65622994 CTGGGTCAATGAAAGGCAGGAGG + Intergenic
1139631290 16:68233491-68233513 ATGTGTCTATGGAGGGGAGTTGG - Intronic
1140403955 16:74695270-74695292 CTGGGTCTTTGGTGGGGAGTGGG - Intronic
1140415572 16:74771778-74771800 CTGTGACCATGGGGGGAAGGGGG - Intronic
1141087036 16:81103198-81103220 CTGGGTCTAAGGTGGGAGGATGG + Intergenic
1141421640 16:83921462-83921484 CAGGGTATATGGAAGGAAGATGG + Exonic
1141717012 16:85732743-85732765 CTGGGTCTCTGGAGGTGATGAGG - Intronic
1141732788 16:85833997-85834019 CTGTGTCAAAGGAAGGAAGGAGG + Intergenic
1141854791 16:86673669-86673691 GTGGGTGCATGAAGGGAAGGAGG - Intergenic
1142043008 16:87907332-87907354 CTGTGTCTGTGGGGGAAAGGGGG + Intronic
1142521454 17:507667-507689 TTGGGGCTGTGGAGGGAGGGAGG + Intergenic
1142559727 17:802889-802911 ATGGGTGGATGGAGGGCAGGGGG + Intronic
1142743790 17:1945008-1945030 CTGCGGCTGGGGAGGGAAGGAGG - Intronic
1143272110 17:5683474-5683496 CTGGGGCCGTGGAGGGCAGGGGG + Intergenic
1144624814 17:16839237-16839259 GTGGGGCCATGGAGGGCAGGAGG - Intergenic
1144730805 17:17525179-17525201 CTGGGTCTGTTGGGGGAGGGGGG - Intronic
1144802735 17:17941874-17941896 CTGCTACTAGGGAGGGAAGGTGG + Intronic
1144881616 17:18433484-18433506 GTGGGGCCATGGAGGGCAGGAGG + Intergenic
1145150617 17:20510902-20510924 GTGGGGCCATGGAGGGCAGGAGG - Intergenic
1145891076 17:28416184-28416206 CTGGGCCCATGGAGGGTAGCTGG - Intergenic
1145928063 17:28662471-28662493 CCTGCTCTATGGGGGGAAGGGGG + Intronic
1146250615 17:31339905-31339927 CCAGGACAATGGAGGGAAGGTGG + Intronic
1146565649 17:33910735-33910757 CTGCCTCTCTGGAGGGAAGTAGG + Intronic
1146644778 17:34569896-34569918 CTTGGCCTGGGGAGGGAAGGGGG + Intergenic
1147142614 17:38467881-38467903 TTGAGTCGATGGAGGGATGGAGG - Intronic
1147646654 17:42038325-42038347 CTGGGGATCTGGAGGGAGGGAGG - Intronic
1148341461 17:46875849-46875871 CTTGGTCTATTGAGGGGAGGAGG + Intronic
1148645548 17:49217970-49217992 CTGGGGTTCTGGAGGGAAAGGGG - Intronic
1148737813 17:49874632-49874654 CAGGGGCCATGGTGGGAAGGGGG - Intergenic
1149595323 17:57861808-57861830 CTGGGGCCCTGGAGGGAGGGGGG - Exonic
1149637218 17:58180747-58180769 CAGGGTGCAGGGAGGGAAGGGGG - Intergenic
1151820628 17:76494888-76494910 TTGGGGCAATGAAGGGAAGGGGG + Intronic
1151882928 17:76905675-76905697 CTGGGTGGAGGGAGGGAGGGAGG - Intronic
1152330343 17:79669066-79669088 ATGGGCCTAAGGAGGGAATGGGG + Intergenic
1152528431 17:80902843-80902865 CAGGGTTTCGGGAGGGAAGGCGG - Intronic
1152901935 17:82947316-82947338 GTGGGTGTGTGGAGGGAAGGTGG - Intronic
1153190578 18:2533389-2533411 TTGGCTCTAGGGAGGGAAGAAGG + Intergenic
