ID: 1166567177

View in Genome Browser
Species Human (GRCh38)
Location 19:43772328-43772350
Sequence CTCCTCTCTGCTGTGTGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 492
Summary {0: 1, 1: 1, 2: 10, 3: 58, 4: 422}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166567173_1166567177 12 Left 1166567173 19:43772293-43772315 CCATTAAGTTCTGAGCTTTGGAA 0: 1
1: 0
2: 1
3: 23
4: 246
Right 1166567177 19:43772328-43772350 CTCCTCTCTGCTGTGTGACCTGG 0: 1
1: 1
2: 10
3: 58
4: 422
1166567171_1166567177 25 Left 1166567171 19:43772280-43772302 CCTGGACAAAAAGCCATTAAGTT 0: 1
1: 0
2: 1
3: 10
4: 192
Right 1166567177 19:43772328-43772350 CTCCTCTCTGCTGTGTGACCTGG 0: 1
1: 1
2: 10
3: 58
4: 422

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166567177 Original CRISPR CTCCTCTCTGCTGTGTGACC TGG Intronic
900131765 1:1090237-1090259 CTCATCTGTGCTGCGGGACCTGG - Intronic
900853502 1:5162462-5162484 ATCCACTCTGCTGTGTGCCTGGG - Intergenic
900956514 1:5889506-5889528 CCCCTCTTTGCTGTGCCACCTGG - Intronic
901328398 1:8384204-8384226 CCCCTCTAGGCTGTGTGACTGGG + Intronic
902449041 1:16485104-16485126 CTCCAATCGACTGTGTGACCTGG - Intergenic
902622066 1:17656420-17656442 CGCCTTTCGGCTGTGTGGCCAGG - Intronic
903154696 1:21435847-21435869 CTCCCATCAACTGTGTGACCTGG + Intergenic
903182684 1:21612972-21612994 CTCCTATCTGCTGTGCACCCTGG + Intronic
903831323 1:26177152-26177174 CTCTTGTTAGCTGTGTGACCTGG - Intergenic
904245752 1:29186834-29186856 CTGCTGCCTGCTGTGTGATCTGG + Intergenic
904610911 1:31725855-31725877 ATCCTGCCTGCTGTGAGACCTGG - Intergenic
904993393 1:34612272-34612294 CTGCTGTGTGCTGTGTGATCGGG + Intergenic
905016427 1:34781715-34781737 CTCGCCTCTGCTGTGGGCCCCGG + Exonic
905451189 1:38057700-38057722 CTCTTACCAGCTGTGTGACCAGG + Intergenic
905602575 1:39266693-39266715 CTGCTTTCTGCTGTGTGGCCTGG + Intronic
906362859 1:45178837-45178859 CTGCTCTCTGCTGTATAATCTGG + Intronic
906543145 1:46603569-46603591 CACCTCTTAGCTGTGTGTCCTGG - Intronic
907150779 1:52285387-52285409 CTCACCTCTGCTGTGTGGCCTGG - Intronic
907165075 1:52403523-52403545 CTCGTCTCTGCTGTGTTAGGTGG - Intronic
907274000 1:53306954-53306976 CCTCTGACTGCTGTGTGACCTGG - Intronic
907301194 1:53487229-53487251 GTCCTCCCTGCTTTGTGGCCTGG + Intergenic
908787787 1:67752288-67752310 CTCTTCTCTCCAGTGAGACCTGG - Intronic
910099228 1:83558943-83558965 CTCCTCTCTGATCTGTAGCCTGG - Intergenic
912999568 1:114566120-114566142 AGCCTCTCTGCTCTGTGTCCTGG + Intergenic
915123749 1:153649157-153649179 CTCTTCTCTGTTGTCTGAACTGG - Intergenic
915364181 1:155304950-155304972 TTCCACTCTGCTGTGGGGCCAGG + Intergenic
916503099 1:165403823-165403845 ACCCTCTTTGTTGTGTGACCTGG + Intronic
916832690 1:168509342-168509364 CTCCTCTCTGATGTGTTAACTGG + Intergenic
917485271 1:175449761-175449783 CTCCTCCCTCCTGTATGAGCAGG - Intronic
918368278 1:183832689-183832711 TGCCTCTTAGCTGTGTGACCTGG + Intronic
919350585 1:196448526-196448548 CTGCCCTCTACTGTGTGGCCTGG + Intronic
919818309 1:201456003-201456025 CTCCTCCCTGCTGTGTCTCCTGG - Intergenic
920414994 1:205793210-205793232 CTCCTCCCAGCTGTGTGTCCTGG - Intronic
920441914 1:205986406-205986428 CTTCTCTCAGCTATGTGATCTGG - Intronic
922721973 1:227903978-227904000 GTCCTCTCTGGGCTGTGACCTGG + Intergenic
922969602 1:229724900-229724922 CTATTTTCTGCTGTGTGACAGGG - Intergenic
922995331 1:229953321-229953343 CTACACACTGCTGTTTGACCAGG - Intergenic
923219717 1:231882037-231882059 CTCCTCCCTGCTGTGGGCCCAGG + Intronic
1063614495 10:7590177-7590199 CTCCTCGCTGCTCTCTGTCCCGG + Intronic
1064470340 10:15629092-15629114 CTGCTCTTGGCTGTGAGACCAGG - Intronic
1064486101 10:15792199-15792221 CTCAGCTCTGGTGTGTGACTTGG - Intronic
1065958189 10:30711250-30711272 CTCCCCACTGCTGTGTCACAGGG - Intergenic
1067731420 10:48814411-48814433 CTCCTCGCTCATGAGTGACCTGG + Intronic
1067738644 10:48878681-48878703 CTGCTCCCTGCTCTGAGACCTGG + Intronic
1069694911 10:70379639-70379661 TCCCTCTCTGCTGTGAGGCCAGG - Intronic
1069869913 10:71526840-71526862 CCCATCTCTGCTCTGTGACGTGG - Intronic
1070737091 10:78870573-78870595 CTCATCTTTCCTGTGTGGCCTGG + Intergenic
1070775156 10:79105347-79105369 CCACTGACTGCTGTGTGACCTGG + Intronic
1071172384 10:82881660-82881682 CTCCTATATGCTGTGAGACATGG + Intronic
1071474840 10:86017311-86017333 CTTCTCTGGGCAGTGTGACCAGG + Intronic
1071533781 10:86410572-86410594 TTCCTCTCAACTGTGTCACCTGG - Intergenic
1071672136 10:87618675-87618697 CTCCCCTCTGCTCTGCGCCCCGG - Intergenic
