ID: 1166567479

View in Genome Browser
Species Human (GRCh38)
Location 19:43774110-43774132
Sequence CTCAACCTGCACCGCGGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 90}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166567475_1166567479 -1 Left 1166567475 19:43774088-43774110 CCACTGCTTGGTCCTAGGGGGCC 0: 1
1: 0
2: 0
3: 8
4: 107
Right 1166567479 19:43774110-43774132 CTCAACCTGCACCGCGGCACAGG 0: 1
1: 0
2: 0
3: 2
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166567479 Original CRISPR CTCAACCTGCACCGCGGCAC AGG Intronic
900000434 1:12035-12057 CTCAGCTTGCACCCTGGCACAGG - Intergenic
900020148 1:182554-182576 CTCAGCTTGCACCCTGGCACAGG - Intergenic
900357917 1:2273589-2273611 CCCAACCTGCACCTCTGCCCTGG - Intronic
903255587 1:22096660-22096682 GACCACCTGCACCGCGGCACAGG - Intergenic
905714036 1:40132871-40132893 CTCAGCCTGCACAGCCGCAGCGG + Intergenic
916071862 1:161175124-161175146 CACAACCTGCAGGGCGGTACCGG + Exonic
920189175 1:204181478-204181500 CTCAGCCTGCACCATGCCACAGG - Intergenic
1063884277 10:10561891-10561913 CTGAACCTGCACCTAGGCCCTGG - Intergenic
1077059980 11:613780-613802 CTCACCTTGCACCGCGGTGCAGG + Exonic
1079708628 11:23653210-23653232 CTCCCCCTGCTCCACGGCACGGG - Intergenic
1080802348 11:35619606-35619628 AGCAACCTGCACCGCGGTCCGGG + Exonic
1084512278 11:69613700-69613722 CTCTAACTGCACGGTGGCACTGG - Intergenic
1085271541 11:75272973-75272995 CTCAACCTGCAAAGTGACACAGG + Exonic
1089214477 11:116827443-116827465 TCCAACCTGCACCCCGGCAGGGG - Intergenic
1089636400 11:119816135-119816157 CTCAACCTGCACATCCCCACTGG - Intergenic
1089893933 11:121908602-121908624 CTCAACCTGCTCTGGGGAACGGG - Intergenic
1091266633 11:134276630-134276652 CTGAGCCTGCCCCGCGGAACCGG + Intronic
1091373525 12:12166-12188 CTCAGCTTGCACCCTGGCACAGG - Intergenic
1092259654 12:6946158-6946180 CTCAACCTGCCCCGGGGGAAGGG - Intergenic
1092541445 12:9421840-9421862 CTCAGCTTCCACCCCGGCACAGG + Intergenic
1093435471 12:19130201-19130223 CGCAACCTGCCCCGCGCCGCGGG + Intronic
1094511598 12:31100663-31100685 CTCAGCTTCCACCCCGGCACAGG - Exonic
1096717860 12:53501755-53501777 TTCAACCTGCATTGGGGCACAGG + Intronic
1096838037 12:54363586-54363608 CTCCACCTGCACTGGCGCACCGG - Exonic
1113805994 13:113110243-113110265 CTCCACCCGCACCGCGTCTCCGG - Intronic
1116653836 14:47626917-47626939 CTCCACCTGCACCCCGGTGCGGG + Intronic
1120979693 14:90278966-90278988 CCCGGCCTGCCCCGCGGCACCGG - Intronic
1131977527 15:97961086-97961108 CTCGGCCAGCACCGCGGCCCTGG + Exonic
1132453073 15:101978910-101978932 CTCAGCTTGCACCCTGGCACAGG + Intergenic
1132453822 16:11716-11738 CTCAGCTTGCACCCTGGCACAGG - Intergenic
1132623521 16:879380-879402 CTCAGCCTGCAGCCCGGGACAGG + Intronic
1134057234 16:11178242-11178264 CCCATCCTGAACCGCGGCCCTGG - Intronic
1134570126 16:15283851-15283873 CTCCACCTGCACCCCTGCATAGG + Intergenic
1134732250 16:16472198-16472220 CTCCACCTGCACCCCTGCATAGG - Intergenic
1134935187 16:18239765-18239787 CTCCACCTGCACCCCTGCATAGG + Intergenic
1142291612 16:89195870-89195892 CTCCACCTGCACTGAGACACGGG + Exonic
1146639346 17:34528067-34528089 CACAACCTGCACAGCTACACAGG + Intergenic
1151226016 17:72648889-72648911 CTCAGCCAGCACCACGGCAAAGG + Exonic
1152596333 17:81239467-81239489 CTCCTCCTGCCCCGCAGCACTGG - Intronic
1152811519 17:82384929-82384951 CTGAACCTGCACAGCATCACAGG + Intergenic
1161767120 19:6214033-6214055 CTCAACCTGAACCGACACACGGG + Exonic
1166567479 19:43774110-43774132 CTCAACCTGCACCGCGGCACAGG + Intronic
1166863289 19:45821810-45821832 CACAGACTCCACCGCGGCACAGG + Intronic