1154385176 18:13886708-13886730 CTGTGTCTCTGGGGTGAAGGCGG + Intronic
1155032783 18:21998760-21998782 CTGGGTGTAGGGATGGCAGGGGG + Intergenic
1155173037 18:23281112-23281134 CTAGGTCAGTGGAGGGGAGGAGG + Intronic
1155226861 18:23736926-23736948 CTGGGTCTTAAGAGGGTAGGTGG - Intronic
1156479717 18:37428410-37428432 CTGGGTCTCTGTAAGGAAGGAGG + Intronic
1156610014 18:38714766-38714788 CTGCGTATGTGGAGGGAAGCTGG + Intergenic
1157190322 18:45576237-45576259 CTGGGTGTTTGGAGAGAAGGTGG + Intronic
1157335212 18:46732880-46732902 CTGGGTCTCGGGAGGGCTGGTGG + Intronic
1157446417 18:47749595-47749617 TGGGGTTGATGGAGGGAAGGAGG + Intergenic
1157517643 18:48322058-48322080 TTGGGGCTATGCAGGGATGGAGG - Intronic
1158869368 18:61669780-61669802 CTGGACCTAGGGATGGAAGGAGG - Intergenic
1159426524 18:68295628-68295650 TTGAGTCTATGGAGATAAGGAGG + Intergenic
1160807995 19:1000955-1000977 CCGGGACTACGCAGGGAAGGGGG + Intronic
1161068233 19:2248492-2248514 CTGGGCCTTCGGAGGGAAGTGGG - Exonic
1161610188 19:5238047-5238069 CTGGGTGAAGGGAGGGAAGAGGG + Intronic
1161926154 19:7301679-7301701 CTGGGGCTGGGGAGGGGAGGTGG - Intergenic
1161934597 19:7363896-7363918 ATGGGTTGATGGAAGGAAGGAGG + Intronic
1161934655 19:7364241-7364263 ATGGGTTGATGGAAGGAAGGAGG + Intronic
1162622518 19:11855297-11855319 CTGGGTCCATGGAGGGGGGTAGG + Intronic
1162905036 19:13818213-13818235 CTGGCTCCCGGGAGGGAAGGGGG - Intronic
1163448293 19:17360604-17360626 CTGGGTCTGTGGAGGGAGAGAGG + Exonic
1164756261 19:30691962-30691984 CCCGGTCTCTGGAGGGGAGGTGG - Intronic
1165325307 19:35111274-35111296 CTGGTTTGATGGAGGGAGGGAGG - Intergenic
1165361290 19:35338451-35338473 CTGGTTCTAGGGAGAGAAGATGG + Intronic
1165375271 19:35437435-35437457 CTGGGGCTATGGCAGGAACGAGG + Intergenic
1165382987 19:35494273-35494295 CTGGGTCTAGGGAGGGAGTGGGG + Intronic
1165384593 19:35502881-35502903 CTGGTTCTGTGGATGAAAGGCGG + Exonic
1165501730 19:36194827-36194849 CTGGGTCAAAGGAGGGAGAGAGG - Intronic
1165926311 19:39328229-39328251 CTGGGTCCCGGGAGGGAAGGAGG - Intergenic
1166566949 19:43771162-43771184 CTGGGTCTATGGAGGGAAGGAGG + Intronic
1166703203 19:44893944-44893966 CTGGGTCTGTGGAGAGGAGGGGG - Exonic
1166730965 19:45058893-45058915 ATGGGTGGATGGAGGGAGGGAGG - Intronic
1167101897 19:47408825-47408847 CTGGGTGGATGGTGGGCAGGTGG + Intronic
1167248063 19:48385716-48385738 CTTGGTTTGTGGAAGGAAGGTGG + Intronic
1167249255 19:48391928-48391950 CTGGGTCTAGGGGAGGAAGTAGG - Intergenic
1167515041 19:49918445-49918467 CTGGTTCTGTGGAGGAGAGGTGG - Intronic
1167679579 19:50910879-50910901 CTGGGTCCATGGATGGGAGAGGG - Intergenic