1072553582 10:96497417-96497439 CTCCACTCTGCTCTGTGTCCAGG + Intronic
1072739129 10:97899193-97899215 GTCCTCTCTGCTGCGTGCTCAGG + Intronic
1072782230 10:98258906-98258928 TTCCTCTCTCCTGCGTGTCCTGG + Intronic
1073151313 10:101313545-101313567 CTCCTCTATGAAGTGTCACCTGG - Intergenic
1073229810 10:101959510-101959532 CATCTCTGTGCTGTGTGTCCTGG - Intronic
1073996224 10:109318063-109318085 GTCCCTGCTGCTGTGTGACCAGG - Intergenic
1074258697 10:111830226-111830248 CTTCCCACAGCTGTGTGACCTGG - Intergenic
1075004188 10:118818704-118818726 CTCCTCACTGCTCCGTGCCCAGG + Intergenic
1075336212 10:121610485-121610507 CTTCTCTTTGCTGTGTGACCTGG + Intergenic
1075926298 10:126254222-126254244 CACCTATCAGCTGCGTGACCTGG + Intronic
1076205394 10:128596087-128596109 CTCCAATCTGCTGTGAGTCCTGG + Intergenic
1078640415 11:13090295-13090317 CTCCTCCCTGCTCTGTACCCAGG + Intergenic
1078847186 11:15128846-15128868 CTGCTGTCTGCTGTGTTAGCAGG + Intronic
1078857853 11:15221092-15221114 CTCTTCCTTGCTGTGTGACTTGG - Intronic
1078989574 11:16632906-16632928 GCCCTCTCTGCTGTATGCCCAGG - Intronic
1079706541 11:23627432-23627454 CTGCATTCTGCTGTGTAACCTGG + Intergenic
1080042515 11:27774093-27774115 TTCCTCTCTCCTATGTGACATGG - Intergenic
1080114502 11:28606887-28606909 CTCCCCTCAGCTCTGTAACCTGG - Intergenic
1080295134 11:30717967-30717989 CTCTTCTCTTCAGTTTGACCTGG + Intergenic
1080451343 11:32381307-32381329 CTCCTCTCTGCAGTGAGGCAGGG + Intergenic
1080694264 11:34587461-34587483 CTCCTTCCAGCTCTGTGACCTGG - Intergenic
1080855314 11:36106808-36106830 CCTCCCTCTGCTGTGTGACCTGG + Intronic
1081222795 11:40482768-40482790 TAGCTCTCTGATGTGTGACCAGG - Intronic
1081589333 11:44410083-44410105 CACCACTCCGCTGTGTGACCTGG + Intergenic
1081737059 11:45411483-45411505 AGCCTCTCTCCTGTGTGACAGGG + Intergenic
1081858461 11:46318409-46318431 CTGCCACCTGCTGTGTGACCAGG + Intronic
1083273291 11:61582811-61582833 CTACACTCTGCTTTGGGACCTGG + Intergenic
1083332705 11:61906360-61906382 CTGCCCCATGCTGTGTGACCTGG - Intronic
1083384546 11:62297814-62297836 CTTCCCTTTGTTGTGTGACCCGG - Intronic
1083881175 11:65548993-65549015 CACGGCTCAGCTGTGTGACCTGG + Intronic
1083898218 11:65630900-65630922 CTGCTCTGTGCTGGGTGAGCTGG - Intronic
1084092603 11:66888481-66888503 CTCCTCTGTGCTGGCTGCCCAGG - Intronic
1084411709 11:69009693-69009715 CTCCTCTGGGCTATGTGGCCGGG - Intronic
1084657479 11:70527830-70527852 CTCCTCTCTGCCCTTTGCCCTGG - Intronic
1084710779 11:70842655-70842677 CTGCTCCCTGCTGTGCCACCTGG + Intronic
1084945189 11:72634474-72634496 CCCCGTTGTGCTGTGTGACCAGG + Intronic
1085644362 11:78213624-78213646 CTCCTCTCATCTGTGTTCCCAGG + Exonic
1085692413 11:78674428-78674450 TTCCTCTCTGCTGTGTGAACTGG - Intronic
1085757794 11:79216031-79216053 CTCTTCATTGCTGTGGGACCAGG - Intronic
1086432777 11:86751533-86751555 CTCTTCTCTGCAGTGTGGGCAGG - Intergenic
1086850731 11:91804420-91804442 CTCTCCCCTGCTGTGTGATCAGG - Intergenic
1087829287 11:102801401-102801423 TACCGCTCTGCTGTGTGCCCTGG - Intergenic
1088132614 11:106512396-106512418 CACCCCTCTGTTGTATGACCTGG - Intergenic
1089300237 11:117494281-117494303 CTCCACTCTGCTGTTGTACCTGG + Intronic
1089787426 11:120918057-120918079 CTCATCTCTGCTGTGTGGCTGGG - Intronic
1089980459 11:122767696-122767718 GTCCTCTGTGCTGTGTGGCTTGG - Intronic
1090062548 11:123476557-123476579 CACCTCTCTGATGTGTTCCCTGG + Intergenic
1090409141 11:126495627-126495649 GTCCTCCCTGCTGTGACACCAGG + Intronic
1090776241 11:129968508-129968530 CCCCTCTCTTCTGTGGAACCTGG - Intronic
1090892510 11:130937607-130937629 TTTCTCTTTGCAGTGTGACCTGG + Intergenic
1091169292 11:133506215-133506237 TTCCTCTTTACTGTGGGACCTGG - Intronic
1091220613 11:133928030-133928052 CTCCTCGCTGCTTTGTTGCCTGG - Intronic
1091392002 12:131375-131397 CCTCTCTCTGCTCTCTGACCTGG + Intronic
1093204356 12:16229283-16229305 CTACTTTCTACTGTCTGACCAGG + Intronic
1093423561 12:19001796-19001818 CTCTTTACTACTGTGTGACCTGG - Intergenic
1094473684 12:30825321-30825343 CCCCTGTCTGCTGTGTGATGGGG + Intergenic
1094581653 12:31739179-31739201 CTCCTCTCTGCTCTGTGCTGGGG + Intergenic
1096554518 12:52395186-52395208 CTGCTCACTGCTGTGGGAACAGG + Exonic
1096631073 12:52927159-52927181 CTCCTCCCTGGGGTGTGTCCAGG - Intronic
1097052169 12:56230187-56230209 CTCTCCTCTGATGTCTGACCTGG - Intronic
1097184135 12:57187573-57187595 CCCTTCCCTGCTGTGTGATCTGG + Intronic
1097841517 12:64326199-64326221 CTCCTCTCTACCCTGTGCCCTGG - Intronic