936569290 2:113601382-113601404 CTCAGCTTGCACCCTGGCACAGG + Intergenic
938339745 2:130527544-130527566 CTCACCCTGCAGCGCGTCCCAGG + Intronic
938350091 2:130593206-130593228 CTCACCCTGCAGCGCGTCCCAGG - Intronic
1173584873 20:44174918-44174940 CGCAACCTCCACCCCTGCACGGG - Intronic
1174070793 20:47897701-47897723 CTCAAACTACACAGCAGCACCGG - Intergenic
1174100357 20:48122290-48122312 CTCAAACTACACAGCAGCACCGG + Intergenic
1174100518 20:48123193-48123215 CTCAAACTACACAGCAGCACCGG + Intergenic
1174153273 20:48500955-48500977 CTCAAACTACACAGCAGCACCGG + Intergenic
1179455851 21:41499504-41499526 CTCAGCCTCCACCGTGCCACAGG + Intronic
1182696668 22:32203264-32203286 CTCAACCAGCCCCTCGCCACAGG + Exonic
1184520900 22:44993401-44993423 CTCATCCACCACAGCGGCACCGG + Intronic
953846804 3:46433972-46433994 CTCTGCCTGCACAGCTGCACAGG - Intergenic
960261305 3:115571604-115571626 CTCAAGCTGCAGGGTGGCACTGG + Intergenic
966851743 3:184169027-184169049 CTCACCCTGCCCAGCAGCACTGG + Intronic
975373961 4:73620619-73620641 CCCAACATGCACTGAGGCACAGG - Exonic
975754924 4:77562354-77562376 CTCCACCTGCACCGGGGTGCAGG + Intronic
979540080 4:121870665-121870687 CTCCACCCTCACCGCGGCCCAGG + Intergenic
985723471 5:1502673-1502695 CTAAACCTGCACCTCAGGACTGG - Intronic
992111123 5:73495137-73495159 CTCAACCTGCACTCCAGAACTGG - Intergenic
1005675876 6:28154177-28154199 ATCAACCTTCACCAAGGCACTGG - Exonic
1006372761 6:33655636-33655658 CTCTACCTGCAGCGGGGAACGGG + Intronic
1010408871 6:75537784-75537806 CTCAACCTCCACATGGGCACAGG + Intergenic
1013253282 6:108356976-108356998 CACAACCTGCACAGCTGCACAGG + Intronic
1015773592 6:136792483-136792505 CTTGAGCTGCACCGCGGCGCAGG - Exonic
1017009547 6:150054018-150054040 CTCAAACTACACAGCAGCACTGG + Intergenic
1018622887 6:165748933-165748955 CTCAAATTGCACAGCGGCAGTGG - Intronic
1019593884 7:1849564-1849586 CTCAGCCTGCACTGCTGGACAGG + Exonic
1020274205 7:6615213-6615235 CACAATTTGCACCGCGGCAGGGG + Intergenic
1023926331 7:44672558-44672580 CTCGACCTGCACAGCTGCCCTGG - Intronic
1025233755 7:57219941-57219963 CTCAAACTACACAGCAGCACCGG - Intergenic
1026185575 7:68080348-68080370 CCCAACCTCCACCGCTGGACTGG - Intergenic
1026978440 7:74512864-74512886 CTCATCGTGCACGGCGACACAGG - Exonic
1032721166 7:134551871-134551893 CTCACCCTGCCCCGCAGCAGAGG + Intronic
1032836985 7:135683665-135683687 CTCACCCTCCACCCCGGCCCAGG - Intronic
1033659513 7:143393859-143393881 CATAACCTGCACGGCGGGACAGG + Exonic
1034447072 7:151119200-151119222 CACAACCTGCCCCTCGGGACAGG - Intronic
1034619924 7:152449073-152449095 CTGAGACTGCACCGCTGCACTGG - Intergenic
1035641720 8:1189221-1189243 CTCAACCCCAACCGCGGAACCGG - Intergenic
1037477870 8:19275477-19275499 GTCAACCTGCAGGGCTGCACTGG + Intergenic
1040918285 8:52586711-52586733 CTTAACGTGCTCAGCGGCACAGG - Intergenic
1045489088 8:102655748-102655770 CTCAGCCTGCCCCGCGCCGCGGG + Exonic
1049107922 8:140625145-140625167 CTCAGCCTGCACCTGGGCCCTGG + Intronic
1049883238 9:12148-12170 CTCAGCTTGCACCCTGGCACAGG - Intergenic
1055565647 9:77566078-77566100 CTCAACCTCAACCTCAGCACCGG - Intronic
1059380336 9:113918788-113918810 CTCATCTTGCACCCCGGCCCTGG + Intronic
1062554047 9:137106069-137106091 CTCACCCTGCAGCTCGGCCCTGG + Intronic
1062554430 9:137107579-137107601 TTCTACCTGTACCGCGTCACAGG + Exonic
1185747676 X:2584880-2584902 CTCACCCTGCACCCCGGTATGGG + Intergenic
1190984413 X:55488505-55488527 CCCCACCCGCACCGCGGCCCAGG - Exonic
1200402575 X:156028000-156028022 CTCAGCTTGCACCCTGGCACAGG + Intergenic