1167793002 19:51692337-51692359 CTGGGTCTCTGGGGAGAAGGAGG + Intergenic
1167842696 19:52135061-52135083 GTGGGTCTATGGCAGGATGGTGG - Intronic
1168239944 19:55083882-55083904 CTGGGCCTAAGGGAGGAAGGGGG + Intronic
924998550 2:385893-385915 CTCCCTCTCTGGAGGGAAGGTGG + Intergenic
926252333 2:11162195-11162217 CTGTGTCTATGGAGGGAGCTGGG + Intronic
926743305 2:16129947-16129969 CTGAGTCTTGGGAGGGATGGCGG - Intergenic
929950297 2:46405128-46405150 CTGGGGATAAGGATGGAAGGAGG - Intergenic
930086377 2:47500430-47500452 CTGAGTCGATGGAAGGAAGGAGG + Intronic
930914921 2:56674576-56674598 CTCAGTCTATGGGGTGAAGGTGG - Intergenic
932837552 2:75051357-75051379 CTGGGTTGATGTAGGGCAGGAGG + Exonic
933432164 2:82196916-82196938 CTGGGTCTGTGGAGGGTGAGTGG - Intergenic
935549017 2:104431934-104431956 CTGGGTGAATGGAGAGAAGCGGG + Intergenic
935831529 2:107005699-107005721 CTGAAGCTAAGGAGGGAAGGAGG - Intergenic
935842406 2:107127980-107128002 ATGGGGCTATGGAAGGAATGAGG - Intergenic
936558971 2:113520042-113520064 CTGGGTCTAAGGACAGAAGGAGG + Intergenic
936978403 2:118241656-118241678 CTGGGGCCATGGAGGGTGGGTGG + Intergenic
937159346 2:119745755-119745777 CTGGTTCTGTGGAAGGAAGTTGG - Intergenic
939500386 2:142976208-142976230 CTGGGGCTATGTGTGGAAGGAGG + Intronic
939575813 2:143893369-143893391 CTGTGTCTATGGAGACAAGTCGG - Intergenic
939875025 2:147568215-147568237 ATGAGTATATGGAGGGATGGAGG + Intergenic
939875044 2:147568279-147568301 ATGGGTGGATGGAGGGAAGGAGG + Intergenic
940694372 2:156959866-156959888 CTGAGCCTGTGGAGGGAGGGAGG + Intergenic
942076363 2:172360190-172360212 CAGGGTGTATGAAGGGCAGGGGG - Intergenic
945467595 2:210187301-210187323 CAGGGCCTGTGGAGGGTAGGGGG + Intergenic
945532508 2:210973775-210973797 ATGGGTCTAGCAAGGGAAGGGGG - Intergenic
946051549 2:216866927-216866949 CTGGGTCTATCTGGGGAAGGAGG + Intergenic
946154986 2:217801377-217801399 CTGGGTGTCTGGAGGGAAGAGGG - Exonic
947589735 2:231378785-231378807 CTGGGTTTACTGAGGGAAGGTGG + Intergenic
948131888 2:235607189-235607211 CTGGGTCTGGGCAGGGAAGGGGG - Intronic
948301168 2:236908613-236908635 CTGTGTGGCTGGAGGGAAGGCGG - Intergenic
948672588 2:239578031-239578053 CTCGGGCTATGAAGGGTAGGAGG + Intergenic
948716038 2:239864486-239864508 CTGCAGCTATGGAGGGTAGGGGG + Intergenic
948809512 2:240467517-240467539 CTGGGGCACAGGAGGGAAGGAGG - Exonic
1170943474 20:20868493-20868515 CTGGGTCTATTCAGGAAATGTGG - Intergenic
1172129342 20:32645382-32645404 GGGGGTGTATGGAGGGGAGGGGG + Intergenic
1172186913 20:33036625-33036647 CTAGGGCTGTGGAGGGAGGGAGG + Intronic
