ID: 1166571294

View in Genome Browser
Species Human (GRCh38)
Location 19:43798678-43798700
Sequence CCCCGAGACGTGCTAGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 29}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166571294_1166571303 15 Left 1166571294 19:43798678-43798700 CCCGCGCCTAGCACGTCTCGGGG 0: 1
1: 0
2: 0
3: 3
4: 29
Right 1166571303 19:43798716-43798738 CGCCAAGAGCAGGCGCCCAGCGG 0: 1
1: 0
2: 0
3: 14
4: 127
1166571294_1166571305 18 Left 1166571294 19:43798678-43798700 CCCGCGCCTAGCACGTCTCGGGG 0: 1
1: 0
2: 0
3: 3
4: 29
Right 1166571305 19:43798719-43798741 CAAGAGCAGGCGCCCAGCGGAGG 0: 1
1: 0
2: 1
3: 8
4: 141
1166571294_1166571301 5 Left 1166571294 19:43798678-43798700 CCCGCGCCTAGCACGTCTCGGGG 0: 1
1: 0
2: 0
3: 3
4: 29
Right 1166571301 19:43798706-43798728 GATCCTAGCGCGCCAAGAGCAGG 0: 1
1: 0
2: 0
3: 1
4: 23

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166571294 Original CRISPR CCCCGAGACGTGCTAGGCGC GGG (reversed) Intronic
901807144 1:11745691-11745713 CCCTCAGAGGTGCCAGGCGCAGG + Intronic
920385616 1:205568840-205568862 CCCCGTGCGGTGCCAGGCGCCGG - Intergenic
1068299393 10:55119036-55119058 CCAGGAGACGTGCCAGGTGCAGG - Intronic
1078648425 11:13164147-13164169 CCCTGAAATGTGCTAGGCCCTGG - Intergenic
1081709831 11:45209499-45209521 GCCAGAGCCGTGCTAGGAGCTGG + Intronic
1089703086 11:120257421-120257443 CCCCGAGATGTGGCAGGAGCAGG - Intronic
1102146871 12:110661022-110661044 CCCCGGCACGTGGTAGGTGCTGG + Intronic
1127547353 15:60003799-60003821 CCCCGGGTAGTGCTAAGCGCAGG + Intergenic
1129360912 15:75023605-75023627 CCCCGAGACGCGCCTGGCGCGGG + Exonic
1142198560 16:88750368-88750390 CCCAGACACGTGCTGGGGGCAGG - Intronic
1153320705 18:3771450-3771472 CCCGGAGACGCGCTCGGCCCGGG + Intronic
1160810083 19:1009485-1009507 CCCCGAGCTGTGCCAGGAGCTGG - Exonic
1161255283 19:3305400-3305422 ACCCGTGACCTGCTAGGCCCAGG + Intergenic
1161596592 19:5153971-5153993 CTGGCAGACGTGCTAGGCGCTGG + Intergenic
1166571294 19:43798678-43798700 CCCCGAGACGTGCTAGGCGCGGG - Intronic
931630735 2:64296265-64296287 CCCAGAGAGGTGCTAGGGACAGG + Intergenic
934737801 2:96698760-96698782 CCCCCAGCCGTGCTTGGTGCGGG + Intergenic
950444241 3:13027047-13027069 CCCAGAGCCATGCAAGGCGCAGG + Intronic
968285142 3:197504175-197504197 CCCCGCGTTGTGCCAGGCGCTGG + Intergenic
986320971 5:6632808-6632830 CCCCGAGGCCTGCGAGGCGGCGG - Intronic
991371683 5:65925977-65925999 CCCCGAGACGCGCAGGGGGCGGG - Intergenic
1002063667 5:176641646-176641668 CCCTGGTACGTGCTAGGCACAGG - Intronic
1002065136 5:176647989-176648011 CCCAGGGGCGTGCTAGGTGCAGG + Intronic
1005475615 6:26204749-26204771 CCCCGCGACGAGCAAGGCGCCGG - Exonic
1005484327 6:26285373-26285395 CGCCGCGACGAGCAAGGCGCCGG + Exonic
1007390385 6:41546987-41547009 GCCCGAGACGCGCTGGGCGCCGG + Intronic
1046239278 8:111470519-111470541 CCCCGCGACTTGATAGGGGCGGG - Intergenic
1049694065 8:143975099-143975121 TCCCGCTGCGTGCTAGGCGCTGG - Intronic
1061832629 9:133305101-133305123 CCCGGGGAAGTGCAAGGCGCAGG + Intergenic
1062637585 9:137499700-137499722 CCCCGAGCCGGGCAAGGGGCAGG - Intronic
1196925498 X:120629916-120629938 CCCCAAGCCGTTCTAGACGCGGG - Exonic
1197271148 X:124426061-124426083 CCAAGAGATGTGCTAGGCACTGG + Intronic
1197628171 X:128826856-128826878 CACTGAGACTTGCTAGGCACAGG - Intergenic