1099559006 12:84149074-84149096 CTCCTCTCATCAGTGTGGCCTGG + Intergenic
1100090395 12:90961337-90961359 CTCTTCTCTGATTTGTGACTTGG + Intergenic
1101213461 12:102558044-102558066 CTACTCTCTTCTGTGTTGCCAGG + Intergenic
1101968881 12:109298849-109298871 CTCCTCCTGGCTGCGTGACCTGG + Intronic
1102077872 12:110074238-110074260 CTCCACCCTGCTCTGTGCCCCGG + Intergenic
1102508555 12:113399067-113399089 CTGTCCTCTGCTGTGTGTCCTGG - Intronic
1103763807 12:123268438-123268460 CTCCTCTATGCTGTGTGCCCTGG - Intronic
1104213830 12:126716049-126716071 CTCCTCTCTGCTATATGAAGAGG + Intergenic
1104311710 12:127659031-127659053 CTCCTGCCAGCTGGGTGACCTGG - Intergenic
1104360075 12:128124733-128124755 CTCCTCCGTGTTATGTGACCAGG + Intergenic
1106080422 13:26496016-26496038 CTCCACTTTGCTCTGTGTCCTGG - Intergenic
1106132589 13:26952383-26952405 CTCCTCCCTGCCCTGGGACCTGG + Intergenic
1106218536 13:27724776-27724798 CTATTCTCTGCTGTGTAGCCAGG - Intergenic
1106460079 13:29960797-29960819 AACCTCTCTGCTCTGTGACCTGG - Intergenic
1107017960 13:35723099-35723121 CAACTCTCAGCTGTGTGAGCTGG - Intergenic
1108969078 13:56349339-56349361 CTCCTCTCCACTGTGTGGGCAGG + Intergenic
1110165663 13:72440144-72440166 CTTCTCTCTACTGTGTGTCATGG + Intergenic
1113177941 13:107587904-107587926 CTCCTCTCTTCTGTATCTCCAGG + Intronic
1113302453 13:109037019-109037041 CTGCTCTCTGCTGTGCCACTGGG - Intronic
1113542930 13:111122983-111123005 CTCCACTCTGCTTTGTGTCCTGG - Intronic
1114268362 14:21086462-21086484 CTGCTACTTGCTGTGTGACCTGG + Intronic
1114710966 14:24777745-24777767 CTCCTCTCTACTGTCTCCCCAGG - Intergenic
1115527262 14:34293710-34293732 CTCCTCTCTGATGACTGACAGGG + Intronic
1118689790 14:68327042-68327064 CTGCTCTCTGCCCTGGGACCTGG - Intronic
1119416779 14:74476252-74476274 CTGCTCTCTGCTTTTTGATCTGG + Intronic
1121422063 14:93823393-93823415 CCTTTCTCAGCTGTGTGACCTGG - Intergenic
1121514254 14:94538784-94538806 CACCTGTCAGCTGTGTGTCCTGG + Intergenic
1121873252 14:97428537-97428559 CACCTTTCTGCTGTGTTACCGGG + Intergenic
1121956082 14:98214743-98214765 ATCCTCTCTGCTGTGTGTGTTGG + Intergenic
1122266958 14:100551093-100551115 CTCCTGTAGGCTGTGGGACCTGG + Intronic
1122320310 14:100851527-100851549 CAACTCTCTGCAGTGTGCCCAGG + Intergenic
1122388724 14:101365842-101365864 CGCCTCTGTGCTGTGTGAGGAGG - Intergenic
1122542338 14:102505408-102505430 TTCCCCGCTGCTGTGTGTCCTGG - Exonic
1122583296 14:102785538-102785560 ATGCTCTCTGCAGAGTGACCAGG - Intronic
1122833960 14:104421969-104421991 CCCCTCGCTCCTGTGGGACCTGG + Intergenic
1123759624 15:23422427-23422449 CCCCTCGATGCTGTGTGACCCGG - Intergenic
1124126247 15:26940174-26940196 TGCCTCTTTGTTGTGTGACCTGG + Intronic
1124372292 15:29110672-29110694 CTCCACATGGCTGTGTGACCTGG - Intronic
1124937031 15:34183201-34183223 CTCCTCTCAGCTGTGTGGGCTGG + Intronic
1126659355 15:51016812-51016834 CTCCTCCCTGTGCTGTGACCTGG + Intergenic
1127379007 15:58412294-58412316 TTCCTTACTGCAGTGTGACCTGG + Intronic
1127960816 15:63888980-63889002 CTCTCCCCAGCTGTGTGACCTGG + Intergenic
1129301034 15:74625682-74625704 CTGCATTCTGGTGTGTGACCCGG + Intronic
1129753263 15:78080617-78080639 CTCATCTGTGCTGGGTGACCAGG - Intronic
1129909151 15:79211951-79211973 CTGCCCTCTACTGTGTAACCTGG - Intergenic
1132291079 15:100704366-100704388 CTCCTCACAGCTCTGTGAACCGG + Intergenic
1133863174 16:9616232-9616254 CTCCACTCTGCTCTGTGACCTGG + Intergenic
1134102524 16:11462073-11462095 GTCCCCTCTGCTCTGTGGCCAGG - Intronic
1134456722 16:14400469-14400491 CCCCTCGATGCTGTGTGACCCGG + Intergenic
1136598310 16:31266722-31266744 CCCTCCTCTGCAGTGTGACCTGG - Intronic
1137610734 16:49815528-49815550 CTCCTGTTTGCTGTGTGACTTGG - Intronic
1137722462 16:50635403-50635425 CTCCACTCTCCTCTCTGACCTGG - Exonic
1138187590 16:54988284-54988306 CTGCTTGCTGCTCTGTGACCTGG - Intergenic
1138416692 16:56875730-56875752 CTCTTCCCTGCTGTGTGCACTGG - Intronic
1138448628 16:57079697-57079719 CTCCAGCCTGCTGTGTGGCCTGG + Intronic
1138756033 16:59486513-59486535 CTTCTCTCTGCAGTCTCACCAGG + Intergenic
1139339524 16:66259013-66259035 CACTTCCCAGCTGTGTGACCTGG - Intergenic
1139356614 16:66370753-66370775 CTCTTCTTTGCTGTGTTTCCTGG - Intronic
1139690282 16:68637074-68637096 CTCCTCTCAGCTCTGTGAGGTGG + Intronic
1140871829 16:79113661-79113683 CTGCTCTCAGCAGGGTGACCTGG + Intronic
1140920334 16:79531770-79531792 ACTCTTTCTGCTGTGTGACCTGG + Intergenic
1141326286 16:83062616-83062638 CTGCTGGCTGCTGTGTGACAGGG + Intronic