1175372250 20:58499795-58499817 ATGGGGCTAGGGAGGGAAGCTGG - Intronic
1175681792 20:60994715-60994737 CTGGTTCTATGGGGGGAACTGGG - Intergenic
1176093052 20:63327434-63327456 CAGGCTCCATGGAGGGTAGGGGG + Intronic
1176292364 21:5052862-5052884 ATGGATGAATGGAGGGAAGGAGG - Intergenic
1176295682 21:5070897-5070919 CTGAGTCTATGGATGGAGGGAGG + Intergenic
1176359484 21:5982937-5982959 CTGGTTCTAGGGAGGGATGGTGG + Intergenic
1177125198 21:17185250-17185272 CTGGGTTTATAGAGGGAGGAAGG - Intergenic
1179050917 21:37888009-37888031 CTGGAGCTGTGTAGGGAAGGTGG + Intronic
1179764034 21:43555613-43555635 CTGGTTCTAGGGAGGGATGGTGG - Intronic
1179861365 21:44191227-44191249 CTGAGTCTATGGATGGAGGGAGG - Intergenic
1179864893 21:44210788-44210810 ATGGATGAATGGAGGGAAGGAGG + Intergenic
1180081654 21:45490119-45490141 CAGGGGCTGTGGAGGGATGGAGG - Intronic
1180137695 21:45871793-45871815 CCAGTTCCATGGAGGGAAGGTGG + Intronic
1180958368 22:19751127-19751149 CTGGGTCTCAGGAGGGAACCGGG + Intergenic
1181388817 22:22564388-22564410 CTGGGTGTACAGAGGGCAGGAGG + Exonic
1181469194 22:23127531-23127553 CTGGGTCCATCGAAGGAAGCTGG + Intronic
1182013900 22:27023026-27023048 CTGGGGCTAGGGAGGGAGGGAGG + Intergenic
1182074252 22:27484083-27484105 GTTTGGCTATGGAGGGAAGGAGG - Intergenic
1182232621 22:28850032-28850054 ATGGGTGTATGGACGGGAGGGGG - Intergenic
1182320331 22:29474858-29474880 CTGGTTGTCTTGAGGGAAGGAGG - Intergenic
1183037351 22:35150293-35150315 CTGATTCGATGGTGGGAAGGTGG + Intergenic
1183049584 22:35250076-35250098 CTGGGTGAAAGGAGGTAAGGAGG - Intergenic
1183085794 22:35486242-35486264 CAGGGTCTGAGGACGGAAGGAGG - Intergenic
1183208405 22:36434778-36434800 CCGGCTGTGTGGAGGGAAGGGGG + Intergenic
1183258301 22:36777267-36777289 CTAGGTGTCTGGAGGGAATGTGG - Intergenic
1183343029 22:37292527-37292549 CTGGGTTTCCGGAGGGAAGGGGG + Intronic
1183371555 22:37435474-37435496 CTGGGTCTATGGCGGAAGAGAGG - Intergenic
1183785856 22:40028735-40028757 CTGCCTGTAGGGAGGGAAGGGGG - Intronic
1184878109 22:47288346-47288368 GTGGGTGGATGGAGGGAGGGAGG - Intergenic
1185070643 22:48654004-48654026 CGGCGGCTCTGGAGGGAAGGGGG + Intronic
1185111489 22:48902514-48902536 CAGGGTCTCGGGAGGGGAGGAGG + Intergenic
952518739 3:34132727-34132749 TTGGCTCTGTGGAGGGAAGTTGG + Intergenic
953127038 3:40101185-40101207 CTGGGAGAATGGAGGAAAGGGGG - Intronic
953564650 3:44021432-44021454 TTGGGTATAGGGAGGGAAGGAGG - Intergenic
953937932 3:47062571-47062593 CTGAGTCTTTGGAGGGAAAGAGG - Intronic
955799285 3:62669292-62669314 ATGGGGCTGTGGAGGAAAGGAGG - Intronic
956437411 3:69247281-69247303 CTGGGGCTAAGTGGGGAAGGTGG + Intronic
