ID: 1166570296

View in Genome Browser
Species Human (GRCh38)
Location 19:43791632-43791654
Sequence CCTGGAAGGCAGAGCTTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166570296_1166570303 16 Left 1166570296 19:43791632-43791654 CCCTGCAAGCTCTGCCTTCCAGG No data
Right 1166570303 19:43791671-43791693 GCCTCAGCCTCCCATGTAGCTGG 0: 1096
1: 87190
2: 195781
3: 235467
4: 229201
1166570296_1166570305 17 Left 1166570296 19:43791632-43791654 CCCTGCAAGCTCTGCCTTCCAGG No data
Right 1166570305 19:43791672-43791694 CCTCAGCCTCCCATGTAGCTGGG 0: 1327
1: 99928
2: 208308
3: 246635
4: 263389
1166570296_1166570307 25 Left 1166570296 19:43791632-43791654 CCCTGCAAGCTCTGCCTTCCAGG No data
Right 1166570307 19:43791680-43791702 TCCCATGTAGCTGGGACTACAGG 0: 604
1: 45418
2: 160044
3: 221973
4: 226723

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166570296 Original CRISPR CCTGGAAGGCAGAGCTTGCA GGG (reversed) Intergenic
No off target data available for this crispr