1141426829 16:83949657-83949679 CTCAGGTGTGCTGTGTGACCTGG - Intronic
1141530442 16:84642976-84642998 CTACTCCCAGCTGTGTGAACTGG - Intergenic
1141583855 16:85019847-85019869 CACCTCTTCACTGTGTGACCGGG - Intergenic
1141647387 16:85375024-85375046 CCACTCGCTGCTGTGTGACCTGG + Intergenic
1141670169 16:85487580-85487602 CCGTTCTCAGCTGTGTGACCTGG - Intergenic
1141854374 16:86671008-86671030 CTCCTGTCGACTGTGTGACTTGG + Intergenic
1142033020 16:87847747-87847769 CTGCTCACGGCTGTGGGACCTGG + Intronic
1142551201 17:741031-741053 CTCCTGTCAGCTGGGTGGCCTGG + Intronic
1142771138 17:2097856-2097878 CTACTCTCTGCTCTGCTACCAGG - Intronic
1143003401 17:3810365-3810387 CTCCTCTCTGGAGAGTTACCAGG - Intergenic
1143020300 17:3914115-3914137 CCACCCTCTGCTGTGTGACGTGG + Intronic
1143734135 17:8898527-8898549 CTCTTGTCAGCTATGTGACCTGG + Intronic
1144050020 17:11490453-11490475 TTCCTCCCTGCTCGGTGACCTGG - Intronic
1144150274 17:12436344-12436366 CTCTTATTAGCTGTGTGACCTGG - Intergenic
1144787235 17:17838626-17838648 CACCTGCTTGCTGTGTGACCTGG + Intergenic
1144909814 17:18672021-18672043 CTCATCACTGCTGCGTGACGTGG + Intronic
1144946828 17:18973607-18973629 CTCCACTTTGCTCTGTGGCCAGG + Intronic
1145254559 17:21315547-21315569 GTGCTCGCTGCTCTGTGACCTGG - Intergenic
1145779123 17:27550423-27550445 CTCCTCTCTGCTGTTTGCAGGGG - Intronic
1145888876 17:28400830-28400852 CACCTCACAGCTGTGTGACCGGG + Exonic
1146680632 17:34805218-34805240 CTCCTTCCTGCTGTGTGGACTGG + Intergenic
1146915514 17:36676019-36676041 CTCCTCCCAGCTGTGTGTCCTGG + Intergenic
1147148631 17:38500105-38500127 CTCTTCTCTGTTGTGTGCTCGGG + Intronic
1148738854 17:49880635-49880657 CTCCTCTCCGCGGAGGGACCCGG + Intergenic
1148847374 17:50537406-50537428 TTCCTCCAAGCTGTGTGACCTGG + Intronic
1149595526 17:57862541-57862563 CCCATCCCTGCTGGGTGACCGGG + Exonic
1151433323 17:74079652-74079674 CTCCCCTCTGCTCTGTGCCTTGG + Intergenic
1151598967 17:75094742-75094764 CTCCTCTCTGCAGGGAGTCCCGG - Intronic
1152317498 17:79589590-79589612 CTCCTCCCTGCTGCCTGCCCAGG + Intergenic
1152350602 17:79782046-79782068 CGCCTCTCTGCTGGGTGGCAGGG + Intronic
1152509795 17:80778767-80778789 CCCCACTCTGCTGTGTGGGCTGG - Intronic
1152885812 17:82848764-82848786 ATCCTCTCTCCTGTGTCTCCTGG + Intronic
1152928833 17:83099918-83099940 CCCCTCCCTGCTGGGTGAGCCGG - Intergenic
1153377213 18:4393969-4393991 CTCCTTCCTGCTGTGCGGCCAGG + Intronic
1154390810 18:13934566-13934588 CTCTTCTCTGCAGTGTGGGCAGG + Intergenic
1155921473 18:31607587-31607609 CTGCCCTCTGCTCTCTGACCTGG - Intergenic
1157057341 18:44246379-44246401 CCACTCTGAGCTGTGTGACCTGG + Intergenic
1157493783 18:48141165-48141187 CTCCTTCCTGCTGTGGGACTTGG + Intronic
1157903230 18:51541212-51541234 CTACCATTTGCTGTGTGACCTGG + Intergenic
1158446652 18:57528032-57528054 CTTATCTCTGCTCTGTGTCCGGG + Intergenic
1161271220 19:3390389-3390411 CTCTTGTCTGCTGTGGGAGCTGG - Intronic
1161658483 19:5530727-5530749 CACTTCTTGGCTGTGTGACCAGG + Intergenic
1162413040 19:10517774-10517796 CTCCTCTGTCCTGGGTGTCCGGG + Intronic
1162680105 19:12334023-12334045 CTCCCCTCTGCTCTGAGGCCAGG - Intergenic
1163215125 19:15871025-15871047 CTCAGCTCTGCTGTGTGACTTGG - Intergenic
1163228018 19:15978876-15978898 CTCGGTTCTGCTGTGTGACTTGG - Intergenic
1163228294 19:15980174-15980196 CTCAGCTCTGCTGTGTGACTTGG - Intergenic
1163371649 19:16904297-16904319 CTACACTCTGCTGGGTGACGTGG - Exonic
1163393789 19:17046752-17046774 CTCCCTTTTGCTGTGCGACCTGG - Intergenic
1163469902 19:17489984-17490006 CCCTGCTCAGCTGTGTGACCTGG - Intronic
1163736824 19:18986691-18986713 CCTCTCTGTGCTGTGTAACCTGG - Intergenic
1163795203 19:19334010-19334032 CCCCTCTCTCCTGTGTGATTGGG + Intronic
1163833431 19:19558893-19558915 CCCCTCACTGCTGTCTGTCCTGG + Intergenic
1164020926 19:21304386-21304408 CTCCTGTTTGATGTGGGACCTGG - Intronic
1164312044 19:24054535-24054557 CACCTTTGTGCTGTGTGCCCTGG - Intronic
1164832770 19:31335367-31335389 CTCCTGTCTTCCGTGAGACCTGG - Intronic
1165025849 19:32960873-32960895 CTCCTCCCTGTGCTGTGACCTGG - Intronic
1166031473 19:40133761-40133783 CTCCACTCTACTATGTGCCCAGG - Intergenic
1166146932 19:40844544-40844566 CCCCTCTCTGCGGTGTAGCCTGG - Intronic
1166151093 19:40876440-40876462 CCCCTCTCTGCGGTGTAGCCTGG - Intronic
1166179219 19:41095165-41095187 CCCCTCTCTGCGGTGTAGCCTGG + Intronic
1166297741 19:41897146-41897168 CACCCCTCTGCTCTGTGCCCTGG + Intronic
1166567177 19:43772328-43772350 CTCCTCTCTGCTGTGTGACCTGG + Intronic