959190517 3:103104582-103104604 CTGGGTTTAAAGATGGAAGGAGG + Intergenic
959420466 3:106121783-106121805 CTGGGACTTTGGAGGCAAGGGGG + Intergenic
960538148 3:118835487-118835509 CTTTTGCTATGGAGGGAAGGAGG - Intergenic
960815319 3:121665946-121665968 CTGGCTCTCAGGAGGGAAGCAGG - Intronic
960969609 3:123130268-123130290 CTGGGGCTTTGCGGGGAAGGTGG + Intronic
961404903 3:126672138-126672160 CTGCGCCTTTGGAGGGGAGGGGG + Intergenic
962104782 3:132379324-132379346 CTGTGTCTATGGAGGAAGGTGGG + Intergenic
962732778 3:138299024-138299046 TGAGGTCTAAGGAGGGAAGGGGG + Intronic
962810008 3:138951584-138951606 ACGGGTCTTTGGAGGGAAGAGGG - Exonic
963247310 3:143075065-143075087 CTGGGTCTCTGGAGGAAAACCGG + Intergenic
963448730 3:145449226-145449248 CATGGTCTATGGAGGGAAAGAGG + Intergenic
965980802 3:174687567-174687589 CTGGCTTTATGGTGAGAAGGGGG + Intronic
966344893 3:178968436-178968458 CTGGGTCTATGCCGGAGAGGAGG - Intergenic
966857184 3:184202890-184202912 CTGGATCTTTGGTGGGAAGGAGG - Intronic
967280115 3:187814143-187814165 ATGGAACTATGCAGGGAAGGGGG - Intergenic
967438390 3:189477849-189477871 CTGGGCTTCTGGAGGGGAGGGGG - Intergenic
967813350 3:193779198-193779220 CTGGATCTTTGGGAGGAAGGAGG + Intergenic
968823968 4:2879061-2879083 CAGGGTCTTTGGAGGAGAGGAGG + Intronic
969424953 4:7118687-7118709 ATGGATGGATGGAGGGAAGGAGG + Intergenic
969516013 4:7648626-7648648 CTGGGTCTACTGAGGGCGGGCGG + Intronic
969586392 4:8096709-8096731 CAGGGGCTGGGGAGGGAAGGGGG + Intronic
971153477 4:24058501-24058523 CTGGGTATGTGGTGGGAAGAGGG - Intergenic
972741689 4:41893220-41893242 CTTGGTGTCTGGAGGGAGGGAGG - Intergenic
972774112 4:42225796-42225818 CTGGGACCAAGGAGGAAAGGAGG - Intergenic
972976607 4:44643668-44643690 CTGAGGCTATGAAGGGAAGAGGG - Intronic
973180213 4:47257548-47257570 GTGGGTGTAGGGAGGGAGGGTGG + Intronic
976158015 4:82168659-82168681 CAGGGCCTATGGAGGGGTGGAGG + Intergenic
979215469 4:118158848-118158870 ATGACTCTATGGAAGGAAGGAGG - Intronic
983919887 4:173334113-173334135 CTGGGTCTGTGGAGGGCCGGCGG - Intronic
984863627 4:184261621-184261643 TTGGGTGGATGGTGGGAAGGGGG + Intergenic
984993976 4:185409926-185409948 AAGAGCCTATGGAGGGAAGGTGG + Intronic
985643614 5:1074869-1074891 CTGTGGCTGTGGAGGGAACGAGG + Intronic
985827666 5:2204949-2204971 CTGGGTAGAAGGAGGGAGGGAGG + Intergenic
986555630 5:9007863-9007885 CTGGGTGTGAGGAGGGGAGGTGG + Intergenic
986773292 5:10992855-10992877 CAGGCTCTCTGGAGGGAAGGAGG - Intronic
987206080 5:15627439-15627461 CTGGGTCCATGTAGGGAAAATGG + Intronic
