ID: 1166569958

View in Genome Browser
Species Human (GRCh38)
Location 19:43788827-43788849
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 412788
Summary {0: 7, 1: 223, 2: 4133, 3: 45828, 4: 362597}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166569958 Original CRISPR TGTAATCTCAGTACTTCAGG AGG (reversed) Intergenic
Too many off-targets to display for this crispr