1167528519 19:50000549-50000571 TGCTTCCCTGCTGTGTGACCTGG - Intronic
1168113797 19:54209588-54209610 CATCTCCCTGCTGTGTGTCCAGG - Intronic
1168596774 19:57683865-57683887 CACCTCTCTGCAGACTGACCAGG + Intronic
925341992 2:3144373-3144395 ATCCTTGCTGGTGTGTGACCTGG + Intergenic
925923040 2:8650714-8650736 CTCCTCTATTCTGTGTTTCCTGG - Intergenic
926239755 2:11075983-11076005 CTCCTGTCTGTTCTGTGACTAGG + Intergenic
926777260 2:16434865-16434887 GTCCCCTCTGCCCTGTGACCTGG - Intergenic
926783559 2:16498079-16498101 CTCGTCCCTGCTCTGTGCCCTGG - Intergenic
927138900 2:20116341-20116363 CCCTTGCCTGCTGTGTGACCTGG + Intergenic
927665818 2:25032089-25032111 CTCCTCGTTGCTCTATGACCTGG + Intergenic
927770820 2:25859621-25859643 CTCCTCTCTGCGTTTTGTCCAGG - Intronic
927967496 2:27280467-27280489 CTCCTCTCTTCAATGTGTCCAGG - Exonic
928620399 2:33082817-33082839 CTCCTCTCTGCCTTGTGTCCTGG + Intronic
930089343 2:47520610-47520632 CTCCTCGCTGCGGTATGCCCTGG + Exonic
933784041 2:85824154-85824176 GTCCTTTCTGCTGCTTGACCAGG - Intergenic
934755626 2:96822694-96822716 CTCCTCACTGCTGTTGGAGCTGG - Intronic
935129435 2:100250386-100250408 CACTGTTCTGCTGTGTGACCTGG - Intergenic
935560226 2:104551531-104551553 CTCCTCTATAGTGTCTGACCAGG - Intergenic
936073306 2:109385372-109385394 CTGCTCTCTGCAGAGTGACATGG - Intronic
936226580 2:110659546-110659568 CACTTCTCCGCTGTGTGACTGGG - Intronic
936810066 2:116387908-116387930 CTCCACCCTGCTCTGTGTCCTGG + Intergenic
937228371 2:120382781-120382803 CGACCGTCTGCTGTGTGACCTGG - Intergenic
937318619 2:120947700-120947722 CTCCTCTCTGGTGCCTCACCAGG - Intronic
937462726 2:122103348-122103370 CTCCTCACAGCAGTGTGTCCTGG - Intergenic
937463314 2:122108313-122108335 CTGCTCTCTGATGTGACACCTGG + Intergenic
937809624 2:126185045-126185067 CTGCTCTCTGCAGAGTGAGCAGG - Intergenic
938911893 2:135893143-135893165 TTCCACTCTGCTGTGTGTCCTGG - Intergenic
942040983 2:172062580-172062602 CTCCACTCTGCTCTGTGATCTGG - Intronic
943162322 2:184270038-184270060 TTACCCTCTGCTGTGTGGCCTGG + Intergenic
943870399 2:192989345-192989367 CTCCTCTTTGTTGTGTGAAAAGG + Intergenic
946063396 2:216965641-216965663 CTCCACTCTGCTCTCTGCCCTGG + Intergenic
946641553 2:221788952-221788974 CTCCACTCTGCTCTGTGCCCTGG - Intergenic
946766257 2:223043807-223043829 CTTCGTCCTGCTGTGTGACCAGG + Intergenic
947659382 2:231855404-231855426 CTCTCCTCTCCTGTGTAACCAGG + Intergenic
948232085 2:236356134-236356156 CTCCCCTCTGCTTGGTGACCTGG - Intronic
948693879 2:239723001-239723023 CTCCTGTCTGGTGTGTGATAGGG + Intergenic
948747889 2:240109192-240109214 CTGCTCTTTGCTGTGTTCCCAGG + Intergenic
948750648 2:240130573-240130595 CGCCCCTCTGCTGTGTGGGCAGG - Intronic
1169602356 20:7276104-7276126 CTTCTCACAGCTGTGTGACCTGG + Intergenic
1170624550 20:18021341-18021363 CACCCCTCTGCTGTTTGAACTGG - Intronic
1170828549 20:19819279-19819301 CTTCTCTCTGCTGTGTGAGAAGG - Intergenic
1171293399 20:23995395-23995417 CTCCTCTCTGCTTGTGGACCTGG - Intergenic
1171420401 20:25013872-25013894 CAGCTCTCTCCTGTGTGCCCAGG - Intronic
1172188228 20:33044825-33044847 CTCCTCTTTGCTGTGTGTCCTGG + Intergenic
1172772008 20:37387369-37387391 CTCCTCTCTGCAGTCTAGCCAGG + Intronic
1172853271 20:37981972-37981994 CTCCTCTCACCTGTGTTTCCTGG - Intergenic
1172870315 20:38131538-38131560 CTCTTCTTCACTGTGTGACCTGG + Intronic
1172872284 20:38143266-38143288 CTGCTTTCAGCTGTGTGACCTGG + Intronic
1173351384 20:42248618-42248640 CTCAACACTGCTGTGTGGCCAGG - Intronic
1174082164 20:47978251-47978273 CTCCTGTGTGCTGTATGATCAGG - Intergenic
1174134318 20:48368535-48368557 CTCCTGTGTGCTGTATGATCAGG + Intergenic
1174362668 20:50038733-50038755 CTGCTGTGTGCTCTGTGACCTGG - Intergenic
1174422487 20:50408696-50408718 CACCTCTTGGCTGTGTGACCTGG - Intergenic
1174450413 20:50616702-50616724 CTCTTCTCTGCTGTGTGACCGGG - Intronic
1175530753 20:59672975-59672997 CTCCTCTGGGCTCTGTGTCCAGG - Intronic
1175991940 20:62794137-62794159 CGCCTTCCAGCTGTGTGACCGGG - Intergenic
1176113722 20:63422149-63422171 CGCCCCTCTGCTGCCTGACCTGG - Intronic
1176369131 21:6052048-6052070 CTCATGTCTGCTGGGTGACTTGG + Intergenic
1177349937 21:19924497-19924519 TTCGTCTCTGCTTTGTGCCCTGG - Intergenic
1177754915 21:25334847-25334869 CTCCTTCCTACTTTGTGACCAGG + Intergenic
1177995739 21:28095037-28095059 CTCATCTCTGCTCTTAGACCTGG - Intergenic
1179600840 21:42476349-42476371 CTCCTCTCTGCTGGCTCCCCTGG - Intronic
1179754388 21:43486493-43486515 CTCATGTCTGCTGGGTGACTTGG - Intergenic