988099488 5:26658969-26658991 CTGAGTCCTTGGAGGGAAAGAGG - Intergenic
989239856 5:39191282-39191304 GTAGGTCTATGGAGGTAAAGAGG - Intronic
990729970 5:58797553-58797575 CTATCTCTATGGAGGGAAGGAGG - Intronic
991435275 5:66591898-66591920 CTGGCTCTATAGAAAGAAGGTGG - Intergenic
991912604 5:71576570-71576592 CTGGGTCTATGGAGGGGGGTAGG - Intergenic
992025066 5:72662159-72662181 CTGGGTCTGTGGAGGGCAGTGGG - Intergenic
992090404 5:73311592-73311614 CTGGGTCCATGGGCGGAGGGCGG - Intergenic
992103826 5:73433755-73433777 CTGTTTCTGTTGAGGGAAGGAGG + Intergenic
992467036 5:77016162-77016184 CTGGGGTGATGGTGGGAAGGTGG + Intergenic
994775130 5:104030354-104030376 CTGGGCCTATAGAGGGAAAAAGG - Intergenic
995048083 5:107672002-107672024 CTGTGCCTAAGGAGGGAAAGAGG - Intergenic
995971838 5:117982146-117982168 CTGCTTTTATGGAGGGTAGGAGG + Intergenic
996290263 5:121844402-121844424 TTGGGTCTTTGGAAGGAAGACGG - Intergenic
998024963 5:138808264-138808286 GGAGCTCTATGGAGGGAAGGAGG - Intronic
998402045 5:141853208-141853230 CTGGGGCCATGGTGGGATGGGGG - Exonic
998410050 5:141902994-141903016 CTGGCTACAAGGAGGGAAGGGGG - Intergenic
999775780 5:154812087-154812109 CTGGGTATATCAAGGGAAGTTGG + Intronic
1000169148 5:158684630-158684652 CTGGGCCCGTGGAGTGAAGGTGG + Intergenic
1000571817 5:162924191-162924213 GTGTGTTTGTGGAGGGAAGGAGG + Intergenic
1001231672 5:169994086-169994108 GTGGGTGTAGGGAGGGCAGGTGG + Intronic
1002551393 5:179995430-179995452 CTGGGTCTTTGGTAGGAAAGGGG - Intronic
1003116441 6:3286814-3286836 CTGGGTGCAGGGAGGGAAGCTGG - Intronic
1003683211 6:8276142-8276164 ATGGGTATATGGCGGGAAGAGGG + Intergenic
1003770264 6:9291353-9291375 CTGAATTTATTGAGGGAAGGGGG - Intergenic
1004314002 6:14570581-14570603 CTGGCTCCATGGTGGGAAGAGGG + Intergenic
1006407600 6:33854386-33854408 CTGGGTCGGGGGAAGGAAGGAGG - Intergenic
1006442472 6:34060930-34060952 GTGGGTCCCTGGAGGGATGGAGG - Intronic
1006780859 6:36631511-36631533 CTGGCTCCAGGGAGGGAAGATGG - Intergenic
1007183498 6:39947937-39947959 ATGGGTGTAGGGAGGGAGGGAGG + Intergenic
1007364993 6:41385032-41385054 CTGTGTGTATGTGGGGAAGGGGG - Intergenic
1007382516 6:41499839-41499861 CTGGGACTTTGGGGGGAGGGCGG + Intergenic
1007482928 6:42162044-42162066 CTGGGTAGGTGGAGGGATGGAGG + Intronic
1007683225 6:43648800-43648822 CTGGGGCTCTGGAAGGCAGGTGG + Intronic
1008789519 6:55213459-55213481 GTGGTTCCATGGACGGAAGGAGG - Intronic
1010041950 6:71395254-71395276 CTGGGTCTCTGGTGTGCAGGAGG - Intergenic
1012063111 6:94512062-94512084 CTGAGCCCCTGGAGGGAAGGGGG + Intergenic
1015342701 6:132119860-132119882 CTGGGACTTTTGAGGGAGGGCGG + Intergenic
1015866127 6:137728588-137728610 CTGGGTTTATGCAGGCTAGGTGG - Intergenic
1018868272 6:167761837-167761859 ATGGGTGGATGGAGGGATGGGGG - Intergenic
1019314257 7:377246-377268 CTGGGGCAGTGGATGGAAGGGGG + Intergenic
1019510480 7:1415193-1415215 GTGGGTGAATGGAGGGAGGGAGG + Intergenic
1019510510 7:1415289-1415311 GTGGGTGAATGGAGGGAGGGAGG + Intergenic
1019747974 7:2711149-2711171 CTGAGGCTGTGGAGGGAAGAGGG + Intronic
1020168098 7:5823652-5823674 CTGGGTCTCTAGGGGGAAGAAGG + Intergenic
1021835482 7:24668707-24668729 ATGGGCATATGGAGGAAAGGGGG + Intronic
1022412654 7:30151086-30151108 GTGGGTCACTCGAGGGAAGGTGG - Intronic
1023063207 7:36349514-36349536 GTGGGTGTGTGGAGGCAAGGAGG - Intronic
1024254292 7:47528288-47528310 CTGGGGGTCTGCAGGGAAGGAGG + Intronic
1024364745 7:48508101-48508123 GTGCGTGTATGGAGGGATGGAGG + Intronic
1026828894 7:73599961-73599983 CTGGGGCTGGGGAGGGGAGGGGG - Intronic
1027414306 7:77958694-77958716 CAGCCTCTCTGGAGGGAAGGTGG + Intergenic
1029482833 7:100823492-100823514 TTAGGTCTGGGGAGGGAAGGGGG - Intronic
1029705058 7:102271687-102271709 CTGGGTCCCTGGCAGGAAGGTGG - Intronic
1031468569 7:122143663-122143685 CTGGGCGTGGGGAGGGAAGGGGG + Intronic
1032239249 7:130148347-130148369 CTAAGTCTATGGTGGAAAGGTGG - Intergenic
1032722003 7:134557736-134557758 CTTGGTCTAAAGAGGGGAGGAGG - Intronic
1033273476 7:139953687-139953709 CTGGGTCTGTGGAGGTCAGAGGG - Intronic
1033534703 7:142300932-142300954 CTGGTCCTGTGGAGGAAAGGAGG - Intergenic
1035199074 7:157248457-157248479 CAGGGTCTAGGGAGGCGAGGTGG - Exonic
1035436492 7:158863737-158863759 CCGGGTGTGTGGGGGGAAGGGGG + Intronic
1036749376 8:11434339-11434361 CTGGGACTGTGGATGGGAGGGGG + Intronic
1038581015 8:28749487-28749509 CTGGCTCCATGGAGGGGAGCAGG - Intronic
1041100591 8:54392740-54392762 CTTTGTCTATGCAGAGAAGGAGG + Intergenic
1041692608 8:60703750-60703772 CTGGCTCAATAGAGGGAAGGTGG - Intronic
1042992186 8:74654303-74654325 CTTAGATTATGGAGGGAAGGAGG + Intronic
1043837654 8:85064677-85064699 CTGGGTGTGAGGAGGGGAGGTGG - Intergenic
1044629784 8:94267088-94267110 CTGGGCCAATGGAGGGAAGGAGG - Intergenic
1044930257 8:97245291-97245313 CTGGGGGAATGAAGGGAAGGGGG - Intergenic
1045506512 8:102782411-102782433 CTGGGTGTGTGGAGGGACAGAGG + Intergenic
1048517423 8:135123643-135123665 CTGAGTCTAGGGAGGCAAAGTGG - Intergenic
1048812059 8:138297660-138297682 CTGGGAGTATGAAGAGAAGGAGG + Intronic
1048898198 8:139013652-139013674 CTGGGGCTATGAAGGGAACCTGG + Intergenic
1049188579 8:141272790-141272812 CTGGTGTTGTGGAGGGAAGGGGG - Intronic
1049250131 8:141583777-141583799 CTGGGTCTGGGGAGGCAGGGGGG + Intergenic