1180001219 21:44996375-44996397 CTCCTTTCAGCTCTGTAACCTGG + Intergenic
1180053454 21:45344543-45344565 CTCCCCCCAGCTGTGTGTCCAGG - Intergenic
1180824456 22:18853111-18853133 CTCCTCTCTGCTTGTGGACCTGG - Intronic
1181188278 22:21121437-21121459 CTCCTCTCTGCTTGTGGACCTGG + Intergenic
1181210920 22:21289056-21289078 CTCCTCTCTGCTTGTGGACCTGG - Intergenic
1181331008 22:22091219-22091241 CTCCTCTCTGTCCTGTGAGCAGG + Intergenic
1181398585 22:22637832-22637854 CTCCTCTCTGCTTGTGGACCTGG + Intergenic
1181501322 22:23317190-23317212 CTCCTCTCTGCTTGTGGACCTGG + Exonic
1181520737 22:23448210-23448232 CTCTTATCTGCTGTGGGCCCTGG - Intergenic
1181650832 22:24258228-24258250 CTCCTCTCTGCTTGTGGACCTGG - Intergenic
1181706550 22:24652511-24652533 CTCCTCTCTGCTTGTGGACCTGG + Intergenic
1181758772 22:25043424-25043446 TTACTTACTGCTGTGTGACCTGG - Intronic
1181988566 22:26819417-26819439 CTCCTCTTTGCAATGTGACTTGG - Intergenic
1182033011 22:27174894-27174916 CTTCTCCCTGCTCTGTGCCCGGG - Intergenic
1182079314 22:27518008-27518030 CTCCACTCTGCTGTGTGGCCTGG - Intergenic
1182281084 22:29218020-29218042 CTGCACTCTGCTGTGTGACTTGG + Intronic
1182302626 22:29346154-29346176 CTCCTCCCTGTTGTGTGGCCTGG - Intronic
1182547146 22:31082934-31082956 CGCCAGTCTGCTGTGTGGCCTGG - Intronic
1183063551 22:35349366-35349388 CTCCTCTCCCCTGTGTTAGCTGG + Intergenic
1183245687 22:36691645-36691667 CTGCCATTTGCTGTGTGACCTGG + Intronic
1183530771 22:38352117-38352139 CTCCTTCCTGCTGTGTGCACGGG + Intronic
1183650222 22:39149381-39149403 GTCCTCAGTGCTGTGTGGCCAGG - Intronic
1184087809 22:42275719-42275741 CTCTTCCTAGCTGTGTGACCTGG - Intronic
1184122269 22:42459759-42459781 CTCCTCCCTCCTGTCTGATCTGG - Intergenic
1184239875 22:43206450-43206472 CTCCTCTGTGCTGTGGGGGCAGG + Intronic
1184694701 22:46132953-46132975 CTCCTCACTCCTGTGCGACGTGG + Intergenic
1185058265 22:48592317-48592339 CCCCTTGCTGGTGTGTGACCTGG + Intronic
1185073810 22:48671811-48671833 CAGCTCCCTGATGTGTGACCAGG + Intronic
1203216027 22_KI270731v1_random:6374-6396 CTCCTCTCTGCTTGTGGACCTGG + Intergenic
1203274595 22_KI270734v1_random:79016-79038 CTCCTCTCTGCTTGTGGACCTGG - Intergenic
949349429 3:3110525-3110547 CTCTTCTCTGCTTTGTGAGCAGG + Intronic
949533190 3:4977497-4977519 CACCCCACTGCTGAGTGACCTGG - Intergenic
950090380 3:10290530-10290552 CCCCTCCCTGCTGAGTGCCCTGG - Intronic
950141802 3:10620841-10620863 ATCCTGCCTGCTGTGTGTCCAGG - Intronic
950211469 3:11126695-11126717 GTCCACTCTGCTGTGTCCCCAGG - Intergenic
950427563 3:12932725-12932747 CACCTATCAGCTGTGGGACCTGG - Intronic
950849802 3:16051497-16051519 CTCCTCTCTGGTGGGTGAAGAGG + Intergenic
952763152 3:36933501-36933523 GTGCTCACTGCTGTGTGGCCTGG - Intronic
953191311 3:40690692-40690714 CAGCTCTGTGTTGTGTGACCTGG - Intergenic
954124450 3:48520461-48520483 CTCCTCCCAGCTGTGGGCCCCGG + Intronic
955691090 3:61591445-61591467 CTCCTATCTGCTGTGTCACTGGG + Intronic
956167061 3:66405095-66405117 CGCCTCTCTGCTCTGGGCCCAGG - Intronic
956716860 3:72087012-72087034 CTCCTCTTTGCTGTGAATCCTGG - Intergenic
956845997 3:73183495-73183517 CTCCACTCTGCTCTATGCCCTGG + Intergenic
957518592 3:81289114-81289136 CTCCAGACTGCTGGGTGACCAGG + Intergenic
960941391 3:122937335-122937357 CTCCTGTCTGTTGTCTGGCCTGG - Intronic
961391865 3:126557214-126557236 CTATCCTCTGCTGCGTGACCTGG + Intronic
962322704 3:134405113-134405135 CTCCTGCCAGCTGTGGGACCTGG - Intergenic
963676394 3:148316744-148316766 CATCTTTCTGCTGTGTGGCCTGG + Intergenic
964736806 3:159926484-159926506 CTCTTCTCTACTGTGTGCCATGG - Intergenic
965692790 3:171375570-171375592 CTCCTCTCTGCTGTGAAGCTGGG - Intronic
967945164 3:194798345-194798367 GTTGGCTCTGCTGTGTGACCTGG - Intergenic
968705418 4:2075307-2075329 CTCATTGCTGCTGTGTCACCTGG - Intronic
968902471 4:3438151-3438173 CTCCTGTCTGCTGTGGGCCCAGG + Intronic
969101892 4:4775623-4775645 CTCCTGCCTGGTGTGTGACCCGG - Intergenic
969338092 4:6523317-6523339 CTCCTTCTTGCTGTGTGGCCTGG + Intronic
969573537 4:8023917-8023939 GGCCTCTCTGCGGTGTCACCTGG - Intronic
969578178 4:8048520-8048542 CTCCTCCCAGCTGTGTGACCTGG - Intronic
969671941 4:8594472-8594494 CTCAACTCTGCTGTGTGACCTGG + Intronic
970481164 4:16476745-16476767 TTCTTCTCTTCTGTGTGCCCTGG - Intergenic
970890021 4:21032983-21033005 CTCCTCTCTCCTCTTTGAACTGG + Intronic
972628459 4:40822989-40823011 CTCCTCTCTCCAGGGTGAACCGG + Intronic
973790480 4:54373804-54373826 CTCCTGTCTGCTGTGTCATTAGG + Intergenic
973821219 4:54663267-54663289 CTCTTCCCTGCTGTGTGCTCTGG + Intronic
976353287 4:84084806-84084828 CTTCGCTCTGCTTTGTAACCTGG + Intergenic
980705585 4:136488803-136488825 CTCCACCCTGCTTTGTGACCTGG - Intergenic
981490673 4:145336270-145336292 CTCCTCACTCCTGTGTAACCTGG + Intergenic
981747537 4:148066111-148066133 CTGCTCTCTGCTGGTGGACCTGG + Intronic
981747610 4:148066711-148066733 TTCTTATCTTCTGTGTGACCTGG + Intronic
984987191 4:185342840-185342862 CTCTTCATGGCTGTGTGACCTGG + Intronic
985158935 4:187024113-187024135 CTCCACTCTGCTGTGTGCTCTGG + Intergenic
985476424 5:81865-81887 CTCCCCTGGGCTCTGTGACCAGG - Intergenic
985627312 5:995763-995785 CTGCTCACTGCTGGGTCACCAGG - Intergenic
986112466 5:4733593-4733615 TTCCTCTCTGCTGTAGGACATGG + Intergenic
986252030 5:6068816-6068838 TTCTTCTCTGCTGTGAGACAGGG + Intergenic
986722114 5:10566712-10566734 TGCCTCTCTGCTGTGTGGCCTGG - Intronic
986923794 5:12720740-12720762 CTCTTAACTGCTGTGTGACATGG + Intergenic
987110350 5:14680380-14680402 CACCTCTGTCCTGTGTGTCCAGG - Intronic
987722560 5:21657250-21657272 CTCCTTTCTCTTGTCTGACCAGG - Intergenic
990566512 5:57034981-57035003 CACCTCTTTGCCGTGTGACCTGG - Intergenic
991976062 5:72184627-72184649 CTCCTCTGGCCTGGGTGACCAGG - Intronic
992459086 5:76943595-76943617 CTCCTCTCTGCTCTTGGTCCTGG + Intergenic
993841955 5:92890871-92890893 GTCCTCTCTTCTCTGTGTCCTGG + Intergenic
996937393 5:128965132-128965154 CTCCTCCCTGGGGTGTGAGCAGG + Exonic
997199521 5:132001388-132001410 CTTCTCTCTGCTGTGAGAGAAGG + Intronic
997258182 5:132445163-132445185 CTACTCTCCACTGTGTGACTTGG + Intronic
997622495 5:135307864-135307886 CTCCTCTCTCCTGGGGGGCCAGG + Intronic
997773609 5:136577420-136577442 CAACCCTGTGCTGTGTGACCCGG - Intergenic
998133833 5:139664367-139664389 CTCCTCCCTGCAGGGTGCCCAGG - Intronic
998797241 5:145833659-145833681 CTCCTCACTCCTCTGTGACCAGG + Intronic
998846502 5:146315549-146315571 CTCTTCCAGGCTGTGTGACCTGG - Intronic
999102185 5:149035751-149035773 GTCCTCTGTGCTGTGTGAGGTGG - Intronic
999110366 5:149115164-149115186 GTCCTCTGTGCTGTGTGAGGTGG - Intergenic
999608623 5:153344842-153344864 CTCCACTCTGCTATGTGGACAGG - Intergenic
1001533519 5:172481841-172481863 CTGCTTGCTGCTGTGTGACCTGG - Intergenic
1001534742 5:172490593-172490615 CCCCGAGCTGCTGTGTGACCTGG - Intergenic
1001585379 5:172830664-172830686 TCACTCTCTGCTGGGTGACCTGG - Intergenic
1002185519 5:177453050-177453072 CCCTTCTGAGCTGTGTGACCTGG + Intronic
1002706069 5:181161362-181161384 CCCATGTCTGCTGTGTGAGCAGG - Intergenic
1002871326 6:1169711-1169733 CCCTTCCCAGCTGTGTGACCCGG - Intergenic
1005967348 6:30736243-30736265 CTCCTCTCCTCTTTGAGACCGGG - Intronic
1006034055 6:31198170-31198192 CGCCTCTGTGCTGTGGGTCCAGG + Intronic
1007777713 6:44233099-44233121 CTCCTCTCAGCTCTGGGAGCAGG - Intronic
1008322645 6:50136098-50136120 CTGCCCTTAGCTGTGTGACCTGG + Intergenic
1009411966 6:63376299-63376321 TTGCTCTCTGCTGTGAGCCCAGG - Intergenic
1010543698 6:77124178-77124200 GCCCTCTCTGCTCTATGACCAGG + Intergenic
1011652463 6:89519250-89519272 CTTTTCTCTGCAGTATGACCAGG - Intronic
1012600170 6:101086781-101086803 CTCTGCTCTGCTCTGTGCCCAGG - Intergenic
1012620874 6:101341906-101341928 TCCCTCTCTGCAGTGTGACCTGG + Intergenic
1012658236 6:101853232-101853254 CTCTTCTTAGCTATGTGACCTGG + Intronic
1013155020 6:107485285-107485307 CTCCTCTCTTTTGTGAGACGTGG + Intergenic
1013283851 6:108663717-108663739 CTCATCACTGCTGCGTGACGTGG - Exonic
1013758981 6:113494253-113494275 CTCCTGTATACTGTGTGATCTGG - Intergenic
1013758996 6:113494384-113494406 CTCCTGTATACTGTGTGATCTGG - Intergenic
1016094445 6:140018951-140018973 CTCCTTTCTGCTATGGAACCTGG + Intergenic
1017898153 6:158699257-158699279 CTCTTCTCTCCTGGGTGACTTGG - Intronic
1018184708 6:161256470-161256492 CTGCTCTCTGCCGTGTGTCATGG + Intronic
1018906883 6:168080679-168080701 CCCCTCTGTGCTGTGTGTGCCGG - Intronic
1019497584 7:1347658-1347680 CTGCACCCTGCTGTGTAACCTGG + Intergenic
1019907116 7:4073167-4073189 CTCCTCTCTCCTCTGGGAGCTGG + Intronic
1019978442 7:4603215-4603237 CTCCTCCCTGATGTGTCTCCTGG + Intergenic
1023347701 7:39288298-39288320 CCCCTCTCAGCTATGTGACATGG + Intronic
1023858993 7:44205852-44205874 CTCCACTCTGGTGGGTGACTGGG - Intronic
1023981323 7:45072289-45072311 GTGGTTTCTGCTGTGTGACCTGG + Intronic
1024941422 7:54767303-54767325 TTGCTCTCTGCTGTGTGGCCAGG + Intergenic
1025201220 7:56963013-56963035 CTCCACCCTGCTGAGTGCCCTGG + Intergenic
1025248337 7:57334751-57334773 CACCTCTTGGCTGTGTGACCTGG + Intergenic