1049529487 8:143147252-143147274 ATGGGTGTTTGGAGAGAAGGGGG + Intergenic
1049595948 8:143483426-143483448 CTGGGGCAATGCAGGGGAGGTGG + Intronic
1049893880 9:96139-96161 CTGGGTCTAAGGACAGAAGGAGG - Intergenic
1051543131 9:18243733-18243755 CTGGGTCTGTGGACAGAAGATGG - Intergenic
1053735108 9:41096223-41096245 CTGGGTCTAAGGACAGAAGGAGG - Intergenic
1054693274 9:68335174-68335196 CTGGGTCTAAGGACAGAAGGAGG + Intronic
1054933799 9:70665160-70665182 CCGGGTCTAGGGATGGCAGGAGG + Intronic
1055058463 9:72045185-72045207 CAGGTACTATGGAGGTAAGGAGG - Intergenic
1055123626 9:72692485-72692507 TTATGTCCATGGAGGGAAGGCGG + Intronic
1056064828 9:82923284-82923306 CTGGTTCTGTGCAGGGAGGGAGG + Intergenic
1057794956 9:98148978-98149000 CTGGGGTTAAGGAGGGAATGGGG + Intronic
1057894029 9:98891928-98891950 CTGGGTCTATGCATGATAGGTGG + Intergenic
1059208964 9:112493423-112493445 CTGGGAAAATGGATGGAAGGTGG - Intronic
1060206755 9:121686819-121686841 CTGGGGCTCTGGAGGAAATGTGG - Intronic
1060545596 9:124457368-124457390 CTAGGCCTATGGCAGGAAGGAGG + Intronic
1060721792 9:125984486-125984508 CTGGGACTCTGGAGGGAAGGAGG - Intergenic
1061595200 9:131624473-131624495 CAGGGTCTATAGAGGGGAGAAGG - Intronic
1061947352 9:133916148-133916170 CAGGGAGAATGGAGGGAAGGAGG + Intronic
1062649710 9:137569326-137569348 GTGGGTAGATGGATGGAAGGTGG - Intronic
1185618073 X:1435327-1435349 CTGGGCCTATGGCGGGCAGGGGG + Intronic
1186150461 X:6669408-6669430 ATGGATCTATAGAGGGAAGCAGG + Intergenic
1187122756 X:16425208-16425230 TTGGGTGGTTGGAGGGAAGGAGG - Intergenic
1187357597 X:18591778-18591800 CTGAGTCTAGGGGAGGAAGGAGG - Intronic
1188144749 X:26597195-26597217 CTGGGTCTTAGGAGGGCAGGGGG + Intergenic
1189005921 X:36994930-36994952 CTGTCTCCATGGCGGGAAGGAGG - Intergenic
1192261455 X:69508147-69508169 CTGGGTCTTTTGTGGGAAGAAGG + Intronic
1195481031 X:105345461-105345483 CTGGGTCTCAGAAGGGCAGGAGG - Intronic
1196124025 X:112081250-112081272 GTGTGTCTAGGGAGGGAGGGAGG + Intronic
1197586633 X:128355943-128355965 CTGAGTCTAGGGAAGGTAGGAGG - Intergenic
1197611123 X:128639425-128639447 CTGGGTCTATGGAGTGCAAGTGG + Intergenic
1199549611 X:149044356-149044378 CTGTGTCTCCTGAGGGAAGGAGG + Intergenic
1199560030 X:149152048-149152070 CTCAGTCTATGGAGGGAGGGAGG - Intergenic
1199680804 X:150223384-150223406 CTGGGGCTATGGGGGCAGGGAGG - Intergenic
1199746676 X:150776112-150776134 CAAGGTCTTTGGAGGGAAAGGGG - Intronic
1199996372 X:153029101-153029123 CTGGGGCTATGCAGGGAAACTGG - Intergenic
1201691760 Y:16774963-16774985 ATGGGTGTAGGGAGGGAGGGAGG - Intergenic