1025670724 7:63613920-63613942 CTCCACCCTGCTGAGTGCCCTGG - Intergenic
1026300633 7:69094904-69094926 TTCCTGTTTGCTGTGTGACCTGG - Intergenic
1026792847 7:73346041-73346063 TTCATCTCTGCTGTGTGCCTTGG - Intronic
1027530635 7:79327113-79327135 CTCTTCTCATCTGTGTGACCTGG + Intronic
1029183979 7:98725465-98725487 CTTCTCTCTGCTCTGTCCCCAGG + Intergenic
1030536407 7:110772336-110772358 CTCTTCTCTGCTGTCTGGTCAGG + Intronic
1030694731 7:112572376-112572398 CTCTTCTCTGCTCTGTGCCTAGG - Intergenic
1031045194 7:116879683-116879705 CACCTCCCTGCTGTGTGACCGGG + Intronic
1032467464 7:132155261-132155283 CACCTCCCTGCTGTGTAACCTGG + Intronic
1034405864 7:150902104-150902126 CTCCTTCCTTCTGTGTGTCCTGG - Intergenic
1035387017 7:158479871-158479893 ATCCTCGCTGCTGTGGGAGCGGG + Intronic
1036181444 8:6588772-6588794 CTCCTCTCTCCTCTCTGCCCAGG + Intronic
1036662523 8:10717054-10717076 CTTCTCTCTGCTTTGTGCCCTGG + Intergenic
1036750337 8:11439863-11439885 CTCCCCTGTGCTGAGTGCCCAGG + Intronic
1037826147 8:22161778-22161800 CTCCTCTCCCAGGTGTGACCAGG - Exonic
1038442999 8:27584699-27584721 CTCCTGTCTGCTCTGGGCCCTGG - Intergenic
1041409430 8:57536779-57536801 CTCCTCCCTGCTCTGTTACTTGG + Intergenic
1041434575 8:57824095-57824117 CTCATCTCTGCTGTTTTAGCAGG - Intergenic
1043361258 8:79475178-79475200 CTTCTCTCTGCACTGTGACCTGG - Intergenic
1044204714 8:89479248-89479270 CTCCTGACTGCTGTGTGTGCTGG + Intergenic
1045478013 8:102569534-102569556 CTCTGCTCTGCTGTGGGCCCGGG - Intergenic
1046760214 8:118012612-118012634 CGTCTCACTGCTGTTTGACCTGG + Intronic
1047050204 8:121102634-121102656 CTCCTTTCTGCTCTGTGATATGG + Intergenic
1048488323 8:134868920-134868942 CCCCTTCTTGCTGTGTGACCTGG - Intergenic
1049047904 8:140167097-140167119 CTTCTGTGTCCTGTGTGACCTGG - Intronic
1049184427 8:141242003-141242025 CTGCTCTTTTCTGTCTGACCTGG - Intronic
1049332720 8:142063728-142063750 GTCCTCTCTGCTCTGAGTCCCGG - Intergenic
1049365410 8:142234607-142234629 CCCAGCCCTGCTGTGTGACCAGG + Intronic
1052091566 9:24334959-24334981 CTCCTCTGTCCTGTCTGCCCTGG + Intergenic
1053121795 9:35552916-35552938 CTCCTCTCTGCTAAGTTCCCAGG - Intronic
1054814462 9:69461679-69461701 CACTTCACAGCTGTGTGACCTGG - Intronic
1055736494 9:79336384-79336406 GTCCTCTCTGCTCTATGCCCAGG - Intergenic
1056287695 9:85107975-85107997 ATCCTCCCTCCTGTGTCACCAGG - Intergenic
1057447493 9:95127569-95127591 CTCCTCTCCGCTGTGCGCCCAGG + Intronic
1057817047 9:98303587-98303609 CTACTCGCTTGTGTGTGACCTGG + Intronic
1057882704 9:98805346-98805368 CTCCACTCTGTTTTGTGCCCCGG + Intergenic
1058135007 9:101297338-101297360 CTCCTCTCGTCTGTGTGGCATGG + Intronic
1059646720 9:116275480-116275502 CCTCTGTGTGCTGTGTGACCTGG - Intronic
1060521310 9:124295560-124295582 CTGCCGCCTGCTGTGTGACCTGG + Intronic
1060667265 9:125439345-125439367 CTCCCACCTGCTGTGTGACCTGG + Intronic
1060746016 9:126131420-126131442 CTCCTCTCAGCACTGTGACCAGG + Intergenic
1060828560 9:126700056-126700078 CTCCTCTGCCCTGTGTTACCTGG - Exonic
1060994741 9:127869540-127869562 CTCTGTTCAGCTGTGTGACCTGG + Intronic
1061100135 9:128485849-128485871 CTTCTCTCTGTTGTCTGTCCAGG + Intronic
1061978747 9:134087736-134087758 CGCCTCTCAGCACTGTGACCTGG - Intergenic
1062108129 9:134766837-134766859 CTGCTCTCTGTGGTGGGACCCGG + Intronic
1062134317 9:134916675-134916697 CTCCTCTGAGCTTTGTGCCCTGG + Intronic
1187075726 X:15932491-15932513 CTCCTCTCTGTTCAGTGTCCTGG - Intergenic
1187098330 X:16168976-16168998 CTCAGCTCTGCTGTGCGCCCTGG + Intronic
1187206580 X:17187324-17187346 CTCTTCTTGGCTGTGTGCCCTGG - Intergenic
1187393235 X:18899268-18899290 CTCCTCTCTGCTGTGTCTCTTGG - Intronic
1187439769 X:19307483-19307505 CTCCACTCTGCTGTATGCCTGGG - Intergenic
1189438067 X:41010289-41010311 CCCCTCCCTGCTGTGTTTCCGGG + Intergenic
1190199854 X:48351435-48351457 CTGGTCTCTGCTGTGTTACTGGG - Intronic
1190338288 X:49276404-49276426 CACCTATCAGCTGTGTGACCTGG - Intronic
1190712476 X:53080761-53080783 CTCCTCTCTGCTCCGCGACAAGG + Intergenic
1192220659 X:69195410-69195432 CTCATCTCTGCTGTCAGGCCCGG + Intergenic
1193141531 X:78032819-78032841 ATCCTCTCTGCTGTTTGATTTGG - Intronic
1194572910 X:95574777-95574799 CCCCTTGCTGCTGTGTGCCCTGG + Intergenic
1198395312 X:136213741-136213763 CTCTTTCCAGCTGTGTGACCTGG + Intronic
1198557657 X:137812329-137812351 CTCCACTCTGCTTTGTGACCAGG - Intergenic
1198794282 X:140379144-140379166 CTACTCTCTGCTGTGAAGCCTGG + Intergenic
1199780127 X:151050891-151050913 CACTTAGCTGCTGTGTGACCTGG + Intergenic